Identification of Chlamydia pneumoniae by DNA Amplification

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 1992, p /92/ $02.00/0 Copyright 1992, American Society for Microbiology Vol. 30, No. 4 Identification of Chlamydia pneumoniae by DNA Amplification of the 16S rrna Gene CHARLOTTE A. GAYDOS,1* THOMAS C. QUINN,"12 AND JOSEPH J. EIDEN3 Division of Infectious Diseases, Department of Medicine, 1 and Division of Infectious Diseases, Department of Pediatrics,3 The Johns Hopkins University School of Medicine, Baltimore, Matyland and Laboratory of Immunoregulation, National Institute ofallergy and Infectious Diseases, Bethesda, Maryland Received 27 September 1991/Accepted 30 December 1991 Chlamydia pneumoniae is an important cause of respiratory disease in humans, but diagnosis of C. pneumoniae is hindered by difficulties in the in vitro growth of the organism. In order to improve detection and identification, we recently developed a polymerase chain reaction (PCR) assay which uses oligonucleotide primers specific for C. pneumoniae. The nucleic acid sequence was determined for the 16S rrna of C. pneumoniae, and regions in which C. pneumoniae differed from both Chlamydia psittaci and Chlamydia trachomatis were identified. Oligonucleotide primers corresponding to these unique regions were then synthesized and used in a PCR for the detection of C. pneumoniae. The C. pneumoniae-specific primers permitted the identification of six isolates of C. pneunwniae, but no reaction was observed with the 15 serovars of C. trachomatis or two strains of C. psittaci. PCR should prove to be valuable in confirming the identification of C. pneumoniae and in the diagnosis of C. pneumoniae infections. Chiamydia pneumoniae is a recently described cause of respiratory infection, accounting for as many as 10% of cases of community-acquired pneumonia (1, 4-6, 10, 11, 13, 14, 18, 19, 23). C. pneumoniae has also recently been implicated, on the basis of serologic assays, as a cause of bronchitis, sinusitis, and recently, acute chest syndrome of sickle cell disease as well as asthma attacks (15, 20). More extensive microbiological and epidemiological investigations of C. pneumoniae disease are needed, but routine isolation of the organism is difficult. Diagnosis of C. pneumoniae infection is usually made on the basis of elevated antibody titers by using microimmunofluorescence (MIF) and, occasionally, by in vitro isolation (4, 11). MIF serology is sensitive and specific but requires the detection of rising antibody titers in both acute- and convalescent-phase sera, resulting in a delay in definitive diagnosis. Thus, alternate methods of identification should prove helpful in improving the detection of C. pneumoniae infection. The polymerase chain reaction (PCR) has been used to amplify DNA from C. pneumoniae. The PCR is based on primers derived from the major outer membrane protein gene sequence of Chlamydia trachomatis, but these primers were not specific for C. pneumoniae (7, 9, 16). Pollard et al. (22) have also described the use of PCR for the detection of C. trachomatis and Chlamydia psittaci by using primers based on the sequences of the 16S rrnas of those organisms. One primer pair (1A and 1B) yielded a PCR product of 240 bp when it was reacted with DNA from either C. trachomatis or C. psittaci. Another 16S rrna primer pair (2A and 2B) was reported to not react with C. trachomatis but produced a 119-bp product when it was reacted with C. psittaci. While these two primer pairs were reported to permit the differentiation of C. trachomatis from C. psittaci, the reaction of the 16S rrna primers with C. pneumoniae was not noted, and the 16S rrna sequence of C. pneumoniae was not available for comparison. Since C. pneumoniae may be encountered in respiratory specimens, the reactivity * Corresponding author. of this species with 16S rrna primers should also be investigated. Identification of additional primers would also be likely to improve the specific detection of C. pneumoniae. We therefore determined the nucleic acid sequence of the 16S rrna of C. pneumoniae and identified sequences which differed from those of C. trachomatis and C. psittaci. We report here the development of a PCR assay which permits the sensitive detection of C. pneumoniae and its specific differentiation from C. trachomatis and C. psittaci. MATERUILS AND METHODS Organisms. C. pneumoniae TW183, AR39, and AR388 were obtained from the Washington Research Foundation, Seattle. C. pneumoniae CWL-029, 2023, and 2043 were from the American Type Culture Collection, Rockville, Md., as VR1310, VR1356, and VR1355, respectively. C. psittaci 6BC was also obtained from the American Type Culture Collection. C. psittaci SM006 was cultured in our laboratory from a patient with psittacosis. C. trachomatis serovars A, B, Ba, C, D, E, F, G, H, I, J, Ll, L2, and L3, in high titer and fixed in formalin, were obtained from the Washington Research Foundation. Other respiratory bacterial strains were obtained from the Clinical Microbiology Laboratory, The Johns Hopkins Hospital, Baltimore, Md. Growth and purification. Chlamydial strains were propagated in HL or McCoy cells as described previously (16). Purification of high-titer preparations of elementary bodies was performed in a density gradient of 30% Percoll in 12% sucrose-phosphate-glutamate buffer (ph 7.4). The preparation was centrifuged for 30 min at 18,800 x g at 4 C. The band of elementary bodies was collected, washed and pelleted twice with 8.4% sucrose-phosphate glutamate buffer (ph 7.4) for 30 min at 18,800 x g at 4 C. Elementary bodies were resuspended in 1-ml aliquots and stored at -70 C. PCR. Percoll-purified elementary bodies or tissue culture isolates (200,ul) were lysed with Tween 20-Nonidet P-40 (final concentration, 0.5% [vol/vol] each) and a final concentration of 100,ug of proteinase K (Sigma Chemical Co., St. Louis, Mo.) per ml. After boiling for 5 min to inactivate the 796

2 VOL. 30, 1992 proteinase K, the specimens were chilled on ice. For DNA preparation, the samples were extracted by phenol-chloroform treatment and precipitated with sodium acetate-ethanol by standard methods (24). PCR was performed on a 50-,ul processed sample in a total volume of 100,l. The final mixture contained 0.5,uM primers, 0.2 mm deoxynucleoside triphosphates, lx PCR buffer (10 mm Tris [ph 8.3], 50 mm KCI, 2.5 mm MgCl2, 0.01% gelatin), and 1.5 U of Taq polymerase (Perkin-Elmer Cetus, Norwalk, Conn.). Samples were subjected to 30 cycles of denaturation (94 C, 1 min), annealing (55 C, 1 min), and extension (72 C, 1 min) in a Perkin-Elmer Cetus thermocycler. PCR products (10,ul) were separated by electrophoresis in 12% polyacrylamide gels (7 by 10 cm) at 120 V for 1 h by using Tris-borate-EDTA buffer (ph 8.3) (24). Nucleic acids were then visualized by staining with either ethidium bromide (0.5 p,g/ml) or silver nitrate (silver stain kit; Bio-Rad, Richmond, Calif.). Sequence analysis. The sequences of the DNA generated by PCR were determined on an automated DNA sequencer (373A; Applied Biosystems, Foster City, Calif.) which separated, detected, and identified fluorescently labeled DNA molecules. Analysis of nucleic acid sequences were performed with the GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.). Primer synthesis. Oligonucleotides were synthesized on a DNA synthesizer (380; Applied Biosystems) by the phosphoramidite method. Primer sets la-lb and 2A-2B were those published by Pollard et al. (22). Clinical specimens. Human throat culture specimens were obtained from 98 patients enrolled in a community-acquired pneumonia study. Samples from a previously reported primate model of experimental infection with C. pneumoniae were also tested (17). These included nostril and nasopharyngeal specimens from two cynomolgus monkeys. Two specimens were obtained from each monkey prior to inoculation with C. pneumoniae; and 12 specimens were obtained at weeks 1, 4, and 18 post-inoculation (p.i.). A reinoculation occurred at week 15 (17). For these clinical specimens, PCR products were detected by PCR-enzyme immunoassay (3). MIF. Sera from PCR-enzyme immunoassay-positive patients were tested by MIF against antigens from C. pneumoniae and three pools of antigens from C. trachomatis (25). RESULTS Reaction of primers la-lb and 2A-2B with C. pneumonwiae. Initial experiments were conducted in order to determine the reactivity of C. pneumoniae with the primers described by Pollard et al. (22) for the detection of C trachomatis and C. psittaci. An approximately 240-bp product was observed following PCR of C. pneumoniae DNA with primer pair la-1b, and an approximately 119-bp product was observed with primer pair 2A-2B (Fig. 1). The reaction of C. pneumoniae with these primers could not be distinguished from that of either C. trachomatis or C. psittaci. In addition, it was noted that C. trachomatis reacted with both of the 16S rrna primer pairs (la-lb and 2A-2B) reported by Pollard et al. (22). Sequence of 16S rrna and synthesis of PCR primers. Additional oligonucleotide primers were synthesized on the basis of published sequences of the 16S rrnas of C. trachomatis and C. psittaci, and these primers were used in PCRs to construct overlapping fragments of the 16S rrna of C. pneumoniae (27). By this means, 1,448 bp (94%) of the C. pneumoniae 16S rrna gene was determined. Comparison with other chlamydial species revealed regions of substantial 240 bp bp - C. PNEUMON1AE IDENTIFICATION bp -118 bp FIG. 1. PCR products generated with Chlamydia spp. and primers la-lb and 2A-2B. Chlamydial DNA was extracted and reacted in a PCR as described in the text. Lanes 1 and 10 contain marker DNAs, with the sizes of some of the markers noted to the right. DNA templates included C. trachomatis (lanes 2 and 3), C. psittaci (lanes 4 and 5), C. pneumoniae (lanes 6 and 7), and negative control (no DNA) (lanes 8 and 9). Primer pair la-lb was used for the reactions applied to lanes 2, 4, 6, and 8. Primer pair 2A-2B was used for the reactions applied to lanes 3, 5, 7, and 9. Size markers for the expected products of la-lb (240 bp) and 2A-2B (119 bp) appear on the left. PCR products were visualized with UV light following staining with ethidium bromide. sequence diversity from which a pair of oligonucleotide primers (CpnA, CpnB) was synthesized (Fig. 2). When used in a PCR with the TW183 strain of C. pneumoniae, these primers resulted in the generation of a product of 463 bp. This PCR product was consistent in size with that predicted from the nucleic acid sequence of the C. pneumoniae 16S rrna (Fig. 3). No product was produced with C trachomatis or C. psittaci. Each of six different C. pneumoniae strains reacted with primers CpnA and CpnB (Fig. 4), but no PCR product was noted with the 15 serovars of C. trachomatis or the two strains of C. psittaci. In contrast, each of these chlamydial isolates generated a 240-bp product when they were reacted with primer pair la-lb as described by Pollard et al. (22). No reactivity was noted in the PCR by using primer pair CpnA-CpnB with any of the cell lines or other bacteria which were evaluated (Table 1). Sensitivity of PCR primers CPN3 and CPN4. The sensitivity of PCR with primer pair CpnA-CpnB was initially assayed with serial dilutions of DNA extracted from elementary bodies of C pneumoniae. In repeated experiments, as few as 0.4 to 40 inclusion-forming units (IFU) of C. pneumoniae DNA could be detected by PCR and visualization by A C. pneumoniae C. psittad C. trachomafs E oli primer CpnA 5 ' TGACCGCGGCAGAAATGTCGT TGACCGCGGCAGAAATGTCGT 1002 GGAAGTTTTCAGAGATGAGAA 1022 B 3' 5, primer CpnB _. nnaummnian 5' ATTTATAGGAGAGAGGCG 3' C.ttrachomatis CTGCAAAGGAGAGAGGCG trahomatis CCGCAAGGGAGAGAGGCG 1449 C-TTCG-GGAGGGCGCTT 1464 FIG. 2. Sequences of C. pneumoniae 16S rrna and C. pneumoniae primers. Sequences of C. pneumoniae were determined as described in the text. These sequences were then aligned with similar regions from C. psittaci, C. trachomatis, and Escherichia coli. The 16S rrna regions are identified by base number from the 5' end of the E. coli 16S rrna, bases 1002 to 1022 (A) and bases 1449 to 1464 (B). Letters in boldface type indicate bases with differences between C. pneumoniae and other Chlamydia spp. Primer CpnB was made the complement of the sequence shown in panel B.

3 798 GAYDOS ET AL. J. CLIN. MICROBIOL. 463 bp TABLE 1. Bacterial strains which gave no PCR product when tested with primers CpnA-CpnB 240 bp bp - 1I8 bp FIG. 3. PCR products generated with Chlamydia spp. and the C. pneumoniae-specific primer pair CpnA and CpnB. Chlamydial DNA was extracted and reacted in a PCR as described in the text. Lanes 1 and 10 contain marker DNAs, with the sizes of some of the markers noted to the right. DNA templates included C. trachomatis (lanes 2 and 3), C. psittaci (lanes 4 and 5), C. pneumoniae (lanes 6 and 7), and negative control (no DNA) (lanes 8 and 9). Primer pair la-lb was used for the reactions applied to lanes 2, 4, 6, and 8. Primer pair CpnA-CpnB were used for the reactions applied to lanes 3, 5, 7, and 9. Size markers for the expected products of la-lb (240 bp) and CpnA-CpnB (463 bp) appear to the left. PCR products were visualized with UV light following staining with ethidium bromide. silver staining of the 463-bp product on polyacrylamide gels (Fig. 5). The sensitivity was approximately 1 log dilution less on ethidium-stained agarose gels. PCR of clinical specimens. Of 98 human throat specimens obtained from patients with community-acquired pneumonia, 5 (5.1%) were positive for C. pneumoniae by PCRenzyme immunoassay with primers CpnA and CpnB. None of these specimens yielded C. pneumoniae by tissue culture in HL cells. Of these five patients, acute-phase sera were available for three patients and convalescent-phase sera were available for two patients. Two acute-phase sera demonstrated titers of 1:128 against C. pneumoniae. One of these gave a titer of 1:32 in the convalescent-phase serum test. Frozen aliquots of respiratory specimens from two cynomolgus monkeys that were experimentally inoculated with C. pneumoniae were also available for testing (17). Specimens were obtained from nostrils and nasopharynxes both before and after inoculation. At the time of the original study, four preinoculation specimens were culture negative. One of four swabs obtained 1 week p.i. grew C. pneumoniae at the time of the original study. Also available for study were eight specimens for weeks 4 and 18 p.i. These specimens grew C. pneumoniae when they were first cultured Strain Staphylococcus aureus Staphylococcus epidermidis Haemophilus influenzae Haemophilus parahaemolyticus Escherichia coli Klebsiella pneumoniae Streptococcus pyogenes Streptococcus agalactiae Branhamella catarrhalis Micrococcus luteus Corynebacterium sp. Enterococcus faecalis Streptococcus bovis Viridans group streptococci Pseudomonas aeruginosa None of these positive cultures ever yielded more than two inclusions. Frozen aliquots of these specimens were reevaluated for growth in tissue culture by using HL cells and also by PCR. All four preinoculation specimens were negative by PCR as well as by culture. Of four specimens obtained 1 week p.i., three were positive by PCR, but none grew upon repeat culture 4 years after the original aliquots were frozen. Of the remaining eight specimens that were originally culture positive, only one grew C. pneumoniae upon repeat culture from frozen aliquots. However, seven of these were positive by PCR. In summary, for p.i., eight of nine specimens that were culture positive originally were PCR positive and two of three specimens that were culture negative were PCR positive. DISCUSSION The differential reactivities of C. trachomatis and C. psittaci were described for PCR by using two primer sets (la-lb and 2A-2B) derived from the 16S rrna sequence of Chlamydia spp. (22). Primer pair 2A-2B was said to react with C. psittaci but not with C. trachomatis. However, we noted that both of these primer sets reacted with C. pneumoniae as well as C. trachomatis and C. psittaci. This discrepancy was not likely to have resulted from differences in PCR conditions, since the PCR used in this study was more stringent than that used in an earlier study (22). Comparison of published sequences of C. trachomatis and C. psittaci and the 16S rrna sequences of C. pneumoniae 463 bp -310 bp bp- I Ibp 0 FIG. 4. PCR products generated with primer pair CpnA-CpnB and different strains of C. pneumoniae. Chlamydial DNA was extracted and reacted in a PCR as described in the text. All reactions contained primer pair CpnA-CpnB. Lanes 1 to 6 contained as templates C. pneumoniae TW183, AR39, AR388, CWL029, 2023, and 2043, respectively. Lane 7 contained the negative control (no DNA). Lane 8 contained marker DNAs, with the sizes of some of the markers noted to the right. Size markers for the expected products of CpnA-CpnB (463 bp) appear to the left. PCR products were visualized with UV light following staining with ethidium bromide. FIG. 5. PCR with serial dilutions of C. pneumoniae and primer pair CpnA-CpnB. Elementary bodies of C. pneumoniae were prepared, and the DNA was extracted from 10-fold serial dilutions of the preparation as described in the text. These dilutions were then reacted in PCRs which used the primer pair CpnA-CpnB. Of each 100-pl reaction, 10,ul was applied to a polyacrylamide gel for electrophoresis. The 463-bp products were visualized by staining with silver nitrate as noted in the text. PCRs contained 40,000 IFU (lane 1), 4,000 IFU (lane 2), 400 IFU (lane 3), 40 IFU (lane 4), 4 IFU (lane 5), and 0.4 IFU (lane 6). Marker DNA is included in lane 7.

4 VOL. 30, 1992 A C. pneurnna c. psittaci C. trachomatis E. coli B C. neumoniae C. trachomats E. coli primer2a 5' 3' 5' GCTTTTCTAATTTATACC 3' GCTTTTCTAATTTACACC GCTTTTCTAATTTATACC 733 GGCCCCCTGGACGAAGAC ' d 5spri 5'ATGTGGATGGTCTCAACCCCAT 3' ATGTGGATAGTCTCAACCCTAT ATGTGGATGGTCTCAACCCCAT 830 GAGGTTGTGCCCTTGA-GGCGT 850 FIG S rrna sequences of Chlamydia spp. in the regions used for primer pair 2A-2B. Sequences were aligned with similar regions from C. pneumoniae, C. psittaci, C. trachomatis, and E. coli. The 16S rrna regions are identified by base number from the 5' end of the E. coli 16S rrna, bases 733 to 750 (A) and bases 830 to 850 (B). Primer 2B was made as the complement of the sequence shown in panel B. revealed that few sequence differences were present among these three species within the regions of primers 2A and 2B (Fig. 6). Importantly, the 3'-terminal bases of these primer sequences were highly conserved. Mismatches in the 3' region are known to affect primer template annealing and PCR extension more than mismatches at other positions are (21). On the basis of these sequences, we conclude that the primer pair 2A-2B permits detection of all three Chlamydia spp. by PCR. In order to develop an assay capable of distinguishing C. pneumoniae from other Chlamydia spp., additional oligonucleotide primers were identified. For this purpose, we sequenced almost the entire length of the 16S rrna gene of C. pneumoniae and identified a set of oligonucleotide primers which specifically recognized only C. pneumoniae. rrna sequences are particularly appropriate for this purpose, because 16S rrna is highly conserved within individual bacterial species (28). This was especially important in the case of C. pneumonae. Antigenic differences have recently been described for C. pneumoniae, but the variations in nucleic acid sequences among C. pneumoniae strains are largely unknown (2). These antigenic strain differences are likely to reflect changes in nucleic acid sequence. For example, strain variations in the major outer membrane protein of C. trachomatis have been correlated with differences at the nucleic acid level (8, 26). Since 16S rrna sequences are highly conserved, PCR primers designed from those sequences are likely to recognize diverse C. pneumoniae strains (27). This, indeed, was documented in the experiments described here, with primer pair CpnA-CpnB capable of detecting each of the six strains of C. pneumoniae which were tested by PCR. Comparison of PCR with tissue culture for the detection of the TW183-strain of C. pneumoniae indicated that the PCR assay is capable of detecting 0.4 to 40 IFU. No increased sensitivity was noted by PCR when primers previously described for the detection of C. trachomatis and C. psittaci were used (22). The numerical range (0.4 to 40) of IFU detected by PCR in different experiments is likely to have resulted from the adhesiveness of the elementary bodies. Serial dilutions of these preparations can be difficult to calculate precisely because of this adhesive property. In addition, the presence of nonviable particles might have varied from experiment to experiment. Alternatively, differences in experimental sensitivity may have resulted from the presence of reticulate bodies in the elementary body preparations. Reticulate body nucleic acids would be detected by C. PNEUMONUE IDENTIFICATION 799 PCR, but these particles are noninfectious and would not result in the formation of an inclusion in tissue culture titers. The sensitivity of the PCR described here was compared with the sensitivity of culture of Chlamydia strains which were well adapted to growth in vitro. However, C. pneumoniae is often difficult to culture directly from clinical specimens. PCR may therefore offer even greater sensitivity relative to tissue culture if it used for strains which do not grow well in vitro. PCR also resulted in the detection of C. pneumoniae in throat specimens from patients in a community-acquired pneumonia study. However, interpretation of these culturenegative, PCR-positive results was difficult since PCR was more sensitive than the routine culture method. Two of the five PCR-positive specimens were obtained from individuals whose sera had high-titer immunoglobulin G directed against C. pneumoniae, as detected by MIF. Examination of the frozen specimens from experimentally infected monkeys also offered an opportunity to compare detection of C. pneumoniae by PCR and culture. Of the nine previously culture-positive unfrozen specimens, the quantity of viable organisms was very small, because none of the cultures grew more than two inclusions initially, and some were only culture positive after a blind passage. Since only 1 of 12 specimens was positive upon repeat culture from frozen aliquots, this may have indicated that PCR offers increased utility for examination of such specimens. In addition, two specimens obtained 1 week p.i. were negative upon original and repeat culture but were positive by PCR. This finding demonstrates the ability of PCR to detect the presence of organisms at a time early during infection when specimens are not yet positive by culture. While PCR offers the possibility for improved detection of C. pneumoniae in clinical specimens, the test has two disadvantages: cost and the need for strict quality control. However, direct culture of C. pneumoniae from clinical specimens is also a relatively expensive process, and the cost of PCR reagents is likely to decrease in coming years. Strict quality control of all reactions is needed in order to prevent false-positive reactions, and this remains a hindrance to the routine use of PCR for clinical diagnosis. Techniques for the avoidance of false-positive PCR results have been well described, and their use greatly improves the performance of the assay. Despite these disadvantages, PCR appears to offer a highly specific method for confirming the identification of C. pneumoniae. Further investigations will evaluate the use of the PCR primers described here for the direct detection of chlamydiae in additional clinical specimens from patients with documented rises in antibody titers detected against C. pneumoniae. REFERENCES 1. Berdal, B. P., P. I. Fields, S. H. Mitchell, and G. Hoddevilk Isolation of Chlamydia pneumoniae during an adenovirus outbreak, p In W. R. Bowie et al. (ed.), Chlamydial infections. Proceedings of the 7th International Symposium on Human Chlamydial Infections. Cambridge University Press, Cambridge. 2. Black, C. M., J. E. Johnson, C. E. Farshy, T. M. Brown, and B. P. Berdal Antigenic variation among strains of Chlamydia pneumoniae. J. Clin. Microbiol. 29: Bobo, L., F. Coutlee, R. H. Yolken, T. Quinn, and R. P. Viscidi Diagnosis of Chlamydia trachomatis cervical infection by detection of amplified DNA with an enzyme immunoassay. J. Clin. Microbiol. 28: Campbell, J. F., R. C. Barnes, P. E. Kozarsky, and J. S. Spika Culture-confirmed pneumonia due to Chlamydiapneumoniae. J. Infect. Dis. 164:

5 800 GAYDOS ET AL. 5. Campbell, L. A., C. C. Kuo, and J. T. Grayston Characterization of the new Chlamydia agent, TWAR, as a unique organism by restriction endonuclease analysis and DNA-DNA hybridization. J. Clin. Microbiol. 25: Chirgwin, K., P. M. Roblin, M. Gelling, M. R. Hammerschlag, and J. Schachter Infection with Chlamydia pneumoniae in Brooklyn. J. Infect. Dis. 163: Claash, C. J., J. H. T. Wagenvoort, H. G. M. Niesters, T. T. Tio, J. H. Van Rijsoort-Vos, and W. G. V. Quint Diagnostic value of the polymerase chain reaction for Chlamydia detection as determined in a follow-up study. J. Clin. Microbiol. 29: Dean, D., M. Patton, and R. S. Stephens Direct sequence evaluation of the major outer membrane protein gene variant regions of Chlamydia trachomatis subtypes D', I', and L2. Infect. Immun. 59: Dulith, B., C. Bebear, P. Rodriguez, A. Vekris, J. Bonnet, and M. Garret Specific amplification of a DNA sequence common to all Chlamydia trachomatis serovars using the polymerase chain reaction. Res. Microbiol. 140: Grayston, J. T., L. A. Campbell, C. C. Kuo, C. H. Mordhurst, P. Saikku, D. H. Thom, and S. P. Wang A new respiratory tract pathogen: Chlamydia pneumoniae, strain TWAR. J. Infect. Dis. 161: Grayston, J. T., V. K. Diwan, M. Cooney, and S. P. Wang Community and hospital acquired pneumonia associated with Chlamydia TWAR infection demonstrated serologically. Arch. Intern. Med. 149: Grayston, J. T., C. C. Kuo, L. A. Campbell, and S. P. Wang Chlamydia pneumoniae sp. nov. for Chlamydia sp. strain TWAR. Int. J. Syst. Bacteriol. 39: Grayston, J. T., C. C. Kuo, S. P. Wang, and J. Altman A new Chlamydia psittaci strain, TWAR, isolated from acute respiratory tract infections. N. Engl. J. Med. 315: Grayston, J. T., C. C. Kuo, S. P. Wang, M K. Cooney, J. Altman, T. J. Marrie, J. G. Marshall, and C H. Mordhorst Clinical findings in TWAR respiratory tract infections, p In J. D. Oriel et al. (ed.), Chlamydial infections. Cambridge University Press, Cambridge. 15. Hahn, D. L., R. W. Dodge, and R. Golubjatnikou Association of Chlamydia pneumoniae (strain TWAR) infection with wheezing, asthmatic bronchitis, and adult-on' et asthma. JAMA 266: J. CLIN. MICROBIOL. 16. Holland, S. M., C. A. Gaydos, and T. C. Quinn Detection and differentiation of Chlamydia trachomatis, C. psittaci, and C. pneumoniae by DNA amplification. J. Infect. Dis. 162: Holland, S. M., H. R. Taylor, C. A. Gaydos, E. W. Kappus, and T. C. Quinn Experimental infection with Chlamydia pneumoniae in nonhuman primates. Infect. Immun. 58: Kleemola, M., P. Saikku, R. Visakorpi, S. P. Wang, and J. T. Grayston Epidemics of pneumonia caused by TWAR, a new chlamydia organism, in military trainees in Finland. J. Infect. Dis. 157: Marrie, T. J., J. T. Grayston, S. P. Wang, and C. C. Kuo Pneumonia associated with the TWAR strain of Chlamydia. Ann. Intern. Med. 106: Miller, S. T., M. R. Hammerschlag, K. Chirgwin, S. P. Rao, P. Roblin, M. Gelling, T. Stilerman, J. Schachter, and G. Cassell Role of Chlamydia pneumoniae in acute chest syndrome of sickle cell disease. J. Pediatr. 118: Petruska, J., M. F. Goodman, M. S. Boosalis, L. C. Sewers, C. Cheong, and I. Tinoco Comparison between DNA melting thermodynamics and DNA polymerase fidelity. Proc. Natl. Acad. Sci. USA 85: Pollard, D. R., S. D. Tyler, C. W. Ng, and K. R. Rozee A polymerase chain reaction (PCR) protocol for the specific detection of Chlamydia sp. Mol. Cell. Probes 3: Saikku, P., S. P. Wang, M. Kleemola, E. Brander, E. Rusanen, and J. T. Grayston An epidemic of mild pneumonia due to an unusual strain to Chlamydia psittaci. J. Infect. Dis. 151: Sambrook, J., E. F. Fritsch, and T. Maniatis Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 25. Wang, S. P., C. C. Kuo, and J. T. Grayston Formalinized Chlamydia trachomatis organisms as antigens in the microimmunofluorescence test. J. Clin. Microbiol. 10: Wang, S. P., and J. T. Grayston Three new serovars of Chlamydia trachomatis: Da, Ia, and L2a. J. Infect. Dis. 163: Weisburg, W. G., T. P. Hatch, and C. R. Woese Eubacterial origin of chlamydiae. J. Bacteriol. 167: Woese, C. R Bacterial evolution. Microbiol. Rev. 51: