Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

Supplementary Information

Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

CELLS. Cells. Basic unit of life (except virus)

Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

Cell signaling. How do cells receive and respond to signals from their surroundings?

Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure 1. Transcriptional changes are dependent upon Fpn and occur in peritoneal macrophages. A. Mouse bone marrow macrophages were transfected with either WT Fpn-GFP

Maturity-onset diabetes of the young (MODY) is a heterogeneous group

Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the

Cell Cell Communication

IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven

ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e

ACCESSORY PUBLICATION Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals after tick larval challenge e GenBank Accession a No. of elemen ts b t=0 Signal intensity c t=0 Description

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

* Kyoto Encyclopedia of Genes and Genomes.

Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

Cell Cell Communication

IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Question No. 1 of 10 Question 1. Which of the following statements about the nucleus is correct? Question #01 A. The

Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective

BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death

Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:

For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

Supplemental Table 1 Age and gender-specific cut-points used for MHO.

Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123

Developing a clinically feasible personalized medicine approach to pediatric

Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott

Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles

Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI 10.5012/bkcs.2011.32.6. Supporting Information Evaluation of Toxicity and Gene Expression

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age Gene Description Score Fold-change Classification Sephs2 selenophosphate synthase 2 2.680 3.7 Metabolism

INTERACTION DRUG BODY

INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

Effects of Second Messengers

Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many

Principles of Genetics and Molecular Biology

Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.

BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which

Proteasomes. When Death Comes a Knock n. Warren Gallagher Chem412, Spring 2001

Proteasomes When Death Comes a Knock n Warren Gallagher Chem412, Spring 2001 I. Introduction Introduction The central dogma Genetic information is used to make proteins. DNA RNA Proteins Proteins are the

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

MOLECULAR CELL BIOLOGY

1 Lodish Berk Kaiser Krieger scott Bretscher Ploegh Matsudaira MOLECULAR CELL BIOLOGY SEVENTH EDITION CHAPTER 13 Moving Proteins into Membranes and Organelles Copyright 2013 by W. H. Freeman and Company

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

Online Supporting Information. Global gene expression profiling in larval zebrafish exposed to microcystin-lr and Microcystis

Online Supporting Information Global gene expression profiling in larval zebrafish exposed to microcystin-lr and Microcystis reveals endocrine disrupting effects of cyanobacteria Emily D. Rogers, 1,2 Theodore

1. (a. Homeostasis / b. Feedback) is a state of constancy of conditions inside the human body

PLEASE BE AWARE CONTENT COVERED ON EXAMS VARIES FROM ONE SEMESTER TO ANOTHER. THIS EXAM MAY NOT CONTAIN MATERIAL THAT WILL BE ON YOUR EXAM THIS SEMESTER, AND/OR MAY CONTAIN MATERIAL THAT WILL NOT BE COVERED

Organelles of the Cell & How They Work Together. Packet #7

Organelles of the Cell & How They Work Together Packet #7 Introduction Introduction Organization of cells is basically similar in all cells. Additionally, most cells are tiny Ranging from 1 1000 cubic

Biomarkers for Hypothesis Testing

Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,

Project Summary. Characterization of intramuscular adipogenesis in cattle

Project Summary Characterization of intramuscular adipogenesis in cattle Principal Investigators: J. B. Morgan, R. D. Geisert, U. DeSilva, C. R. Krehbiel, J. R. Malayer, and D. Stein Oklahoma State University

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire

Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond

Supplemental Figure 1

Supplemental Figure 1 A B Immune Tissues Non-Immune Tissues Immune Tissues Non-Immune Tissues thymus fetal liver spleen germinal center B cells spleen blood lymph node leukemia T cell (Jurkat) tonsil lymphoma

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-15 FUNDAMENTALS OF CELL BIOLOGY AND BIOCHEMISTRY BIO-4004B Time allowed: 2 hours Answer ALL questions in Section

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

Endoplasmic Reticulum

Endoplasmic Reticulum What s ER? How is ER? Why is ER? definition description functions Nissl s bodies neurons Berg s bodies hepatocytes Organelle structure histocytochemical evidences Ergastoplasm pancreatic

7.012 Problem Set 6 Solutions

Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

BL 424 Chapter 15: Cell Signaling; Signal Transduction

BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be

Organelles of the Cell & How They Work Together. Packet #5

Organelles of the Cell & How They Work Together Packet #5 Developed by Mr. Barrow 2018 1 Introduction Organization of cells is basically similar in all cells. Additionally, most cells are tiny Ranging

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

Cellular Physiology (PHSI3009) Contents:

Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

Organelles of the Cell & How They Work Together. Packet #5

Organelles of the Cell & How They Work Together Packet #5 Developed by Mr. Barrow 2018 1 Introduction Organization of cells is basically similar in all cells. Additionally, most cells are tiny Ranging

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

The elements of G protein-coupled receptor systems

The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch

Regulation of cell function by intracellular signaling

Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation

Supporting Information

Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

Genome-wide analysis of pain-, nerve- and neurotrophin -related gene expression in the degenerating human annulus

Gruber et al. Molecular Pain 2012, 8:63 MOLECULAR PAIN RESEARCH Genome-wide analysis of pain-, nerve- and neurotrophin -related gene expression in the degenerating human annulus Helen E Gruber 1,2*, Gretchen

Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy

(Courtesy of Magda Stumpfova. Used with permission.) Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy M.D. Gomes, S.H. Lecker, R.T. Jagoe, A. Navon, and A.L. Goldberg PNAS,

Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine

Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine dr.abuhassand@gmail.com An overview of cellular components Endoplasmic reticulum (ER) It is a network of membrane-enclosed

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation

The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte

Name Section Problem Set 6

Name Section 7.012 Problem Set 6 Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed of lipids

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B

Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein

5/12/2015. Cell Size. Relative Rate of Reaction

Cell Makeup Chapter 4 The Cell: The Fundamental Unit of Life We previously talked about the cell membrane The cytoplasm is everything inside the membrane, except the nucleus Includes Cytosol = liquid portion

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

Lecture 36: Review of membrane function

Chem*3560 Lecture 36: Review of membrane function Membrane: Lipid bilayer with embedded or associated proteins. Bilayers: 40-70% neutral phospholipid 10-20% negative phospholipid 10-30% cholesterol 10-30%

Biosignals, Chapter 8, rearranged, Part I

Biosignals, Chapter 8, rearranged, Part I Nicotinic Acetylcholine Receptor: A Ligand-Binding Ion Channel Classes of Receptor Proteins in Eukaryotes, Heterotrimeric G Proteins Signaling View the Heterotrimeric

Supplementary Materials for

advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan

Lecture: CHAPTER 13 Signal Transduction Pathways

Lecture: 10 17 2016 CHAPTER 13 Signal Transduction Pathways Chapter 13 Outline Signal transduction cascades have many components in common: 1. Release of a primary message as a response to a physiological

Supporting Information

Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

A. Major parts 1. Nucleus 2. Cytoplasm a. Contain organelles (see below) 3. Plasma membrane (To be discussed in Cellular Transport Lecture)

Lecture 5: Cellular Biology I. Cell Theory Concepts: 1. Cells are the functional and structural units of living organisms 2. The activity of an organism is dependent on both the individual and collective

REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25

REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition

Protein tyrosine kinase signaling

rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular

PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b

PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL 19 99 0.0245 RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b SAVENILEHL 32 91-0.0019 RS29_MOUSE 40S ribosomal protein S29

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system

Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

Fatty acids synthesis

Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

Receptors Functions and Signal Transduction- L4- L5

Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway

Cancer genetics

Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1

Significance of the MHC

CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ