Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
|
|
|
- Julia Shauna McDowell
- 5 years ago
- Views:
Transcription
1 Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, , 300 IL-3 IL-6 IL-8 bioassay, 350 IL-15 bioassay, interleukins in synovial fluid, TNF Blister fluids, 313, collection, cytokine concentrations in, 319 passage of molecules into, pathological, 313 suction blister fluids, 315 Bradford assay, 404 Breast cancer, 207 Brefeldin A, 44 Bullous dermatoses, C C/EBP, 100 Celiac disease, 67 Cerebrospinal fluid, 337, 338, assaying interleukins in, Circadian rhythmicity in cytokine levels, , see also Interleukins Chemiluminescence, Chemokines, 125, 129, 138 Chronic obstructive pulmonary disease, 305 Confocal microscopy, CRE, 100 CTLL-2 cells, , effect of cryopreservation, 192 sensitivity over time, 191 Cystic fibrosis, 305 D Depressive illness, 217, cytokine levels, E Electrophoresis, 103, 107 Electroporation, 386, 401 ELISA, 3 15, assaying IL-8, comparison with bioassay, 318 history, 3, mrna ELISAs, 13 overview, 3 5 reagent suppliers, 13 sandwich ELISA, 6 13, substrates, 12 ELISPOT, 17 28, 29 39, dual color analysis, enumeration of interleukin-secreting cells, principals,
2 440 Index stardust assay, Enzyme-linked immunosorbent assay, see ELISA F FACS, see Flow cytometry Flash-type bioluminescence, 83 97, advantages, as an alternative to radioactive methodologies, 94 bioluminescent hybridization assays, principals of, Flow cytometry, 41 48, assaying intracellular interleukins, 41 48, principals, 41 websites, 43 G G-CSF, 129 Gene arrays, see Microarrays Glycoslation analysis, 404 GM-CSF, 164, 346, bioassay, 351 Grave s disease, , assaying interleukins in, Green fluorescent protein, applications in cell signaling, H Hyopthalamic-pituitary-adrenal axis, 217 I Interleukins, Interleukin-1 (IL-1), 129, 157, 163, bioassay, 299, membrane bioassay, 299 circadian variation in IL-1, in depression, , in seminal plasma, , 297, 299, 330, 324 single nucleotide polymorphism in IL-1 Interleukin-1 receptor antagonist (IL-1Ra), 129, in seminal plasma, 293, 295 Interleukin-2 (IL-2), 34, 90 92, 163, , 193, assaying by bioassay, , 300 assaying by ELISPOT stardust assay, 34 assaying by flash-type bioluminescence, in depression, 218, 221, 222, 226 signal transduction, Interleukin-2 (IL-2) receptor, 150, 152, 163, circadian variation, 164 Interleukin-3 (IL-3), 253, Interleukin-4 (IL-4), 20, 157, 164, assaying by ELISPOT stardust assay, 34 Interleukin-5 (IL-5), 20, 164,
3 Index 441 in sputum, 305, 307 use of proteases to improve recovery, 307, 311 Interleukin-6 (IL-6), , , , 163, 164, circadian variation, ELISA, in breast cancer, in depressive illness, 218, 221, 222, 225 in seminal plasma, 293, 295, 297, 299, 329 in tears, 346 mrna detection using Xplore assay, Interleukin-8 (IL-8), 129, assaying IL-8, bioassay, 350 in sputum, 305 in tears, 346, 350, 351 roles, Interleukin-10 (IL-10), 20, 157, 164, in psoriasis, in seminal plasma, Interleukin-12 (IL-12), 129, 157, in seminal plasma, Interleukin-13 (IL-13), 253, activation of phosphoinositide-3- kinase by, 363, 365 Interleukin-15 (IL-15), , assaying by ELISA, 194, assaying by RT-PCR, bioassay, Interleukin-17 (IL-17), 396 Interleukin-18 (IL-18), 157, Immunoaffinity-receptor affinity chromatography, , column construction, 145, 149 fluorochrome labeling of samples, 150 principles, 145 Immunoassays, 263 history of, interleukins in synovial fluid, Immunohistochemistry, embedding, 159 fixation, 160 staining of cells in tissue culture, 160, tissue processing, 159 Interferon-, 67, 163, detection by quantitative RT-PCR in celiac disease, 67 detection by RNAse protection, 129 circadian variation, J J774 cells, 121 L Luminometry, Lyophilization, 405 M MCP-1, 328
4 442 Index M-CSF, 328, assaying in cerebrospinal fluid, Messenger RNA, see mrna Mononuclear cells, 21 23, mucosal mononuclear cells: isolation, separation from PBMCs, 21, Microarrays, , commercially available arrays, comparison of gene array techniques, 422 cdna arrays, , principal of assay, hybridization, overview of cdna array for cytokine detection, 421 quantification, 434 types of DNA arrays, 420 Migraine, 268, assaying interleukins in, recruitment of patients, mrna, 51 52, measurement by nonradioactive Northern blotting, measurement by RNAse protection assay, preparation of digoxigenin-labeled probes, 102, 106 quantitation by flash-type bioluminescence, standards for quantification of cytokines, 65 total RNA extraction, 51, 63 64, 68 69, design of probes, 116 from biopsy material, 63 from cartilage, 102, 105 from cells in culture, 101, 104 from skin, 243, 246 from synovial membranes, 101, mechanism, 113 preparation of standards, 114 Xplore assay, Myocardial infarction, acute, 273 role of interleukins, testing strategy for interleukins, 275 N NFAT, 100 NF- B, 100 NK cells, 170 Northern blotting, , hybridization and detection, 108 nonradioactive detection method, P Peritoneal fluids, , assaying cytokines in, sample collection, 286 Phosphoinositide-3-kinase, 357, assays, classes, Phosphotyrosine analysis, 373 Phosphospecific antibodies, Preanalytical factors in interleukin assays, 276 Psoriasis, 239, assaying interleukins in, cytokine concentration in sera, 319 Q Quantitative RT-PCR, 56, 59 76, standards used, 66 principals, R Ras, affinity precipitation of, Recombinant cytokine protein production, , use of Pichia pastoris, , cytokines produced, 394
5 Index 443 Reverse transcriptase polymerase chain reaction, see RT-PCR RNAse protection assay, , advantages of multiprobe method, 125 analysis of results, cdna template sets, 129 detection by chemiluminescence, comparison with direct methods, 126 overview, 127 psoralen-biotin labeling of RNA, RT-PCR, 49 58, advantages, 50 PCR reaction, primer design, principals, 49 quantitative RT-PCR, see Quantitative RT-PCR single cell RT-PCR, S Seminal plasma, , 297 Shaw-Kamen instability sequences, 101 Single nucleotide polymorphisms, 409, detection by allelic discrimination, definition, 409 in IL-1 gene, , probes for analysis, SNPs, see Single nucleotide polymorphisms Sputum, 305, assaying interleukins in, , processing, 305 use of proteases to improve recovery, 307 STATs, affinity precipitation of, 373, Synovial fluid, , assaying interleukins in, bioassays for interleukins, cytokine levels in arthritis, 328 immunoassays for interleukins, 330, 331 Taqman analysis, Tears, 345, assaying interleukins in, collection of, Th1 cells, 164, 166, 285, 288 Th2 cells, 164, 166, 285, 288 Th3 cells, 286 TNF, 47, , 163, assaying intracellularly, 47 assaying mrna using Xplore assay, circadian variation in p75 receptor, 164 in depressive illness, , 228 in seminal plasma, , , 330, 333, 334 Tumor necrosis factor, see TNF TGF-, 20, 163, Transforming growth factor-, see TGF- W Western blotting, Whole blood assay for cytokines, X Xplore assays, , design of probes, 116 mechanism, 113 preparation of standards, 114
Optimizing Intracellular Flow Cytometry
Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman
The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The spread of tumors, a process called metastasis, is a dreaded complication
Cancer Biometrics: Results of the 2003 isbtc Workshop. Theresa L. Whiteside, Ph.D., ABMLI University of Pittsburgh Cancer Institute
Cancer Biometrics: Results of the 2003 isbtc Workshop Theresa L. Whiteside, Ph.D., ABMLI University of Pittsburgh Cancer Institute The workshop objective The objective was to consider state-of-theart approaches
Bead Based Assays for Cytokine Detection
Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)
BD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop
BD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop Maria Dinkelmann, PhD Senior Marketing Applications Specialist BD Biosciences, Ann Arbor, MI 23-14380-00 Cellular Communication
A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.
Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
Uncovering the mechanisms of wound healing and fibrosis
Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
ACQUIRED IMMUNODEFICIENCY SYNDROME AND ITS OCULAR COMPLICATIONS
ACQUIRED IMMUNODEFICIENCY SYNDROME AND ITS OCULAR COMPLICATIONS Acquired immunodeficiency syndrome (AIDS ) is an infectious disease caused by a retrovirus, the human immunodeficiency virus(hiv). AIDS is
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Neoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
Supporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Supplemental figures
Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer
VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of
Laboratory diagnosis of congenital infections
Laboratory diagnosis of congenital infections Laboratory diagnosis of HSV Direct staining Tzanck test Immunostaining HSV isolation Serology PCR Tzanck test Cell scrape from base of the lesion smear on
Innate Immunity & Inflammation
Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Masayuki Fukata, MD, Ph.D. Research Scientist II Division of Gastroenterology, Department of Medicine, F. Widjaja Foundation,
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
Rheumatoid arthritis: A heterogeneous disease with a heterogeneous response to treatment
Rheumatoid arthritis: A heterogeneous disease with a heterogeneous response to treatment Pr Pierre Miossec MD PhD Clinical Immunology Unit Hôpital Edouard Herriot Lyon miossec@univ-lyon1.fr Pathogenesis
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
TNF-α antibodies in immune-mediated inflammatory disorders
1 TNF-α antibodies in immune-mediated inflammatory disorders Potential side effects: allergic reactions, opportunistic infections joint lesions and psoriasiform and eczematiform skin lesions Seemingly
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
ankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military
Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan
International Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
Basic Immunology. Cytokines, cytokine receptors. Lecture 8th. Timea Berki MD, PhD
Basic Immunology Lecture 8th Cytokines, cytokine receptors Timea Berki MD, PhD 1. By direct cell-cell interactions: through adhesion molecules 2. By low MW regulatory proteins, called cytokines: messengers
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
microrna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
Doctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Version: CLLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
colorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity
Multiparametric Flow Cytometric Analysis of Inter- Patient Variation in STAT1 Phosphorylation Following Interferon Alfa Immunotherapy
Multiparametric Flow Cytometric Analysis of Inter- Patient Variation in STAT1 Phosphorylation Following Interferon Alfa Immunotherapy Gregory B. Lesinski, Sri Vidya Kondadasula, Tim Crespin, Lei Shen,
Horizon 2020 Programme. SFS-01b Tackling losses from terrestrial animal diseases
Horizon 2020 Programme SFS-01b-2014 Tackling losses from terrestrial animal diseases Strengthening Animal Production and Health through the Immune Response Project ID: 633184 D12.1 Age related innate responses
M.Sc. (Reproductive Biology & Clinical Embryology)
M.Sc. (Reproductive Biology & Clinical Embryology) ACADEMIC SCHEDULE Theory (Didactic) Lectures + Seminars + Journal Clubs Semester I & II (2 hours / day) Practicals (Hands-on + Demo) Semester I & II (first
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Index. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Adherence, to bismuth quadruple therapy, 543 546 Adjuvant therapy, probiotics as, 567 569 Age factors, in gastric cancer, 611 612, 616 AID protein,
ImmunoTools special Award 2014
ImmunoTools special Award 2014 Davide Ferrari, PhD University of Ferrara, Department of Morphology, Surgery and Experimental Medicine. Section of Pathology, Oncology and Exper. Biology via L. Borsari 46,
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
Life Sciences. Cytokine assays
Life Sciences Cytokine assays A full range of cytokines Cisbio s kits cover the full range of cytokines: interleukins, interferons (IFN), chemokines, TNF and lymphokines. All our assays are cell based
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Chapter 10apter 9. Chapter 10. Summary
Chapter 10apter 9 Chapter 10 The field of proteomics has developed rapidly in recent years. The essence of proteomics is to characterize the behavior of a group of proteins, the system rather than the
4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
Protein Arrays High Throughput Protein Quantification from Total Cell Lysates
Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland
of clinical laboratory diagnosis in Extra-pulmonary Tuberculosis
New approaches and the importance of clinical laboratory diagnosis in Extra-pulmonary Tuberculosis Bahrmand.AR, Hadizadeh Tasbiti.AR, Saifi.M, Yari.SH, Karimi.A, Fateh.A, Tuberculosis Dept. Pasteur Institute
Nori Rabbit IL-2 ELISA Kit DataSheet
Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
Nutrition and Age-Associated Inflammation :Role of Nutritional Intervention Simin Nikbin Meydani, DVM, PhD.
Nutrition and Age-Associated Inflammation :Role of Nutritional Intervention Simin Nikbin Meydani, DVM, PhD simin.meydani@tufts.edu Outline 1) Role of immune and inflammatory responses in age-related diseases
The Modulation of Matrix Metalloproteinase and ADAM Gene Expression in Human Chondrocytes by Interleukin-1 and Oncostatin M
ARTHRITIS & RHEUMATISM Vol. 46, No. 4, April 2002, pp 961 967 DOI 10.1002/art.10212 2002, American College of Rheumatology The Modulation of Matrix Metalloproteinase and ADAM Gene Expression in Human Chondrocytes
INTRODUCTION TO PATHOLOGY
INTRODUCTION TO PATHOLOGY The literal translation of the word pathology is the study (logos) of suffering (pathos). It is a discipline that bridges clinical practice and basic sciences. Pathology is concerned
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Optimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Monocyte subsets in health and disease. Marion Frankenberger
Monocyte subsets in health and disease Marion Frankenberger main cellular components: Leukocytes Erythrocytes Composition of whole blood Monocytes belong to the cellular components of peripheral blood
p. 111 p. 185 p. 197 p. 238
Editorial Board Contributors Preface General Methods p. 1 General Methods: Antibody-Based and Molecular p. 3 Introduction p. 5 Antibody-Based Methods p. 6 p. xiii p. xv p. xxv Introduction to Molecular
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
Optimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors An encore presentation by Jurg Rohrer, PhD, BD Biosciences 10.26.10 Outline Introduction Cytokines
Microscopy Service 2019 Confocal Leica STED 3X Assisted $ 121
Microscopy Confocal Leica STED 3X Assisted $ 121 Self Use $ 54 Self Use Off Hours $ 27 Leica SP5 DM $ - Assisted $ 104 Self Use $ 37 Leica SP5 DMI $ - Assisted $ 114 Self Use $ 47 Olympus FV1000 Multiphoton
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
silent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
Transcription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*