CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
|
|
|
- Lester Reeves
- 6 years ago
- Views:
Transcription
1 CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven Summerfelt and Bendik Fyhn Terjesen * Norwegian Institute of Food, Fisheries and Aquaculture Research Nofima vasco.mota@nofima.no
2 Problem definition Fish exposed to high CO 2 shows: Lower: oxygen consumption, feed intake, growth Higher: Nephrocalcinosis (deposits in kidneys) & cataracts Impaired osmoregulation and blood acidosis Gene expression changes Dissolved CO 2 accumulates in RAS Recommendation for Atlantic salmon: mg/l Atlantic salmon CO 2 tolerance in RAS is unknown
3 OBJECTIVE Carbon dioxide tolerance of Atlantic salmon post-smolts in RAS Foto: Aquafarm Equipment Vasco Mota - Overview of Atlantic salmon RAS and CtrlAQUA developments 21 August
4 Experimental design
5
6 Experimental system Water quality Oxygen >85 % Salinity 12 ppt Temperature C ph Alkalinity mg/l
7
8 R: health & welfare No observed effects on: haematocrit glucose hepatosomatic Index eye cataracts welfare score (skin & fins) nephrocalcinosis
9 Genes RAS 40 FTS 40 RAS 5 FTS 5 40R1>3100.diff_corr 40R2>3101.diff_corr 40R3>3102.diff_corr 40R4>3103.diff_corr 40R5>3104.diff_corr 40R6>3105.diff_corr 40S1>3106.diff_corr 40S2>3107.diff_corr 40S3>3108.diff_corr 40S4>3109.diff_corr 40S5>3110.diff_corr 40S6>3111.diff_corr 5R1>3112.diff_corr 5R2>3113.diff_corr 5R3>3114.diff_corr 5R4>3115.diff_corr 5R5>3116.diff_corr 5R6>3117.diff_corr 5S1>3118.diff_corr 5S2>3119.diff_corr 5S3>3120.diff_corr 5S4>3121.diff_corr 5S5>3122.diff_corr 5S6>3123.diff_corr Tpr protein - Ident Ankycorbin Dystonin Tektin Keratin_ type I cytoskeletal 18 - Ident Tubulin--tyrosine ligase-like protein Exosome complex exonuclease RRP4 [Salmo salar] Dexamethasone-induced Ras-related protein precursor [Salmo salar] Rho GTPase-activating protein AP-1 complex subunit gamma-like 2 [Salmo salar] Diaphanous Telomerase-binding protein EST1A E3 ubiquitin-protein ligase MARCH MHC class I antigen [Salmo salar] TAP2b [Salmo salar] CC chemokine with stalk CK2 [Oncorhynchus mykiss] C-C motif chemokine 8 precursor [Salmo 0.30 salar] C-X-C chemokine C-X-C chemokine Complement component C7 [Salmo salar] Complement component C8 gamma chain 1.57precursor [Salmo 0.97 salar] SAPS domain family member 3 [Salmo-1.29 salar] Small inducible cytokine A13 [Oncorhynchus mykiss] Small inducible cytokine A13 [Oncorhynchus mykiss] putative interferon-alpha/beta receptor 0.12 alpha chain [Oncorhynchus mykiss] Complement component 9, Perforin precursor fish virus induced TRIM protein [Oncorhynchus mykiss] Gig Gig Gig ISG15-like Ubiquitin protein ligase E3A, hect domain ZNF C-type lectin domain family 4 member 0.56 E [Salmo -0.89salar] C-type lectin M4, cd209l Fish-egg lectin [Salmo salar] Rhamnose binding lectin STL2 [Oncorhynchus mykiss] Rhamnose-binding lectin precursor [Salmo salar] Growth factor independent Matrix metalloproteinase modified T cell receptor alpha [Salmo salar] TNF receptor member 11B S100 calcium binding protein A10b aminolevulinate synthase, erythroid-specific, mitochondrial precursor [Salmo salar] Cytidine deaminase [Salmo salar] Ectonucleoside triphosphate diphosphohydrolase [Salmo-0.57 salar] Carboxypeptidase A1 precursor [Salmo 0.43 salar] Nucleolar protein 5 [Salmo salar] Poly polymerase 10 [Salmo salar] Fatty aldehyde dehydrogenase [Salmo-1.52 salar] Sulfotransferase family cytosolic 2B member [Salmo salar] Claudin-like protein ZF4A22 [Salmo salar] Fibulin-1 [Salmo salar] Nephronectin variant 2 - Ident Otoancorin Glucocorticoid receptor Inactive serine protease PAMR Solute carrier family 13 member 3, slsc13a Tripartite motif-containing protein [Salmo-1.56 salar] homeobox protein HoxC8ba [Salmo salar] Lim homeobox protein 3 [Salmo salar] Extracellular matrix protein 1 precursor [Salmo salar] leukolectin protein [Salmo salar] leukolectin protein [Salmo salar] Up-regulator of cell proliferation Col6a2 protein - Ident GMP Giant mucus protein Calcitonin-1 precursor [Salmo salar] growth hormone receptor isoform 1 precursor [Salmo salar] Angiogenin-1 precursor / RNase ZF G-protein coupled receptor UDP-GlcNAc:betaGal beta-1_3-n-acetylglucosaminyltransferase-like Ident Optineurin [Salmo salar] Synaptobrevin homolog ykt6 [Oncorhynchus mykiss] Synaptosomal-associated protein 25-A [Salmo salar] Zymogen granule membrane protein precursor 0.06 [Salmo salar] Zymogen granule membrane protein precursor [Salmo salar] Ceacam EGF-like domain-containing protein 7 precursor [Salmo -2.49salar] Fibronectin 1b - Ident Leucine rich repeat containing 8 family_ member C Tetraspanin-1 [Salmo salar] Uncharacterized protein Uncharacterized protein Uncharacterized protein Unknown Ankyrin repeat and SAM domain-containing protein Immunoglobulin superfamily member R: gene expression microarray Gill: low DEG / gene suppression in RAS
10 R: physiology Negative correlation choride vs. bicarbonate Positive regression CO 2 plasma vs. water
11 R: fish growth
12 R: fish body weight
13 R: fish body weight
14
15 Conclusions no mortalities, cataracts, nephrocalcinosis or poor external welfare observed in fish exposed to CO 2 from 5 40 mg/l the highest non-observed effect concentration for several ions and growth was 5 mg/l Three take home messages Atlantic salmon very resilient to high CO 2 CO 2 has a growth penalty, and this penalty starts at lower concentrations than previously reported (<12 mg/l) early production conditions have a carry-over effect on fish performance at later phases
16 Special thanks to Michele Gallo, Jascha Gerwins, and all user partners, researchers, and technicians who have contributed. Thank you for your attention. Vasco Mota Contact:
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in
HOST RESPONSE AGAINST SALMON LOUSE what have we learned so far?
Norwegian University of Life Sciences () Department of Basic Sciences & Aquatic Medicine HOST RESPONSE AGAINST SALMON LOUSE what have we learned so far? Stanko Skugor 1, Helle Holm 1, Anne Kari Osmo 2,
Effects of water salinity and exercise on Atlantic salmon performance as postsmolts in land-based closedcontainment
Effects of water salinity and exercise on Atlantic salmon performance as postsmolts in land-based closedcontainment systems B.F. Terjesen 1*, T. Ytrestøyl 1, J. Kolarevic 1, S. Calabrese 2,3, B.O. Rosseland
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Cetoleic acid makes pelagic fish more healthy
Cetoleic acid makes pelagic fish more healthy WORKSHOP IN FISHMEAL AND FISH OIL, NOVEMBER 2018 Bente Ruyter Nofima Omega-3 fatty acids and health Eye Brain Cell membrane The marine omega-3 fatty acids
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
T cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
Hormones and Signal Transduction. Dr. Kevin Ahern
Dr. Kevin Ahern Signaling Outline Signaling Outline Background Signaling Outline Background Membranes Signaling Outline Background Membranes Hormones & Receptors Signaling Outline Background Membranes
The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation
The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Abstract. Introduction
Functional Feeds Reduce Heart Inflammation and Pathology in Atlantic Salmon (Salmo salar L.) following Experimental Challenge with Atlantic Salmon Reovirus (ASRV) Laura Martinez-Rubio 1 *, Sofia Morais
KEY CONCEPT The overall process of cellular respiration converts sugar into ATP using oxygen.
KEY CONCEPT The overall process of cellular respiration converts sugar into ATP using oxygen. ! Cellular respiration makes ATP by breaking down sugars. Cellular respiration is aerobic, or requires oxygen.
Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment
Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment MODULE 1: PRINCIPLES OF CELL FUNCTION Membrane Structure & Function Cellular membranes are fluid mosaics of lipids and proteins Phospholipids
BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
Tutorial 27: Metabolism, Krebs Cycle and the Electron Transport Chain
Tutorial 27: Metabolism, Krebs Cycle and the Electron Transport Chain Goals: To be able to describe the overall catabolic pathways for food molecules. To understand what bonds are hydrolyzed in the digestion
Moderator Hamish Rodger ( Fish Vet Group )
Husbandry / Physiology Thursday September 6 th Langeve / Cartier Husbandry / Physiology Moderator Hamish Rodger ( Fish Vet Group ) 3:5 PM Timmerhaus - Effects of Low to Very High Water Velocities on Atlantic
Elevated carbon dioxide alters neural signaling and anti-predator behaviors in ocean phase coho salmon (Oncorhynchus kisutch)
Western Washington University Western CEDAR Salish Sea Ecosystem Conference 2018 Salish Sea Ecosystem Conference (Seattle, Wash.) Apr 5th, 3:30 PM - 3:45 PM Elevated carbon dioxide alters neural signaling
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
Deciphering multiple stressor effects of gamma radiation and uranium on Atlantic salmon (Salmo salar): Transcriptomics-based mixture modeling
Deciphering multiple stressor effects of gamma radiation and uranium on Atlantic salmon (Salmo salar): Transcriptomics-based mixture modeling Y. Song, J. Asselman, K.A.C. De Schamphelaere, B. Salbu, and
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
DIETARY LIPIDS, IMMUNE FUNCTION AND PATHOGENESIS OF DISEASE IN FISH
DIETARY LIPIDS, IMMUNE FUNCTION AND PATHOGENESIS OF DISEASE IN FISH Santosh P. Lall and Joyce E. Milley National Research Council Canada, Institute for Marine Biosciences, 1411 Oxford Street, Halifax,
Lesson Overview. Cellular Respiration: An Overview. 9.2 process of cell respiration
9.2 process of cell respiration Glycolysis During glycolysis, glucose is broken down into 2 molecules of the 3-carbon molecule pyruvic acid. Pyruvic acid is a reactant in the Krebs cycle. ATP and NADH
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
Reduced dietary levels of EPA and DHA have a major impact on the composition of
Supplementary materials Reduced dietary levels of EA and DHA have a major impact on the composition of skin membrane lipids in Atlantic salmon (Salmo salar L.) Ken Cheng *,, Marta Bou, Bente Ruyter, Jana
Signaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
Principles of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
Quantidoc AS. The presence of health. Slimy Barriers: The first defense in disease
Quantidoc AS The presence of health Slimy Barriers: The first defense in disease 1 HIGH MORTALITY & LOW PERFORMANCE in fish farming Costs have increased by more than 50% in 10 years. Transfer losses 11
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
BIOLOGY - CLUTCH CH.9 - RESPIRATION.
!! www.clutchprep.com CONCEPT: REDOX REACTIONS Redox reaction a chemical reaction that involves the transfer of electrons from one atom to another Oxidation loss of electrons Reduction gain of electrons
Contents The Cytokine System The Discovery of the Brain Immunomodulators
Contents 1 The Cytokine System... 1 1.1 Inducible Character of Cytokine Formation and Reception... 1 1.2 Locality of Cytokine Action... 2 1.3 Superfluity of Cytokine System... 2 1.4 Interrelationship and
Osmoregulation and Osmotic Balance
OpenStax-CNX module: m44808 1 Osmoregulation and Osmotic Balance OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this
Anatomy 36 Study Guide Unit 3
Anatomy 36 Study Guide Unit 3 Chapter 11 Amine hormones Peptide hormones Steroid hormones 11 4 Hormones of the adrenal cortex 11 6 Hormones of the gonads Categories of hormones Table 11 2 Hormone receptors
The unstable production of grouper fry in the hatchery is one of the constraints in the
Effect of KIKO technology on growth and survival of grouper Epinephelus fuscoguttatus larvae Ofelia S. Reyes Aquaculture Department Southeast Asian Fisheries Development Center 5021 Tigbauan, Iloilo, Philippines
Excretion. Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes. Hormonal Control
Excretion Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes Hormonal Control Ingestion Storage Lipid Carbohydrate Mobilization Lipid Carbohydrate Protein Adsorption
1. Cyanide is introduced into a culture of cells and is observed binding to a mitochondrion, as shown in the diagram below.
1. Cyanide is introduced into a culture of cells and is observed binding to a mitochondrion, as shown in the diagram below. The following observations are made: Cyanide binds to and inhibits an enzyme
7 Pathways That Harvest Chemical Energy
7 Pathways That Harvest Chemical Energy Pathways That Harvest Chemical Energy How Does Glucose Oxidation Release Chemical Energy? What Are the Aerobic Pathways of Glucose Metabolism? How Is Energy Harvested
Ben JG Sutherland 1, Kim W Koczka 1, Motoshige Yasuike 1,2, Stuart G Jantzen 1, Ryosuke Yazawa 1,3, Ben F Koop 1* and Simon RM Jones 1,4
Sutherland et al. BMC Genomics 2014, 15:200 RESEARCH ARTICLE Open Access Comparative transcriptomics of Atlantic Salmo salar, chum Oncorhynchus keta and pink salmon O. gorbuscha during infections with
UNDERSTANDING YOUR WATER PROFILE PRESENTED BY POULTRY PARTNERS AND AHPD
UNDERSTANDING YOUR WATER PROFILE PRESENTED BY POULTRY PARTNERS AND AHPD WHY DOES IT MATTER? Water intake for commercial poultry breeds is 1.5-2x greater than feed intake Commercial birds drink more now
ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e
ACCESSORY PUBLICATION Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals after tick larval challenge e GenBank Accession a No. of elemen ts b t=0 Signal intensity c t=0 Description
MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:
For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)
4. Which step shows a split of one molecule into two smaller molecules? a. 2. d. 5
1. Which of the following statements about NAD + is false? a. NAD + is reduced to NADH during both glycolysis and the citric acid cycle. b. NAD + has more chemical energy than NADH. c. NAD + is reduced
2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above
Biochem 1 Mock Exam 3 Chapter 11: 1. What is glucose completely oxidized into? a. Carbon Dioxide and Water b. Carbon Dioxide and Oxygen c. Oxygen and Water d. Water and Glycogen 2. What is molecular oxygen
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Respiration Practice Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Which of the following statements describes NAD+? A) NAD+ can donate
CELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
Kortner et al. BMC Veterinary Research 2012, 8:101
Kortner et al. BMC Veterinary Research 2012, 8:101 RESEARCH ARTICLE Open Access Dietary soyasaponin supplementation to pea protein concentrate reveals nutrigenomic interactions underlying enteropathy in
Endocrine System Hormones. AP Biology
Endocrine System Hormones 2007-2008 Regulation Why are hormones needed? u chemical messages from one body part to another u communication needed to coordinate whole body u daily homeostasis & regulation
Biosecurity in Water Recirculation Aquaculture Systems. Christopher Good. Biosafety and Biocontainment Symposium Baltimore, Maryland February 6-9
Biosecurity in Water Recirculation Aquaculture Systems Christopher Good Biosafety and Biocontainment Symposium Baltimore, Maryland February 6-9 Research at The Freshwater Institute At Issue Courtesy of
Biology /08 Released Exam August 2008 Form A Provincial Examination Answer Key
Biology 12 2007/08 Released Exam August 2008 Form A Provincial Examination Answer Key Cognitive Processes K = Knowledge U = Understanding = igher Mental Processes Weightings 22% 58% 20% Types 67 = Multiple
Cellular Respiration and Fermentation
Name Class Date 9 Cellular Respiration and Fermentation Big idea Cellular Basis of Life Q: How do organisms obtain energy? WHAT I KNOW WHAT I LEARNED 9.1 Why do most organisms undergo the process of cellular
ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
Marah Bitar. Faisal Nimri ... Nafeth Abu Tarboosh
8 Marah Bitar Faisal Nimri... Nafeth Abu Tarboosh Summary of the 8 steps of citric acid cycle Step 1. Acetyl CoA joins with a four-carbon molecule, oxaloacetate, releasing the CoA group and forming a six-carbon
Nitrogen Metabolism. Overview
Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak
Immune Surveillance. Immune Surveillance. Immune Surveillance. Neutrophil granulocytes Macrophages. M-cells
he immune system is everywhere Some organs have developed strategies towards the immune system to keep it out or to put it under control Immune privileged organs: Brain Eye estis hyroid gland Humoral immunity
Immune System AP SBI4UP
Immune System AP SBI4UP TYPES OF IMMUNITY INNATE IMMUNITY ACQUIRED IMMUNITY EXTERNAL DEFENCES INTERNAL DEFENCES HUMORAL RESPONSE Skin Phagocytic Cells CELL- MEDIATED RESPONSE Mucus layer Antimicrobial
Enzymes and Metabolism
PowerPoint Lecture Slides prepared by Vince Austin, University of Kentucky Enzymes and Metabolism Human Anatomy & Physiology, Sixth Edition Elaine N. Marieb 1 Protein Macromolecules composed of combinations
Cell Signaling (part 1)
15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular
Inflammatory Bowel Disease - Target Initial Survey
Date: / / This document has been created as input for the upcoming target evaluation meeting with where this initial candidate list will be discussed. After the evaluation meeting Euretos will undertake
'Namgis First Nation's "KUTERRA" Project:
'Namgis First Nation's "KUTERRA" Project: Managing Atlantic salmon well-being in a newly operational land-based recirc. grow-out system Tyler Stitt DVM MPH&TM BSc Winchelsea Veterinary Services Ph: 250-667-5534
Chapter 14 - Electron Transport and Oxidative Phosphorylation
Chapter 14 - Electron Transport and Oxidative Phosphorylation The cheetah, whose capacity for aerobic metabolism makes it one of the fastest animals Prentice Hall c2002 Chapter 14 1 14.4 Oxidative Phosphorylation
STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 15, 2018 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
1. Cyanide is introduced into a culture of cells and is observed binding to a mitochondrion, as shown in the diagram below.
1. Cyanide is introduced into a culture of cells and is observed binding to a mitochondrion, as shown in the diagram below. The following observations are made: Cyanide binds to and inhibits an enzyme
Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.
!! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions
NAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided!
EXAM 3a BIOC 460 Wednesday April 10, 2002 Please include your name and ID# on each page. Limit your answers to the space provided! 1 1. (5 pts.) Define the term energy charge: Energy charge refers to the
Biology Ch 9 Cellular Respiration & Fermentation ( )
Name Class Date Biology Ch 9 Cellular Respiration & Fermentation (9.1-9.2) For Questions 1 10, complete each statement by writing the correct word or words. 1. A calorie is a unit of. 2. The Calorie used
Macromolecules. You are what you eat! Chapter 5. AP Biology
Macromolecules You are what you eat! Chapter 5 AP Biology Organic Compounds Contain bonds between CARBON glycosidic bond AP Biology Carbohydrates Structure / monomer u monosaccharide Function u energy
Name: Bendik Fyhn Terjesen
Name: Bendik Fyhn Terjesen Present position Work address Senior research scientist Nofima Marin, NO-6600 Sunndalsøra, Norway Telephone +47 404 57 874 / +47 916 31 702 E-mail bendik.terjesen@nofima.no Degrees
Supplementary Material Correlation matrices on FP and FN profiles
Supplementary Material Correlation matrices on FP and FN profiles The following two tables give the correlation coefficients for the FP profiles and the FN profiles of a single tagging solutions against
Membrane Function. How does the cell membrane control movement of materials? Type 1 Ions Type 2 Molecules Type 3 Molecules Type 4 Molecules H O H
Why? Membrane Function ow does the cell membrane control movement of materials? The membrane is critical to the maintenance of homeostasis in living organisms. The cell membrane separates the cell from
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
Chemical Energy. Valencia College
9 Pathways that Harvest Chemical Energy Valencia College 9 Pathways that Harvest Chemical Energy Chapter objectives: How Does Glucose Oxidation Release Chemical Energy? What Are the Aerobic Pathways of
9.2 The Process of Cellular Respiration
9.2 The Process of Cellular Respiration Oxygen Carbon 2 2 Dioxide 34 Water Glycolysis Glycolysis is the first stage of cellular respiration. During glycolysis, glucose is broken down into 2 molecules of
The Lymphatic System and Body Defenses
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College The Lymphatic System and Body Defenses 12PART B Adaptive Defense System: Third Line of Defense Immune
PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b
PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL 19 99 0.0245 RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b SAVENILEHL 32 91-0.0019 RS29_MOUSE 40S ribosomal protein S29
STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells