single nucleotide polymorphisms SNPs IL 13 messenger RNA IL 8 IL 8 251T A SNPs A
|
|
|
- Edwin Jacobs
- 5 years ago
- Views:
Transcription
1 2013 Vol. 25No RS Respiratory syncytial virusrsv single nucleotide polymorphismssnps IL13 messenger RNA IL8 IL8251TA SNPs A RSV RSV RSV Respiratory syncytial virusrsv RSV Th1Th2 IgE 2 RSV tumor necrosis factor TNF interleukinil6 RSV in vitro 3 RSV TNF RSV 4,5 Key wordsrs SNPs
2 RSV RSV single nucleotide polymorphismssnps 1RSV SpO RSVrespiratory syncytial virus SNPssingle nucleotide polymorphisms ILinterleukin GCSFgranulocytecolony stimulating factor GMCSFgranulocyte macrophage colony stimulating factor IFNinterferon MCP1monocyte chemoattractant protein1 MIP1 macrophage inflammatory protein1 TNFtumor necrosis factor RSV 33 RSV RS ml 1 15, BioPlex BioRad LaboratoriesTokyoJapan3 IL8 monocyte chemoattractant protein MCP1 macrophage inflammatory protein MIP1 14 IL1 IL2IL4IL5IL6IL7IL10IL12 IL13IL17GCSFGMCSFIFNTNF messenger RNA IL6IL8IL QIAamp RNA extraction kit QIAGEN K.K., TokyoJapan RNA SearchLC GmbHHeidelberg PCR Light Cycler IL6IL8 IL13 messenger RNA actin 2 SNPs RSV SNPs SNPs 6,7 IL8251TA RSV Lu IL8251TA SNPs QIAamp DNA extraction kitqiagen K.K., TokyoJapan DNA Polymerase chain reaction Lu Statcel softwareomssaita-
3 2013 Vol. 25No majapan MannWhitney Utest p SNPs IL8GMCSF RSV INFIL4INFIL13IL8MCP1 2 IL13 IL6IL8IL13 messenger RNA 3 IL8 2 SNPs IL8251TA SNPs 3 7 TA 2 AA 5 7 TA 1 AA 6 10 TT 4 TA 3 AA 3 A CI CI IL13 messenger RNA IL8 IL p 0.05 IgEIUml p value 0.01 ns nsnot significant l 1 IL8 GMCSF
4 l l l p l l 2 aifnbil4ifncil13dil8emcp1 IL13 p 3Messenger RNA IL6IL8IL13 ail6bil8cil13 IL8 3IL8251TA SNPs Genotype, N TT TA AA Allele frequency T A OR 95CI A RSV
5 2013 Vol. 25No messenger RNA IL IL8251T A SNPs A RSV A Hull 9 RSV RSV RSV Emboriadou human neutrophil elastasehne RSV RSV 11 RSV eosinophil cationic proteinecp 12 mast cell leukotriene C4 LTC4 RSV 13 RSV mast cell 14 Sha Tolllike receptortlragonist TLR 15 RSV TLR3 TLR4 16,17 RSV TLR3 RSV single strand RNA double strand RNA necrosis aptoposis TLR3 IL8 16,18,19 TLR4 RSV F TLR4 NFB 17,20 LPSlipopolysaccharide HDMhouse dust mite IL8RANTESMIP RSV Th2 Th1 T Th1Th2 IFN Th1 IL12 25 Joshi RSV Th1 IFN Th2 IL10 RSV IFN 26 IL8 Th2 IL13 RSV 27 IL8 IL8251TA SNPs SNPs
6 Taguchi 252 AAAT 50.4TT IL13 RSV 7 29 IL13 messenger RNA RSV IL13 Arg130Gln Gln IL13 SNPs IL8IL13 SNPs RSV 31,32 SNPs IL4590T IL4R Glu551Arg RSV 33 TLR4 Asp299GlyThr399Ile LPS IL6 C CRP RSV 34 TLR4 RSV 35 RSV RSV 1 RS Sigurs N, et alsevere respiratory syncytial virus bronchiolitis in infancy and asthma and allergy at age 13. Am J Respir Crit Care Med , FrankeUllmann G, et alalteration of pulmonary macrophage function by respiratory syncytial virus infection in vitro. J Immunol , Neuzil KM, et alprotective role of TNFalpha in respiratory syncytial virus infection in vitro and in vivo. Am J Med Sci , Hornsleth A, et alcytokines and chemokines in respiratory secretion and severity of disease in infants with respiratory syncytial virus RSV infection. J Clin Virol , Janssen R, et algenetic susceptibility to respiratory syncytial virus bronchiolitis is predominantly associated with innate immune genes. J Infect Dis , Janssen R, et alhost transcription profiles upon primary respiratory syncytial virus infection. J Virol , Lu A, et alhaplotype of IL8251T and 781C is associated with the susceptibility to respiratory syncytial virus. J Trop Pediatr , Hull J, et alassociation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax , Everard ML, et alanalysis of cells obtained by bronchial lavage of infants with respiratory syncytial virus infection. Arch Dis Child , Emboriadou M, et alhuman neutrophil elastase in RSV bronchiolitis. Ann Clin Lab Sci , Oymar K, et alserum eosinophil cationic protein and interleukin5 in children with bronchial
7 2013 Vol. 25No asthma and acute bronchiolitis. Pediatr Allergy Immunol , DimovaYaneva D, et aleosinophil activation and cysteinyl leukotriene production in infants with respiratory syncytial viris bronchiolitis. Clin Exp Allergy , Bataki EL, et alrespiratory syncytial virus and neutrophil activation. Clin Exp Immunol , Sha Q, et alactivation of airway epithelial cells by tolllike receptor agonists. Am J Respir Cell Mol Biol , Kato A, et altlr3 and Th2 cytokinedependent production of thymic stromal lymphopoietin in human airway epithelial cells. J Imminol , KurtJones EA, et alpattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nature Immunol , Hewson CA, et altolllike receptor 3 is induced by and mediates antiviral activity against rhinovirus infection of human bronchial epithelial cells. J Virol , Groskreutz DJ, et alrespiratory syncytial virus induces TLR3 protein and protein kinase R, Leading to increased doublestranded RNA responsiveness in airway epithelial cells. J Immunol , Monick MM, et alrespiratory syncytial virus upregulates TLR4 and sensitizes airway epithelial cells to endotoxin. J Biol Chem , Takeuchi R, et alrespiratory syncytial virus infection of human alveolar epithelial cells enhances interferon regulatory factor 1 and interleukin1 converting enzyme gene expression but does not cause apoptosis. J Virol , Tsutsumi H, et alrespiratory syncytial virus infection of human respiratory epithelial cells enhances inducible nitric oxide synthase gene expression. J Leukoc Biol , Stark JM, et alimmune and functional role of nitric oxide in a mouse model of respiratory syncytial virus infection. J Infect Dis , RS Marodi LDownregulation of Th1 responses in human neonates. Clin Exp Immunol 12812, Joshi P, et alinterferongamma levels in nasopharyngeal secretions of infants with respiratory syncytial virus and other respiratory viral infections. Clin Exp Immunol , BermejoMartin JF, et alpredominance of Th2 cytokines, CXC chemokines and innate immunity mediators at the mucosal level during severe respiratory syncytial virus infection in children. Eur Cytokine Netw , Taguchi A, et alinterleukin8 promoter polymorphism increases the risk of atrophic gastritis and gastric cancer in Japan. Cancer Epidemiol Biomakers Prev , Sigurs N, et alrespiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am J Respir Crit Care Med , Ermers MJ, et alil13 genetic polymorphism identifies children with late wheezing after respiratory syncytial virus infection. J Allergy Clin Immunol , Janssen R, et alhost transcription profiles upon primary respiratory syncytial virus infection. J Virol , Janssen R, et algenetic susceptibility to respiratory syncytial virus bronchiolitis is predominantly associated with innate immune genes. J Infect Dis , Hoebee B, et alassociation of severe respiratory syncytial virus bronchiolitis with interleukin 4 and interleukin4 receptor alpha polymorphisms. J Infect Dis , Tal G, et alassociation between common Toll like receptor 4 mutations and severe respiratory syncytial virus disease. J Infect Dis , KurtJones EA, et alpattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol , 2000
8 Nasal cytokine response to respiratory syncytial virus infection in childhood Taro MIURA, Yasuyo KASHIWAGI, Hisashi KAWASHIMA Department of Pediatrics, Tokyo Medical University Respiratory syncytial virusrsvinfection is a severe respiratory disease in infants. However, the levels of chemokines and cytokines in the nasal aspirate of patients remain unclear. This study determined the levels of chemokines and cytokines in order to elucidate the role of chemokine and cytokine production in serious and mild RSV infection. A total of 46 children were classified into 2 groups of patientsa seriousn147 boys, 7 girlsand mild groupn3218 boys, 14 girls. The average and standard deviation of age in the patients was months and months in the serious and mild group, respectively. The levels of 3 chemokines and 14 cytokines in the nasal aspirates of 46 RSV infections were determined. The level of the cytokine IL13 and messenger RNA in IL8 was elevated markedly and significantly in the serious group, respectively. The IL8251A allele tended to associate with increased IL8 production in RSV infection. Severity of the illness may be correlated with chemokine and cytokine production caused by not only RSV infection but also genetic factor
Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations
Identifying Biologic Targets to Attenuate or Eliminate Exacerbations exacerbations are a major cause of disease morbidity and costs. For both children and adults, viral respiratory infections are the major
Vol. 26 No IL 1 IL 6 IL 8. interleukin IL 6. Key words CCL4 IL Interleukin 6
Vol. 26No. 121 1 1 1 1 73 4 17 8 2 GCSF CCL4 IL1IL6IL8 60500 30 8 1 2 3 interleukinil6 4 Key wordsccl4ilinterleukin6 1 1600023 671 22 NOx 5 2008 12 2009 5 A 77 4 Genzyme Diagnostics FLU 1 3 ml 1 15,000
Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis
Hypersensitivity Disorders Hypersensitivity Disorders Immune Response IgE Disease Example Ragweed hay fever IgG Cytotoxic Immune complex T Cell Hemolytic anemia Serum sickness Poison ivy IgE-mediated Diseases
DNA vaccine, peripheral T-cell tolerance modulation 185
Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory
Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.
REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial
Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine
Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline! Consensus characteristics! Allergens:role in asthma! Immune/inflammatory basis! Genetic basis!
Impact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma
American Association for Respiratory Care Asthma Educator Certification Prep Course Asthma Epidemiology and Pathophysiology Robert C. Cohn, MD, FAARC MetroHealth Medical Center Cleveland, OH Impact of
The Link Between Viruses and Asthma
The Link Between Viruses and Asthma CATHERINE KIER, MD Professor of Clinical Pediatrics Division Chief, Pediatric Pulmonary, and Cystic Fibrosis Center Director, Pediatric Sleep Disorders Center SUNY Stony
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
Infantile respiratory syncytial virus and human rhinovirus infections: respective role in inception and persistence of wheezing
REVIEW RSV AND HRV INFECTION Infantile respiratory syncytial virus and human rhinovirus infections: respective role in inception and persistence of wheezing Giovanni A. Rossi 1 and Andrew A. Colin 2 Affiliations:
Pulmonary Perspective
Pulmonary Perspective Bronchiolitis to Asthma A Review and Call for Studies of Gene Virus Interactions in Asthma Causation Anne Marie Singh, Paul E. Moore, James E. Gern, Robert F. Lemanske, Jr., and Tina
Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
Exhaled Nitric Oxide: An Adjunctive Tool in the Diagnosis and Management of Asthma
Exhaled Nitric Oxide: An Adjunctive Tool in the Diagnosis and Management of Asthma Jason Debley, MD, MPH Assistant Professor, Pediatrics Division of Pulmonary Medicine University of Washington School of
Inflammation in the clinic
Inflammation in the clinic Stephen T. Holgate MRC Clinical Professor of Immunopharmacology ILSI Europe Workshop, Seville, May 14-15 2012 The immune system acts in four general ways to ensure host defence
Defining Asthma: Clinical Criteria. Defining Asthma: Bronchial Hyperresponsiveness
Defining Asthma: Clinical Criteria Atopy 34% Recent wheeze 20% Asthma 11% AHR 19% n = 807 From: Woolcock, AJ. Asthma in Textbook of Respiratory Medicine, 2nd ed. Murray, Nadel, eds.(saunders:philadelphia)
Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
Property of Presenter
Have We Missed A Role For Neutrophils In Asthma? In Steroid-Refractory Asthma? Erwin W. Gelfand, MD Chairman, Department of Pediatrics National Jewish Health Professor of Pediatrics and Immunology University
Edinburgh Research Explorer
Edinburgh Research Explorer The human immune response to respiratory syncytial virus infection Citation for published version: Russell, C, Unger, SA, Walton, M & Schwarze, J 2017, 'The human immune response
The immunology of virus infection in asthma
Eur Respir J 2001; 18: 1013 1025 Copyright #ERS Journals Ltd 2001 DOI: 10.1183/09031936.01.00228701 European Respiratory Journal Printed in UK all rights reserved ISSN 0903-1936 SERIES 0LUNG INFECTIONS
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
Cytokine and Chemokine Gene Expression after Primary and Secondary Respiratory Syncytial Virus Infection in Cotton Rats
1780 Cytokine and Chemokine Gene Expression after Primary and Secondary Respiratory Syncytial Virus Infection in Cotton Rats Jorge C. G. Blanco, 1 Joann Y. Richardson, 2 Miriam E. R. Darnell, 1,3 Anne
Potential public health impact of RSV vaccines. R. Karron December 2016
Potential public health impact of RSV vaccines R. Karron December 2016 1. RSV is The leading cause of hospitalization in infants and in many high-income countries; >2 million medical visits annually in
Cell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
Supporting Information
Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus
Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline
Pathology of Asthma Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline Bronchial Asthma Definition: chronic, relapsing inflammatory lung disorder characterised by reversible
VIRUSES AND ASTHMA. They asked if the sneezle came after the wheezle, or if the first sneezle came first
VIRUSES AND ASTHMA They asked if the sneezle came after the wheezle, or if the first sneezle came first First documented viral-association of asthma attacks occurred during influenza epidemics at 4 th
Intrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
Lecture on Innate Immunity and Inflammation
Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
Mechanisms of asthma and allergic inflammation
IL-13 genetic polymorphism identifies children with late after respiratory syncytial virus infection Marieke J. J. Ermers, MD, a Barbara Hoebee, PhD, b Hennie M. Hodemaekers, b Tjeerd G. Kimman, PhD, c
Abstract: I. A ims Aim 1:
Abstract: Previous work from our laboratory demonstrated that obese mice have alterations in antiviral cytokine gene expression when infected with the influenza virus. Since these cytokines play a major
Medicine Dr. Kawa Lecture 1 Asthma Obstructive & Restrictive Pulmonary Diseases Obstructive Pulmonary Disease Indicate obstruction to flow of air
Medicine Dr. Kawa Lecture 1 Asthma Obstructive & Restrictive Pulmonary Diseases Obstructive Pulmonary Disease Indicate obstruction to flow of air through the airways. As asthma, COPD ( chronic bronchitis
Allergy and Immunology Review Corner: Chapter 75 of Middleton s Allergy Principles and Practice, 7 th Edition, edited by N. Franklin Adkinson, et al.
Allergy and Immunology Review Corner: Chapter 75 of Middleton s Allergy Principles and Practice, 7 th Edition, edited by N. Franklin Adkinson, et al. Chapter 75: Approach to Infants and Children with Asthma
Index. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Adaptive immune response biologic response modifiers and, 735 737 S-Adenosylmethionine (SAMe) for hepatitis, 825 826 Albinterferon for hepatitis,
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Dr Sarah Sasson SydPATH Registrar 23 rd June 2014 TLRs: Introduction Discovered in 1990s Recognise conserved structures in pathogens Rely
1. TLR. TLR Toll-like receptors. Toll Toll-like receptor, TLR TLR TLR TLR. type I TLR TLR. Toll
54pp.145 152 2004 1. TLR T B TLR Toll-like receptors TLR TLR I IFN TLR T B B T Toll NF- B 1996 565-0871 3-1 TEL 06-6879-8303 FAX 06-6879-8305 E-mail uemattsu@biken.osaka-u.ac.jp Toll Toll-like receptor,
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Vitamina D: un ormone multifunzione
Vitamina D: un ormone multifunzione Introduction And Infections Diego Peroni Clinica Pediatrica Universita di Ferrara Food Allergy Asthma Conclusions diego.peroni@unife.it Holick, M. F. J. Clin. Invest.
CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
2. Cytokines and chemokines
2. Cytokines and chemokines Larry C. Borish, MD, and John W. Steinke, PhD Charlottesville, Va Cytokines and chemokines are redundant secreted proteins with growth, differentiation, and activation functions
Step up if needed (first, check adherence, environmental control and comorbid conditions) Patients ASSESS CONTROL. Step down if possible
12/9/212 Pharmacogenomics Treating the Individual Asthma Patient Elliot Israel, M.D. Professor of Medicine Harvard Medical School Brigham & Women s Hospital Partners Asthma Center Too much of a good thing?
Diagnosis and Management of Fungal Allergy Monday, 9-139
Diagnosis and Management of Fungal Allergy Monday, 9-139 13-2010 Alan P. Knutsen,, MD Director, Pediatric Allergy & Immunology Director, Jeffrey Modell Diagnostic Center for Primary Immunodeficiencies
Viral infections and asthma: an inflammatory interface?
STATE OF THE ART INFECTIONS AND ASTHMA Viral infections and asthma: an inflammatory interface? Brian G.G. Oliver 1,2, Paul Robinson 2,3,4, Mathew Peters 5,6 and Judy Black 2 Affiliations: 1 School of Medical
Early life nutrition and Inflammation
Early life nutrition and Inflammation Harry J McArdle and Graham Devereux Rowett institute of Nutrition and Health, University of Aberdeen. Aberdeen Royal Infirmary. The process of development Critical
Rhinoviruses, allergic inflammation, and asthma
Monica L. Gavala Paul J. Bertics James E. Gern Rhinoviruses, allergic inflammation, and asthma Authors addresses Monica L. Gavala 1, Paul J. Bertics 1, James E. Gern 2,3 1 Department of Biomolecular Chemistry,
Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series
Cutaneous Immunology: Innate Immune Responses Skin Biology Lecture Series The Immune Response: Innate and Adaptive Components Source: Wolff, Goldsmith, Katz, Gilchrest, Paller, Leffell. Fitzpatrick s Dermatology
Implications on therapy. Prof. of Medicine and Allergy Faculty of Medicine, Cairo University
Implications on therapy Dr. Hisham Tarraf MD,FRCP(Edinb.) Prof. of Medicine and Allergy Faculty of Medicine, Cairo University Need for better understanding Global health problem Impact on quality of life
TREAMENT OF RECURRENT VIRUS-INDUCED WHEEZING IN YOUNG CHILDREN. Dr Lại Lê Hưng Respiratory Department
TREAMENT OF RECURRENT VIRUS-INDUCED WHEEZING IN YOUNG CHILDREN Dr Lại Lê Hưng Respiratory Department Literature review current through: Feb 2013. This topic last updated: Aug 14, 2012 INTRODUCTION Wheezing
ACCEPTED. Viral and host factors in human respiratory syncytial virus pathogenesis. Peter L. Collins 1 and Barney S. Graham 2.
JVI Accepts, published online ahead of print on 10 October 2007 J. Virol. doi:10.1128/jvi.01625-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
Respiratory syncytial virus (RSV) is the
[haematologica reports] 2006;2(10):50-55 IMMUNE RESPONSE TO RSV INFECTION Respiratory Syncytial Virus (RSV): Characteristics of Infection and the Role of Immune Response in the Evolution of Disease PEARAY
Infections in children with asthma
International Journal of Immunology 2014; 2(1): 1-5 Published online January 30, 2014 (http://www.sciencepublishinggroup.com/j/iji) doi: 10.11648/j.iji.20140201.11 Infections in children with asthma Abdullah
Potential therapeutic implications of new insights into respiratory syncytial virus disease Peter JM Openshaw
Available online http://respiratory-research.com/content/3/s1/s15 Potential therapeutic implications of new insights into respiratory syncytial virus disease Peter JM Openshaw Department of Respiratory
TNF-α antibodies in immune-mediated inflammatory disorders
1 TNF-α antibodies in immune-mediated inflammatory disorders Potential side effects: allergic reactions, opportunistic infections joint lesions and psoriasiform and eczematiform skin lesions Seemingly
Innate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine
Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline Consensus characteristics/incidence data Immune/inflammatory basis Etiology/Genetic basis Hygiene
JPEMS Nantes, Basic Immunology INNATE IMMUNITY
JPEMS Nantes, 2014- Basic Immunology INNATE IMMUNITY Teacher: Pr. Régis Josien, Laboratoire d Immunologie and INSERM U1064, CHU Nantes Regis.Josien@univ-nantes.fr 1 Contents 1. General features and specificity
Management of wheeze in pre-school children. Prof Colin Robertson, Respiratory Medicine, Royal Children s Hospital, Melbourne
Management of wheeze in pre-school children Prof Colin Robertson, Respiratory Medicine, Royal Children s Hospital, Melbourne General Practitioner encounters for asthma Asthma in Australia, 2003 Emergency
This is an author-submitted, peer-reviewed version of a manuscript that has been accepted for publication in the European Respiratory Journal, prior
This is an author-submitted, peer-reviewed version of a manuscript that has been accepted for publication in the European Respiratory Journal, prior to copy-editing, formatting and typesetting. This version
Bronchiolitis is the most common lower
Eur Respir J 2012; 39: 76 80 DOI: 10.1183/09031936.00040211 CopyrightßERS 2012 Preschool asthma after bronchiolitis in infancy P. Koponen*, M. Helminen*, M. Paassilta #, T. Luukkaala " and M. Korppi* ABSTRACT:
Innate Immunity. Natural or native immunity
Innate Immunity 1 Innate Immunity Natural or native immunity 2 When microbes enter in the body 3 Secondly, it also stimulates the adaptive immune system 4 Immunologic memory 5 Components of Innate Immunity
IL-33 Dependent Type 2 Inflammation during Rhinovirus-induced Asthma Exacerbations In Vivo
IL-33 Dependent Type 2 Inflammation during Rhinovirus-induced Asthma Exacerbations In Vivo David J. Jackson, Heidi Makrinioti1, Batika M. J. Rana, Betty W. H. Shamji, Maria-Belen Trujillo-Torralbo, Joseph
Update on Immunology 12/31/12. Disclosures. Outline. Outline. Outline. Pathophysiology of Allergic Disease. Allergy background Novel T cell subsets
Update on Immunology Mitchell H. Grayson, MD Associate Professor Medical College of Wisconsin Dec 2012 Disclosures Employer Medical College of Wisconsin Research support National Institutes of Health $100,000
The cytokine network in asthma and chronic obstructive pulmonary disease
Review series The cytokine network in asthma and chronic obstructive pulmonary disease Peter J. Barnes National Heart & Lung Institute, Imperial College London, London, United Kingdom. Asthma and chronic
Cytokines (II) Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel:
Cytokines (II) Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel: 4677363 aalshamsan@ksu.edu.sa Learning Objectives By the end of this lecture you will be able to: 1 Understand the physiological
Genetics. Environment. You Are Only 10% Human. Pathogenesis of IBD. Advances in the Pathogenesis of IBD: Genetics Leads to Function IBD
Advances in the Pathogenesis of IBD: Genetics Leads to Function Pathogenesis of IBD Environmental Factors Microbes Scott Plevy, MD Associate Professor of Medicine, Microbiology & Immunology UNC School
Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
Risk Factors for Recurrent Early Wheezing in Childhood: Viral Infections
Risk Factors for Recurrent Early Wheezing in Childhood: Viral Infections Robert F. Lemanske, Jr., M.D. Professor of Pediatrics and Medicine University of Wisconsin Madison, WI Jackson & Lemanske, Immunology
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
The role of dendritic cells in asthma
Mechanisms of allergic diseases Series editors: Joshua A. Boyce, MD, Fred Finkelman, MD, William T. Shearer, MD, and Donata Vercelli, MD The role of dendritic cells in asthma Michelle Ann Gill, MD, PhD
Understanding How Allergic Responses End: The Allergy Resolvome. Lipid mediators
Understanding How Allergic Responses End: The Allergy Resolvome Lipid mediators Koichiro Asano Tokai University School of Medicine, Kanagawa, JAPAN ko-asano@tokai-u.jp Resolution of granulocytic inflammation
Original Article CD4 + T cell proliferation and inhibition of activation-induced cell death (AICD) in childhood asthma
Int J Clin Exp Med 2018;11(3):2319-2324 www.ijcem.com /ISSN:1940-5901/IJCEM0066213 Original Article CD4 + T cell proliferation and inhibition of activation-induced cell death (AICD) in childhood asthma
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Effector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
Overview of the immune system
Overview of the immune system Immune system Innate (nonspecific) 1 st line of defense Adaptive (specific) 2 nd line of defense Cellular components Humoral components Cellular components Humoral components
Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
The relationship between serum selenium levels and frequent wheeze in children
The Turkish Journal of Pediatrics 2006; 48: 308-312 Original The relationship between serum selenium levels and frequent wheeze in children Can Naci Kocabaş 1, Gönül Adalıoğlu 1, Turgay Coşkun 2, Ayfer
Defining Asthma: Clinical Criteria. Defining Asthma: Bronchial Hyperresponsiveness
Defining Asthma: Clinical Criteria Atopy 34% Recent wheeze 20% Asthma 11% AHR 19% n = 807 From: Woolcock, AJ. Asthma in Textbook of Respiratory Medicine, 2nd ed. Murray, Nadel, eds.(saunders:philadelphia)
Defining Asthma: Bronchial Hyperresponsiveness. Defining Asthma: Clinical Criteria. Impaired Ventilation in Asthma. Dynamic Imaging of Asthma
Defining Asthma: Clinical Criteria Defining Asthma: Bronchial Hyperresponsiveness Atopy 34% Recent wheeze 20% Asthma 11% AHR 19% n = 807 From: Woolcock, AJ. Asthma in Textbook of Respiratory Medicine,
1/30/2016 RESPIRATORY INFECTIONS AND ASTHMA NO DISCLOSURES NO FINANCIAL INTEREST INFORMATION OBTAINED JACI AJRCCM
RESPIRATORY INFECTIONS AND ASTHMA NO DISCLOSURES NO FINANCIAL INTEREST INFORMATION OBTAINED JACI AJRCCM 1 2 year old male HISTORY -Daycare since 9 months of age -Recurrent symptoms since 10 months of age:
Innate Immunity. Natural or native immunity
Innate Immunity 1 Innate Immunity Natural or native immunity 2 When microbes enter in the body 3 Secondly, it also stimulates the adaptive immune system 4 Immunologic memory 5 Components of Innate Immunity
EVect of oral glucocorticoid treatment on serum inflammatory markers in acute asthma
18 Department of Paediatrics, Queen Mary s Hospital, Sidcup, Kent DA14 6LT, UK A Sahid El-Radhi Department of Paediatrics, Royal Brompton Hospital, London SW3 6NP, UK C L Hogg J K Bungre A Bush C J Corrigan
Early Administration of Azithromycin and Prevention of Severe Lower Respiratory Tract Illnesses in Preschool Children With a History of Such Illnesses
Early Administration of Azithromycin and Prevention of Severe Lower Respiratory Tract Illnesses in Preschool Children With a History of Such Illnesses M I R E N G U E N E C H E A - S O L A, M. D. U C S
HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk?
HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk? Dept of Emergency and Critical Care Medicine The University of Tokyo Kent Doi, MD. PhD Organ crosstalk in AKI Grams ME, Rabb H. Kidney Int.
Respiratory syncytial virus: The virus, the disease and the immune response
PAEDIATRIC RESPIRATORY REVIEWS (2004) 5(Suppl A), S119 S126 Respiratory syncytial virus: The virus, the disease and the immune response Pearay L. Ogra* Department of Pediatrics, State University of New
University of Groningen. Exercise induced bronchoconstriction in childhood asthma van Leeuwen, Janneke
University of Groningen Exercise induced bronchoconstriction in childhood asthma van Leeuwen, Janneke IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research Shoude Jin Harbin Medical University, China Background COPD ------ a silent killer Insidious,
IgE-mediated allergy in elderly patients with asthma
Allergology international (1997) 46: 237-241 Original Article IgE-mediated allergy in elderly patients with asthma Fumihiro Mitsunobu, Takashi Mifune, Yasuhiro Hosaki, Kouzou Ashida, Hirofumi Tsugeno,
Functional SNPs of the CCL5 gene and non-emphysematous phenotype in patients with COPD
ERJ Express. Published on April 2, 2008 as doi: 10.1183/09031936.00115307 Functional SNPs of the CCL5 gene and non-emphysematous phenotype in patients with COPD Nobuyuki Hizawa 1, 2, Hironi Makita 1, Yasuyuki
Anti-allergic Effect of Bee Venom in An Allergic Rhinitis
Anti-allergic Effect of Bee Venom in An Allergic Rhinitis Dr: Magdy I. Al-Shourbagi Sharm International Hospital Allergic Rhinitis Rhinitis: Symptomatic disorder of the nose characterized by itching, nasal
Innate Immunity. Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016
Innate Immunity Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016 Objectives: Explain how innate immune system recognizes foreign substances
Identification of Microbes
Identification of Microbes Recognition by PRR (pattern recognition receptors) Recognize conserved molecular patterns on microbes called pathogen associated molecular patterns (PAMPs) which are not present
Appendix E1. Epidemiology
Appendix E1 Epidemiology Viruses are the most frequent cause of human infectious diseases and are responsible for a spectrum of illnesses ranging from trivial colds to fatal immunoimpairment caused by
2 االستاذ المساعد الدكتور خالد ياسين الزاملي \ مناعة \ المرحلة الثانية \ التحليالت المرضية \
![2 االستاذ المساعد الدكتور خالد ياسين الزاملي \ مناعة \ المرحلة الثانية \ التحليالت المرضية \](/thumbs/96/128020366.jpg "2 االستاذ المساعد الدكتور خالد ياسين الزاملي \ مناعة \ المرحلة الثانية \ التحليالت المرضية \")
Innate Immunity Innate immunity: is the resistance that an individual possesses by birth. Innate immunity may be classified as (a) individual immunity (b) racial immunity (c) species immunity. Factors
Lecture on Innate Immunity and Inflammation. Innate Immunity: An Evolutionary View
Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator
Eat Dirt: Why Cleanliness is Bad for Asthma
Eat Dirt: Why Cleanliness is Bad for Asthma Joel N. Kline MD MSc Professor, Pulmonary Medicine Director: UI Adult Asthma Center Director, Clinical Research ICTS University of Iowa Iowa City, IA 1 Disclosures:
Index. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Action plans, and asthma self-management, 47 51 education on, 48 49 health literacy-based education on, 49 50 Airway hyperresponsiveness, assessment