PCR CRP ESR CBC. universal PCR CBC ESR CRP PCR CRP.

Transcription

1 CBC ESR CRP CBC ESR CRP :... universal 100 :.. (1-120) 12/ %65 :. CRP ESR CBC. 38/9±0/6. % (%22) (%24) (%29) CRP ESR WBC. 19 universal :... : 1 2* -1-2 * : : smamishi@sina.tums.ac.ir ( 24-48) : (%40) 4. CRP CBC ESR. universal. (DNA RNA) ( )

2 º C 15 K Lysate PH= DNA. 0/ DNA DNA DNA DNA DNA DNA Universal... (). - - U1: 5'- CCAGCAGCCGCGGTAATACG -3' U2: 5'- ATCGG(C/T) TACCTTGTTACGACTTC -3' Amplify 16S rrna 997 DNA. 20 0/4mM dntp 2/5mM MgCl2 0/1-1µg DNA DNA Taqpolymerase Primer 50. X Amplification /5 º C ml 10 mm +NH 4Cl 0/155 M) (PH= 7/2 (NaHCO 3). 4 º C. 400 g 10ml. (). (PBS). -20 º C. ph=7/2 0/01M Tris HCl DNA 0/005M %0/45 Nonidet P40 %0/ µg/ml Tween20 K rpm 0/05M KCl MgCl 2 500µl (PBL) 60 º C. K

3 171 CBC ESR CRP. (1-120) 12/50 26/31±29/96 %35. %55 %45 %12 %25 %28 %43... %12 %45 38/98±0/57 (). (40/7-38/5) (%24) (%29) (%5) (%7) (%22). (%18) ( ) (2-140 ) 45/12±34/01 ESR (±SD). WBC/mm 3 (±SD) 39 %52 CRP. ( ) 14050/50±6349/ 1:160 1:80 1:40 1:20. % % (p=0/001).. WBC.(p=0/392) WBC.(p=0/002) 11605/17±5656/ /29±4696/60}.{(p=0/018) 12788/89±7637/28 (p=0/002) ESR 57/87±30/54) (p=0/398) CRP.(p=0/023 30/10±23/25.(1 ) WBC ESR 500 ESR.(1 ) extension Postextenssion 1/5 UV Trans illuminator DNA DNA.. DNA... CRP ESR WBC.. 11/5 SPSS. (SD) ±.. Negative Positive Predictive Value (PPV) ) χ 2 Predictive Value (NPV). Odds Fisher s Exact test Post Hoc (ANOVA) ratio (95s%CI). 100.

4 172 CRP Titration 0/35±0/016 (0/0062-0/05) 0/33±0/013 (0/025-0/05) 0/037±0/22 (0/012-0/05) 0/31±0/016 (0/012-0/05) 0/035±0/013 (0/013-0/05) 0/036±0/016 (0/006-0/05) (Mean ± SD) WBC ESR CRP :1- ESR 30/2±23/25 (2-110) 41/50±39/46 (2-140) 53/43±37/22 (12-130) 57/9±30/54 (13-105) 53/50±37/9 (3-127) 45/12±34/01 (2-140) WBC 11605/2±5656/16 ( ) 14022/72±5985/53 ( ) 21114/28±4696/60 ( ) 15916/66±5039/64 ( ) 12788/89±7637/28 ( ) 14050/50±6349/38 ( ) 38/85±0/48 (38/5-40) 38//92±0/6 (38-40) 39/21±0/39 (38-39) 39/02±0/64 (38-41) 39/11±0/61 (38-40) 38/98±0/57 (38-41) ESR 140/00 120/00 100/00 80/0 60/0 40/0 20/0 0/0 R Sq Linear = :2-29 (%100) 22 (%100) 7 (%100) 24 (%100) 18 (%100) 100(%79/3) 6 (%20/7) 3 (%13/6) 2 (%28/6) 3 (%12/5) 5 (%27/8) 19 (%19) 23 (%79/3) 19 (%86/4) 5 (%71/4) 21(%81/5) 13 (%72/2) 81 (%81) 0/ / / /0 WBC ESR WBC :1-10. (%70) 11.. Cursons Universal 15. (%28/6) NPV PPV.(2 ) (p=0/368) %91/67s %CI. %91 %98/67 %61/11 %90/91s %CI 9...

5 173 Afsharpaiman CBCSh. ESR et al. CRP. CRP ESR WBC. Isaacman. WBC 17.. ( ). universal ) gold standard.... %87 % Durso Jordan. 27 NICU DNA Jordan Laforgin Anthony. (%75/3) buffy coat... References 1. Sands KE, Bates DW, Lanken PN, Graman PS, Hibberd PL, Kahn KL, et al. Epidemiology of sepsis syndrome in 8 academic medical centers. JAMA 1997; 278: Harris KA, Hartley JC. Development of broad-range 16S rdna for use in the routine diagnostic clinical microbiology service. J Med Microbiol 2003; 52: Rothman RE, Majmudar MD, Kelen GD, Madico G, Gaydos CA, Walker T, Quinn TC, et al. Detection of bacteremia in emergency department patients at risk for infective endocarditis using universal 16S rrna primers in a decontaminated polymerase chain reaction assay. J Infect Dis 2002; 186: Goldenberger D, Künzli A, Vogt P, Zbinden R, Altwegg M. Molecular diagnosis of bacterial endocarditis by broad-range amplification and direct sequencing. J Clin Microbiol 1997; 35: Rantakokko-Jalava K, Nikkari S, Jalava J, Eerola E, Skurnik M, Meurman O, et al. Direct amplification of rrna genes in diagnosis of bacterial infections. J Clin Microbiol 2000; 38: 32-9.

6 Diagnosis of Bacteremia in febrile patients: versus other routine methods Makhoul IR, Sujov P, Smolkin T, Lusky A, Reichman B. Epidemiological, clinical, and microbiological characteristics of late-onset sepsis among very low birth weight infants in Israel: a national survey. Pediatrics 2002; 109: Fredricks DN, Relman DA. Application of polymerase chain reaction to the diagnosis of infectious diseases. Clin Infect Dis 1999; 29: Ley BE, Linton CJ, Bennett DM, Jalal H, Foot AB, Millar MR. Detection of bacteraemia in patients with fever and neutropenia using 16S rrna gene amplification by polymerase chain reaction. Eur J Clin Microbiol Infect Dis 1998; 17: Kaplan SL. Bacteremia and Septic Shock. In: Feigin Rd, Cherry JD, Demmler GJ, Kaplan SL. Textbook of Pediatric Infectious Diseases. 5 th ed. Philadelphia: Saunders: 2004; p Barlett JG, McGowan Jr, Shulman JA. Bloodstream Invasion In: Gorbach SL, Barlett JG, Blacklow NR. Infectious Diseases. 3 rd ed. Philadelphia: Lippincott, Williams Wilkins: 2004; p Cursons RT, Jeyerajah E, Sleigh JW. The use of polymerase chain reaction to detect septicemia in critically ill patients. Crit Care Med 1999; 27: Breitkopf C, Hammel D, Scheld HH, Peters G, Becker K. Impact of a molecular approach to improve the microbiological diagnosis of infective heart valve endocarditis. Circulation 2005; 111: Jordan JA, Durso MB. Comparison of 16S rrna gene and BACTEC 9240 for detection of neonatal bacteremia. J Clin Microbiol 2000; 38: Jordan JA. identification of four medically important Candida species by using a single primer pair. J Clin Microbiol 1994; 32: Laforgia N, Coppola B, Carbone R, Grassi A, Mautone A, Iolascon A. Rapid detection of neonatal sepsis using polymerase chain reaction. Acta Paediatr 1997; 86: Anthony RM, Brown TJ, French GL. Rapid diagnosis of bacteremia by universal amplification of 23S ribosomal DNA followed by hybridization to an oligonucleotide array. J Clin Microbiol 2000; 38: Isaacman DJ, Zhang Y, Reynolds EA, Ehrlich GD. Accuracy of a polymerase chain reaction-based assay for detection of pneumococcal bacteremia in children. Pediatrics 1998; 101:

7 Tehran University Medical Journal; Vol. 66, No. 3, Jun 2008: Diagnosis of bacteremia in febrile patients: versus other routine methods Afsharpaiman Sh. 1 Mamishi S. 2* 1- Department of Pediatrics, School of Medicine, Baghiat allah University 2- Department of Infectious Disease, School of Medicine, Infectious Diseases Research Center, Tehran University of Medical Sciences Abstract Background: Early diagnosis of bacteremia and its complications is the most important part of care and management of the patients. The utility of polymerase chain reaction () techniques have been shown to identify pathogens in less and more optimal time. The aim of our study was to evaluate prevalence of bacteremia using universal in febrile patients admitted in Pediatric Medical Center comparing other routine methods like blood culture. Methods: One hundred febrile children suspected to septicemia who were admitted in Pediatric Medical Center, were included. From all patients whole blood samples were obtained for blood culture and. Results: Of all patients, 65% were 3 to 36 months old. The frequency of male and female patients was 45 and 55, respectively. The prior oral and parental antibiotic therapy had been taken for 45 and 12 patients. The mean temperature of body was 38.98±0.57 at presenting time. Twelve patients were positive blood culture. Nineteen patients had positive test which consisted of 11 patients with positive blood culture. The severity of fever and laboratory findings such as WBC, ESR, and CRP had no significant difference between patients with positive and negative blood culture and. Conclusion: universal technique is more sensitive and specific than conventional blood culture and other methods to diagnose bacterial infection. Keywords: Bacteremia, fever, sepsis, Polymerase Chain Reaction (). * Corresponding author: Dept. of Pediatric Infectious Disease, Children Medical Center Hospital, School of Medicine, Tehran University of Medical Sciences, No.62, Gharib St., Keshavarz Blvd., Tehran, IRAN Tel: smamishi@sina.tums.ac.ir