Analysis of the BZLF1 Promoter of Epstein-Barr Virus: Identification of an Anti-Immunoglobulin Response Sequence

Transcription

1 JOURNAL OF VIROLOGY, June 1993, p Vol. 67, No X/93/ $02.00/0 Copyright 1993, American Society for Microbiology Analysis of the BZLF1 Promoter of Epstein-Barr Virus: Identification of an Anti-Immunoglobulin Response Sequence NORIO SHIMIZU AND KENZO TAKADA* Department of Virology and Parasitology, Yamaguchi University School of Medicine, Kogushi, Ube, Yamaguchi 755, Japan Received 27 October 1992/Accepted 2 March 1993 The induction of the viral lytic cycle in latently Epstein-Barr virus (EBV)-infected B cells is initiated by activation of the BZLF1 gene, whose expression is sufficient to disrupt EBV latency, suggesting that BZLF1 acts as the switch to change from a latent to a lytic replicative cycle. In the present studies, a series of deletion plasmids encompassing positions bp -552 to +12 of the BZLF1 promoter were constructed and tested for their response to anti-immunoglobulin (anti-ig), an inducer of the viral lytic cycle, upon transfection into EBV-negative and -positive lymphoid cells. The promoter consisted of three functionally distinct regions. Region I (bp -552 to -221) had a negative influence on promoter activity; its deletion made the promoter highly responsive to anti-ig. Region II (bp -203 to -177) was important for conferring responsiveness to anti-ig. The response to anti-ig did not require the presence of the EBV genome or EBV gene products. This sequence also enhanced expression of the chloramphenicol acetyltransferase (cat) gene from the simian virus 40 promoter in response to anti-ig, even when inserted downstream of the cat gene. Region III (-134 to -116) was a positive element that was transactivated by the BZLF1 gene product. Epstein-Barr virus (EBV) is a ubiquitous virus which infects the majority of the human population and is the causative agent of infectious mononucleosis. EBV is commonly transmitted by saliva and, following replication in epithelial cells of the oropharynx, infects B lymphocytes, in which it persists in a latent state for the life of the host. In rare cases, the virus is associated with human malignancies, such as Burkitt's lymphoma, nasopharyngeal carcinoma, opportunistic lymphoma in immunocompromised hosts, and some cases of Hodgkin's lymphoma, which occur after prolonged persistence and reactivation of latent EBV (reviewed in reference 8). EBV transforms human B lymphocytes to indefinitely growing lymphoblastoid cells, in which only a few of the 90 to 100 viral genes are expressed, although the entire viral genome is maintained in a plasmid form (8). Such transformed cells have been a tractable in vitro model for studying the molecular mechanism of establishment, maintenance, and disruption of EBV latency (2). In some of these cells, the viral lytic cycle can be induced by treatment with various reagents, including halogenated pyrimidine (11, 13), tumor promoters (27, 30), anti-immunoglobulin (anti-ig) (22, 28), and butyrate (16). Although we do not know the physiological stimuli that control activation of the productive cycle and the switch from latency in vivo, the antigenic stimuli that are mimicked by anti-ig treatment in vitro would serve as more physiologically relevant activators. We have established a unique system (22, 23, 25) in which the viral lytic cycle can be synchronously induced by treatment of the EBV-infected Burkitt's lymphoma cell line Akata with anti-ig. The use of this system proved that several regions of the viral genome are transcribed shortly after anti-ig treatment in the presence of protein synthesis inhibitors (17, 21, 25). Among them, only the product of the BZLF1 gene (1) is able to trigger the viral lytic cycle when transfected into latently infected lymphocytes (4, 5, 26), * Corresponding author strongly suggesting that the initial event in the lytic cascade is activation of BZLF1 transcription. Several groups have already studied the promoter of the BZLF1 gene, which is involved in positive and negative regulations. Two distinct elements which are responsive to either 12-O-tetradecanoylphorbol-13-acetate (TPA) or the BZLF1-encoded protein itself have been identified (9, 10, 29). Another group identified a region of the BZLF1 promoter which negatively regulates expression (18). The present investigations are aimed at analyzing the promoter for the BZLF1 gene, with special reference to responsiveness to anti-ig. The results indicate that the BZLF1 promoter contains three functionally distinct regions, one of which responds to anti-ig in the absence of the EBV genome or EBV gene products. MATERIALS AND METHODS Cells, tissue culture medium, and transfection procedures. The EBV genome-positive Burkitt's lymphoma cell line Akata (23) and the EBV genome-negative B-lymphoma cell line BJAB (14) were maintained in RPMI 1640 medium supplemented with penicillin (40 U/ml), streptomycin (50,ug/ml), glutamine (280,ug/ml), and 10% fetal calf serum at 37 C in a 5% humidified CO2 atmosphere. Akata cells were transfected by the DEAE-dextran method (7, 26). Cells (5 x 106) were washed twice in Tris-buffered saline (0.1 g of MgC12 6H20, 0.1 g of CaCl2, 8.0 g of NaCl, 0.38 g of KCI, 0.1 g of Na2HPO4. 12H20, 3.0 g of Tris-HCI per liter [ph 7.5]). Chloramphenicol acetyltransferase (CAT) plasmid DNA (4,ug) was suspended in 300,ul of Tris-buffered saline and mixed with 300,ul of Tris-buffered saline containing DEAE-dextran (1.5 mg/ml; molecular weight, 500,000; Pharmacia). Cells were suspended in DNA solution and incubated for 30 min at room temperature with frequent gentle shaking. After the cells were washed with Tris-buffered saline, they were suspended in 2 ml of fresh medium and cultured at 37 C. BJAB cells were transfected by the electroporation method (15, 24). Cells (5 x 106) were suspended

2 VOL. 67, 1993 in 300,ul of ice-cold phosphate-buffered saline containing 20,ug of CAT plasmid DNA, electroporated with a Gene Pulser (Bio-Rad), and then suspended in 2 ml of growth medium. Anti-Ig treatments and CAT assays. After 24 h of transfection, each culture was suspended in 2 ml of fresh medium and split into two, to one of which was added 1% (vol/vol) anti-ig (anti-igg antibodies for Akata cells and anti-igm antibodies for BJAB cells; Cappel) (22). After 48 h of transfection, cells were harvested, spun down at 1,000 x g, washed once with phosphate-buffered saline, and suspended in 100 Rl of 0.25 M Tris-HCl (ph 7.5). The cell suspension was then lysed by three cycles of freeze-thawing, and the debris was removed by centrifugation. Except as noted otherwise, 50,u of the extract was used to determine CAT activity by standard methods (12, 19). The extent of acetylation of [14C]chloramphenicol (Amersham) was quantitated by using the BAS2000 system (Fuji Film Co. Ltd., Tokyo, Japan). Plasmid constructions. To generate pz-cat, we cloned the 564-bp BamHI-NaeI fragment (blunted with T4 DNA polymerase) containing the BZLF1 promoter (Zp) from Akata EBV into the HincII site of the promoterless CAT vector puc-cat, oriented so that the promoter could transcribe the cat gene. puc-cat was made by cloning the HindIII-BamHI fragment from psv2cat (12) (which has the simian virus 40 [SV40] early-region termination and polyadenylation signals downstream of the cat gene), after addition of the HindIII linker, into the HindIII site of puc19. Deletion derivatives of pz-cat were generated as follows. p387-cat and p222-cat were generated by inserting the NdeI-NaeI and SphI-NaeI fragments (each blunted with T4 DNA polymerase) of Zp into the HincII site of puc- CAT, respectively. p134-cat was generated from pz-cat by removal of the BamHI-EcoT22I fragment and reclosing. Other deletion derivatives of pz-cat were generated by Bal31 digestion from the NdeI, SphI, or EcoT22I site, removal of the remaining 5' fragment of Zp after the BamHI (present in polylinker sites of puc19) digestion, blunting with T4 DNA polymerase, and reclosing and were characterized by DNA sequencing. p552/222-sv2cat, p552/387-sv2cat, and p387/222- SV2CAT were generated by inserting the BamHI-SphI, BamHI-NdeI, and NdeI-SphI fragments (blunted) of Zp into the SmaI site upstream of the SV40 enhancer-promoter in puc-sv2cat, respectively. puc-sv2cat was generated by inserting the AccI-BamHI fragment from psv2cat (12), which contained two 72-bp repeats of the enhancer and three 21-bp repeats of the promoter from SV40 upstream of the cat gene, after blunting with T4 DNA polymerase, into the HincII site of puc19. puc-sv1scat and puc-sv1rcat were generated by inserting the ClaI fragment from psv1s-cat (20) into the HincII site of puc19 in both orientations. The ClaI fragment contained two 21-bp repeats and a TATA box from the SV40 promoter upstream of the cat gene but lacked the 72-bp repeats of the SV40 enhancer, as described previously. The BamHI-SphI, BamHI-NdeI, and NdeI-SphI fragments (blunted) were individually inserted into the SmaI site of puc-sv1scat or puc-sv1rcat so that the inserted sequences were upstream or downstream of the cat gene. Designations of resultant plasmids are indicated in Fig. 4. The 86-bp EcoT22I fragments of Zp were treated with T4 DNA ligase, blunted with T4 DNA polymerase, and cloned into the SmaI site upstream of the SV40 promoter in puc-sv1scat. Several clones were isolated and characterized by sequencing. Four representative clones, each containing one to four copies of the 86-bp fragment, were used ANTI-Ig RESPONSE OF EBV BZLF1 PROMOTER 3241 A larni I II C 3 101, BZi,F 1 102, , , 155 lc..c T221 NacI +1?c i{i..1. B Akata Anti-IgG _ Zp Sp I03, 741 B,JAB Anti-Igm 0 r + NW' I R 10 3, , 741 i 1.m I FIG. 1. (A) Map of the BZLF1 region (1) and the region used in the BZLF1 promoter (Zp) construct. EBV BamHI e3, Z, g, and R regions are shown, with the structure of the 1.0-kb BZLF1 mrna (3). Solid lines represent BZLF1 coding sequence. The numbers represent nucleotide numbers on the EBV map (1). The transcription start site is indicated by the leftward arrow. Numbers in italic type are positions from the mrna start site (+1). (B) Anti-Ig inducibility of Zp. pzp-cat was transfected into either Akata or BJAB cells. Each culture was incubated for 24 h and then split into two, to one of which was added 1% (vol/vol) anti-ig. After 48 h of transfection, cells were harvested for CAT assays. The fold increase in CAT activity compared with that in the untreated control is indicated. in this experiment. The KpnI-BamHI fragments (blunted with T4 DNA polymerase) from these four clones, each containing one to four copies of the 86-bp fragment, were individually cloned into the SmaI site of puc_svlrcat so that the 86-bp sequences were downstream of the cat gene. Designations of resultant plasmids are indicated in Fig. 5. RESULTS The BZLF1 promoter (Zp) is anti-ig inducible in both EBV-positive and EBV-negative cells. A region of Zp of Akata EBV from bp -552 to + 12 (3) was cloned upstream of the bacterial gene that encodes CAT (Fig. 1A). The resultant plasmid, designated pzp-cat, was transfected into Akata cells. After 24 h of transfection, each transfection mix was split into two cultures, with and without anti-ig. After 48 h of transfection, cells were harvested and assayed for CAT enzymatic activity. Representative results from several separate experiments are shown in Fig. 1B. The uninduced levels of CAT expression were very low, and the activities increased 58-fold after treatment of cells with anti-ig. The CAT activities in cultures transfected with puc-cat were not responsive to anti-ig (data not shown). When Zp was

3 3242 SHIMIZU AND TAKADA J. VIROL. A response to anti-ig in BJAB cells but retained considerable 100l anti-ig responsiveness in Akata cells. Deletion of a further 19 bp (region III; bp -134 to -116) completely abolished anti-ig 80 response in Akata cells. These results suggest that regions II and III are.0 important for responding to anti-ig and that region III 60 requires other EBV factors for its response. A negative regulatory region (region I) acts as an enhancer 00 for a heterologous promoter. We tested whether region I 40 could exert a negative regulatory effect on a heterologous promoter. 20 Region I and its deleted fragments were individually cloned upstream of the SV40 enhancer-promoter in oi I I I I - psv2cat. Rather than repressing promoter activities, insertion of these fragments consistently caused elevated levels of CAT activity in transfected BJAB cells (Fig. 3). We Nucleotides from cap site therefore tested whether region I had the properties of an enhancer. Region I and each of its deletion fragments B0- enhanced CAT expression even when inserted downstream 10 of the cat gene ligated to the SV40 promoter in psvlcat, in which the 72-bp repeats of the SV40 enhancer were com- 80- pletely removed (Fig. 4), indicating that region I acts as an enhancer for a heterologous promoter. - 6 Region IH has the properties of an enhancer that is inducible by anti-ig. As indicated above, the region of Zp from bp to -177 (designated region II) seems to be very important for responding to anti-ig in the absence of other 2- EBV antigens. We tested whether this sequence could activate gene expression from a heterologous promoter in O - _Y_--_t-_-_-_,_., response to anti-ig. The 86-bp EcoT22I fragment (bp -220 to -5i Oo I -135) of Zp containing region II and multimers of this fragment were individually cloned upstream or downstream Nucleotides from cap site of the cat gene ligated to the SV40 promoter in psvlcat and tested for their responses to anti-ig in BJAB cells. As C Akata BJAB shown in Fig. 5, CAT plasmids containing a single copy of the EcoT22I fragment could not respond to anti-ig, but when pr52 p222 p176i p117 prs2 1)222 P'17f p1l:b the copy number of the EcoT22I fragment was increased, the responses appeared. The response to anti-ig was also ob- * *- served when the same fragments were inserted downstream of the cat gene. These results indicate that region II has the * ** * *properties of an enhancer which can activate gene expression from a heterologous promoter in response to anti-ig. oo o o o o o > W W O O o (, <7 0 Region III is transactivated bythe BZLF1 gene product. The Allti-1X "+'' + +results presented above suggested that region III requires I l I I -1' I other EBV factors for its response to anti-ig. Two plasmids, p203-cat (bp -203 to +12, containing regions II and III) and FIG. 2. Scatter plots illustrating the effects of deletions on the p134-cat (bp -134 to + 12, containing region III only), were anti-ig iinducibility of Zp in Akata (A) and BJAB (B) cells. Anti-Ig used to compare the kinetics of CAT expression in response inducib: ility is represented as the fold increase in CAT activity to ani-i rebthplasmidswr iva transfento compar*ed with that in an untreated control. The results are averages to anti-ig. Both plasmids were individually transfected into of threl e separate experiments. (C) Autoradiographs and fold in- Akata cells. After 24 h of transfection, anti-ig was added to crease iin CAT activity of representative clones. each of the cultures, and aliquots were harvested at designated times for CAT assays. As shown in Fig. 6, cells that were transfected with p203-cat exhibited CAT activity as transfected into EBV-negative BJAB cells, the promoter early as 2 h after anti-ig addition, while CAT expression in expres (Fig. 1: cells w inducit Zp c To deti we con Akata resulta end of I inducit elemen -552 t -203 t,sed slightly elevated levels of constitutive activity p134-cat-transfected cells was delayed until 4 h after anti-ig B). This activity increased 5.6-fold after treatment of addition. These results also suggest that region III is activated,ith anti-ig. These results suggest that the Zp is anti-ig by EBV factors that are induced in Akata cells following ble in the absence of EBV gene products. entrance into a lytic cycle in response to anti-ig. ontains both negative and positive regulatory regions. Immediate-early antigens of EBV play crucial roles in :ermine the sequence that was responding to anti-ig, disrupting EBV latency and are expressed as early as 3 h istructed a series of deletion derivatives of pzp-cat. after anti-ig addition in Akata cells (17, 21, 25). We therefore and BJAB cells were used to test the response of the tested whether these immediate-early proteins activate the Lnt plasmids to anti-ig (Fig. 2). Deletions from the 5' BZLF1 gene via region III. Two plasmids in which the immethe promoter up to bp -221 caused increases in anti-ig diate-early genes are under the control of the SV40 enhancerility, suggesting the presence of a negative control promoter, psg5-bzlf1 and psg5-brlf1, were individually it(s) within the deleted region (designated region I; bp cotransfected with p134-cat (bp -134 to +12) or p115-cat o -221). Removal of an additional 27 bp (region II; bp (bp -115 to +12) into BJAB cells. After 36 h of transfection, to -177) from the 5' end completely abolished the cells were harvested for CAT assays. As shown in Fig. 7,

4 VOL. 67, 1993 ANTI-Ig RESPONSE OF EBV BZLF1 PROMOTER 3243 % acetylation (S.E.) Relative activity BauHI NdeI SphI p552/222-sv2cat QT 89 (3.5) 4.0 p552/387-sv2cat S (4.6) 3.6 C!TL - p387/222-sv2cat - 81 (2.1) 3.7 puc-sv2cat ISV21 CQiTi i- 22 (5.3) 1.0 FIG. 3. Enhancement of CAT activity by insertion of region I (bp -552 to -221) or its deletion fragments upstream of the SV40 enhancer-promoter (SV2) in psv2cat. Twenty micrograms of DNA from each of the plasmids shown was transfected into BJAB cells, which were then assayed for CAT activity. In this experiment, only 10 pl of extract was used for determination of the CAT activity. The percentage of chloramphenicol acetylated and the level of CAT activity relative to that produced by psv2cat are presented. The results are averages of three separate experiments. psg5-bzlf1 activated CAT expression (7.5-fold) in plasmid p134-cat but not in p115-cat, deleted of region III, indicating that BZLF1 activates its own promoter via region III. DISCUSSION Using transient-transfection assays, we have demonstrated that the promoter for the BZLF1 gene can be induced by treatment of cells with anti-ig, which mimicks the antigenic stimulus for B lymphocytes and would be the most physiological activator of latent EBV in vivo. As summarized in Fig. 8, the promoter consisted of three functionally distinct regions, designated regions I (bp -552 to -221), II (bp -203 to -177), and III (bp -134 to -116). Region I had a negative influence on promoter activity. Removal of region I was not sufficient to allow increased expression from the BZLF1 promoter but made the promoter highly responsive to anti-ig. Montalvo et al. (18) also BanilI NdeI SphI Il p552/222-svillat 8V1 CQT _ p552/387-sv1cat ISVll QT _ p387/222-svlsptt 81 QT _ identified a cis-acting negative regulatory element within region I. In contrast to our results, they reported that deletion of 165 bp from the 5' end was sufficient to cause high CAT expression, comparable to that from the SV40 enhancer-promoter, in the absence of inducing agents. The different target cells used in their experiment (they used fibroblasts and epithelial cells) may explain the discrepancy. The unexpected result was obtained when region I was inserted upstream or downstream of the SV40 promoter. Rather than repressing promoter activity, insertion of this fragment consistently caused elevated levels of CAT activity. We have demonstrated that the 27-bp sequence, designated region II, is very important for conferring responsiveness to anti-ig. Its response to anti-ig did not depend on the presence of the EBV genome or EBV gene products in the cell. The sequence had the properties of an enhancer which could activate gene expression from a heterologous promoter in response to anti-ig. The sequence did not display % acetylation (S.E.) Relative activity 4.3 (0.7) (0.5) (0.3) 10.0 puc-svpcat ISVl CAT _ 0.5 (0.04) 1.0 p552/222-8vlr CQT I - QT 8V1S p552/387-svrqcat -+ - IS p387/222_sv1rcqt l (0.7) (0.6) (0.7) 10.2 PUC-8V rcatt _QT I VIF 0.4 (0.04) 1.0 FIG. 4. Demonstration of enhancer activity of region I (bp -552 to -221) and its deletion fragments. The BamHI-SphI fragment of Zp, designated region I, and its deletion fragments were individually cloned upstream or downstream of the cat gene driven by the SV40 promoter (SV1) lacking the entire enhancer sequence. Twenty micrograms of DNA from each of the plasmids shown was transfected into BJAB cells, which were then assayed for CAT activity. Arrows indicate the direction of CAT transcription. The percentage of chloramphenicol acetylated and the level of CAT activity relative to that produced by puc-sv1scat or puc-sv1'cat are presented. The results are averages of three separate experiments.

5 3244 SHIMIZU AND TAKADA J. VIROL. % acetylation Fold Anti-Ig (S.E.) induction treatment puc-sv1 CAT SV1 CAT 0.3 (.02) 0.4 (.04) 1.5 p(ecot)1 -SV1 CAT 0.4 (.02) 0.6 (.07) 1.5 p(ecot )2 -SV1CAT p(ecot)3 -SV1CAT p(ecot )4 -SVlCAT * SlCA- 0.4 (.04) 1.4 (.2) (.06) 5.1 (.6) (.04) 5.5 (.4) 11.0 PUC-SVlr CAT CAT SVI p(ecot) -SVlr CAT [ 3 S p(ecot )2 -SVlr CAT --I -Ij CAT SVi p(ecot )3 _SVlr CAT } p(kcott)4 -SVlr CAT 0.4 (.07) 0.4 (.08) (.04) 0.6 (.1) 0.5 (.08) 1.0 (.3) (.04) 3.8 (.9) (.08) 3.9 (.7) 7.8 FIG. 5. Demonstration of enhancer activity of region II (bp -203 to -177) that is inducible by anti-ig. The 86-bp EcoT22I fragment (bp -220 to -135) containing region II and its concatemers was individually cloned upstream or downstream of the cat gene driven by the SV40 promoter (SV1) lacking the entire enhancer sequence. Twenty micrograms of DNA from each of the plasmids shown was transfected into BJAB cells. Cultures were incubated for 24 h and then split into two, with and without anti-ig. After 48 h of transfection, cells were harvested for CAT assays. The EcoT22I fragments are indicated by open boxes; orientation relative to the direction of transcription of Zp is indicated by arrows. Arrows next to CAT indicate the direction of transcription. The percentage of chloramphenicol acetylated and the fold increase in CAT activity compared with that in the untreated control are presented. The results are averages of three separate experiments. any homology to previously identified binding sequences for transcription factors, suggesting that new transcription factors might be involved in regulation of the BZLF1 gene. Recent reports (10, 21) have indicated that Zp can be activated by TPA in Ramos cells (an EBV-negative Burkitt's lymphoma cell line). Flemington and Speck (10) mapped TPA inducibility to the region containing region II. How- I- 100,0 80 U cl ever, as these authors found, this region does not contain previously identified TPA-responsive elements, and we could not find any TPA response of this region in either Akata or BJAB cells (unpublished data). These authors added theophylline to transfected cells in order to increase promoter activities because otherwise TPA responses could not be detected in their assays. The possibility is not ruled out that theophylline treatment induced or altered the TPA response. Together, these results indicate that the response of Zp to TPA is very weak compared with that to anti-ig. Although TPA is known to activate the EBV lytic cycle, there is no evidence that TPA induction is mediated via activation of the BZLF1 gene. The full response to TPA is relatively slow (30), and TPA may act at many stages in the activation p134-cat pf 15-CAT I: Hours after anti-ig treatment FIG. 6. Kinetics of CAT expression in Akata cells transfected with either p203-cat (bp -203 to +12, containing regions II and III; *) or p134-cat (bp -134 to + 12, containing region III only; 0). Both plasmids were individually transfected into Akata cells. After 24 h of transfection, anti-ig was added to the cultures. At designated times after anti-ig addition, cells were harvested for CAT assays. CAT activity relative to that at 24 h after anti-ig addition is indicated. These results were reproduced several times, and this figure reflects a typical assay. R * A@ I{} FIG. 7. Transactivation of CAT expression from region III (bp -134 to +12) by the BZLF1 gene product. The BZLF1 (Z) and BRLF1 (R) expression plasmids in vector psg5 were individually cotransfected into BJAB cells with plasmid p134-cat or p115-cat, each containing Zp (bp -134 to +12 or -115 to +12) linked to the cat gene. After 36 h of transfection, cells were harvested for CAT assays. The fold increase in CAT activity relative to that in cultures cotransfected with psg5 (C) is indicated. These results were reproduced several times, and this figure reflects a typical assay.

6 VOL. 67, 1993 Region I GCTGTCTATTTTTGACACCAGCTTATT TGCATGAGCCACAGGCATT Region II Region III FIG. 8. Schematic representation of the BZLF1 promoter. The mrna start site is referred to as +1. of EBV gene expression. The low TPA response of Akata cells (6; unpublished data) also supports this possibility. It has been demonstrated that the BZLF1 gene product positively regulates its own expression by a mechanism which involves direct binding to a region of Zp corresponding to region III (9). Results with Akata cells (17, 21, 25) indicated that BZLF1 mrna appears at 1 h, is detectable at high levels at 2 h, but returns to undetectable levels at 6 h after anti-ig treatment of Akata cells. It remains to be clarified whether autostimulation of BZLF1 expression via region III is really required for EBV induction. ACKNOWLEDGMENTS We thank Hiroshi Handa for helpful advice during the progress of this work. This work was partly supported by grants from the Japanese Ministry of Education, Science and Culture and from the Ichiro Kanehara Foundation. REFERENCES 1. Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hutfull, G. S. Hudson, S. C. Satchwell, C. Seguin, P. S. Tuffhell, and B. G. Barrell DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature (London) 310: Baichwal, V. R., and B. Sugden Latency comes of age for herpesvirus. Cell 52: Biggin, M., M. Bodescot, M. Perricaudet, and P. Farrell Epstein-Barr virus gene expression in P3HR-1-superinfected Raji cells. J. Virol. 61: Chevailier-Greco, A., E. Manet, P. Chavrier, C. Monsnier, J. Daillie, and A. Sergeant Both Epstein-Barr virus (EBV)- encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 5: Countryman, J., and G. Miller Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA 82: Daibata, M., R. E. Humphreys, K. Takada, and T. Sairenji Activation of latent EBV via anti-igg-triggered, second messenger pathways in the Burkitt's lymphoma cell line Akata. J. Immunol. 144: Eckhart, W Complementation and transformation by temperature-sensitive mutants of polyoma virus. Virology 38: Fields, B. N., and D. M. Knipe (ed.) Virology, 2nd ed. Raven Press, New York. 9. Flemington, E., and H. Speck Autoregulation of Epstein- Barr virus putative lytic switch gene BZLF1. J. Virol. 64: Flemington, E., and H. Speck Identification of phorbol ester-response elements in the promoter of Epstein-Barr virus putative lytic switch gene BZLF1. J. Virol. 64: ANTI-Ig RESPONSE OF EBV BZLF1 PROMOTER Gerber, P Activation of Epstein-Barr virus by 5-bromodeoxyuridine in "virus-free" human cells. Proc. Natl. Acad. Sci. USA 69: Gorman, C. M., L. F. Moffat, and B. H. Howard Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2: Hampar, B., J. G. Derge, L. M. Martos, and J. L. Walker Synthesis of Epstein-Barr virus after activation of the viral genome in a "virus-negative" human lymphoblastoid cell (Raji) made resistant to 5-bromodeoxyuridine. Proc. Natl. Acad. Sci. USA 69: Klein, G., T. Lindahl, M. Jondal, W. Leibold, J. Menezes, K. Nilsson, and C. Sundstrom Continuous lymphoid cell lines with characteristics of B cells (bone marrow-derived), lacking the Epstein-Barr virus genome and derived from three human lymphomas. Proc. Natl. Acad. Sci. USA 71: Liebowitz, D., J. Mannick, K. Takada, and E. Kieff Phenotypes of Epstein-Barr virus LMP1 deletion mutants indicate transmembrane and amino-terminal cytoplasmic domains necessary for effects in B-lymphoma cells. J. Virol. 66: Luka, J., B. Kallin, and G. Klein Induction of the Epstein-Barr virus (EBV) cycle in latently infected cells by n-butyrate. Virology 94: Mellinghoff, I., M. Daibata, R. E. Humphreys, C. Mulder, K. Takada, and T. Sairenji Early events in Epstein-Barr virus genome expression after activation: regulation by second messengers of B cell activation. Virology 185: Montalvo, E. A., Y. Shi, T. E. Shenk, and A. J. Levine Negative regulation of the BZLF1 promoter of Epstein-Barr virus. J. Virol. 65: Oguro, M. O., N. Shimizu, Y. Ono, and K. Takada Both the rightward and the leftward open reading frames within the BamHI M DNA fragment of Epstein-Barr virus act as transactivators of gene expression. J. Virol. 61: Shimizu, N., S. Sakuma, Y. Ono, and K. Takada Identification of an enhancer-type sequence that is responsive to Z and R trans-activators of Epstein-Barr virus. Virology 172: Sinclair, A. J., M. Brimmell, F. Shanahan, and P. J. Farrell Pathways of activation of the Epstein-Barr virus productive cycle. J. Virol. 65: Takada, K Cross-linking of cell surface immunoglobulins induces Epstein-Barr virus in Burkitt lymphoma lines. Int. J. Cancer 33: Takada, K., K. Horinouchi, Y. Ono, T. Aya, T. Osato, M. Takahashi, and S. Hayasaka An Epstein-Barr virusproducer line Akata: establishment of the cell line and analysis of viral DNA. Virus Genes 5: Takada, K., Z. Ji, S. Fujiwara, N. Shimizu, and A. Tanabe- Tochikura Partial elimination of Epstein-Barr virus plasmids from Burkitt's lymphoma cells by transfecting the BZLF1 gene. J. Virol. 66: Takada, K., and Y. Ono Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63: Takada, K., N. Shimizu, S. Sakuma, and Y. Ono trans activation of the latent Epstein-Barr virus (EBV) genome after transfection of the EBV DNA fragment. J. Virol. 57: Takada, K., and H. zur Hausen Induction of Epstein-Barr virus antigens by tumor promoters for epidermal and nonepidermal tissues. Int. J. Cancer 33: Tovey, M. G., G. Lenoir, and J. Begon-Lours Activation of latent Epstein-Barr virus by antibody to human IgM. Nature (London) 276: Urier, G., M. Buisson, P. Chambard, and A. Sergeant The Epstein-Barr virus early protein EB1 activates transcription from different responsive elements including AP-1 binding sites. EMBO J. 8: zur Hausen, H., F. J. O'Neill, U. K. Freese, and E. Hecker Persisting oncogenic herpesvirus induced by the tumour promoter TPA. Nature (London) 272: