Detection of Chlamydia pneumoniae by Polymerase Chain Reaction

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 1992, p /92/ $02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 30, No. 2 Detection of Chlamydia pneumoniae by Polymerase Chain Reaction LEE ANN CAMPBELL,* MERCEDES PEREZ MELGOSA, DAVID J. HAMILTON, CHO-CHOU KUO, AND J. THOMAS GRAYSTON Department of Pathobiology, University of Washington, Seattle, Washington Received 10 September 1991/Accepted 13 November 1991 While criteria for serodiagnosis of Chlamydia pneumoniae infection are well established, isolation of the organism is often difficult. To increase detection of this organism, C. pneumoniae-specific sequences were identified to permit amplification of C. pneumoniae by polymerase chain reaction (PCR). A cloned C. pneumoniae 474-bp PstI fragment was shown by dot blot and Southern hybridization to differentiate C. pneumoniae from the other Chlamydia spp., react with all C. pneumoniae isolates tested, and not recognize DNA from normal throat flora or common respiratory tract agents. This cloned fragment was sequenced and primers for use in PCR were chosen on the bases of GenBank analysis, G+C ratio, and absence of secondary structure. All C. pneumoniae isolates tested were amplified by the HL-1-HR-1 primer pair or the HM-1-HR-1 primer pair, producing the expected 437- and 229-bp amplification products, respectively. None of the Chlamydia trachomatis serovars (B/TW-5/OT, C/TW-3/OT, D/UW-3/Cx, E/UW-5/Cx, F/UW-6/Cx, H/UW-41 Cx, I/UW-12/Ur, and L2/434/Bu), Chlamydia psittaci strains (Mn, 6BC, GPIC, FP, and OA), HeLa cells, or other organisms tested were amplified. Reaction conditions including MgCl2, oligonucleotides, and primer concentrations and temperature were optimized before application to clinical samples. Clinical specimens from patients from whom C. pneumoniae was isolated were also positive by PCR, while samples from patients with known C. trachomatis or C. psittaci infection were not amplified by PCR. Chlamydia pneumoniae is a major cause of acute respiratory tract disease in humans and has been responsible for both endemic and epidemic pneumonia (5). In addition, this organism has been associated with other clinical manifestations, including coronary artery disease, asthma, and sarcoidosis (7, 8, 16, 18). The finding that 50 to 60% of adults in the diverse geographical places studied have serological evidence of C. pneumoniae infection makes this one of the most prevalent infectious agents (5, 19). Two serodiagnostic tests have been used routinely for C. pneumoniae, the microimmunofluorescence test and the complement fixation test (5, 19). The microimmunofluorescence test is specific for C. pneumoniae; the complement fixation test measures cross-reactive antibodies against the genus Chiamydia. Because C. pneumoniae immunoglobulin G (IgG) antibody persists for long time periods and, in reinfection, IgM or complement fixation antibody is often absent, differentiation of reinfection from previous infections is difficult (5). The difficulty in isolating and/or demonstrating the presence of the organisms has made epidemiological studies of transmission, host range, tissue tropism, and association of the organism with specific clinical manifestations more difficult. The development of the polymerase chain reaction (PCR) has provided -an alternative diagnostic method for etiological agents that are difficult to culture or detect (15). This method has been used successfully for the detection of Chlamydia trachomatis DNA in clinical samples (3, 9, 14). By using primers that recognized conserved sequences on Chlamydia major outer membrane protein genes or the 60-kDa cysteinerich protein, PCR has been used for differentiation of Chlamydia spp. (9, 20). In this article, we report the DNA amplification of C. pneumoniae-specific sequences by PCR for direct detection of C. pneumoniae. * Corresponding author. 434 MATERIALS AND METHODS Isolates. C. pneumoniae isolates used in this study included the following: TW-183 (the prototype strain isolated in 1965 in Taiwan); AR-39, AR-277, AR-388, AR-458, and LR-65 (isolated in Seattle, Washington); KA-5C (isolated by P. Saikku in Finland); AC-43 (isolated by T. Yamazaki in Japan); 2023 (isolated by M. Hammerschlag in New York, N.Y.); and CWL-29 and CWL-50 (isolated by the Centers for Disease Control, Atlanta, Ga.). All C. pneumoniae isolates except TW-183 were from the respiratory tract. TW-183 was obtained from the conjunctiva of a child. The C. trachomatis serovars used included B/TW-5/OT, C/TW-3/ OT, D/UW-3/Cx, E/UW-5/Cx, F/UW-6/Cx, H/UW-4/Cx, I/UW-12/Ur, and L2/434/Bu. The Chlamydia psittaci strains included guinea pig inclusion conjunctivitis (GPIC), feline pneumonitis (FP), meningopneumonitis (Mn), ovine abortion (OA), and 6BC. 6BC is an avian psittacosis strain. The other strains were of mammalian origin. All chlamydial strains were previously described (2). Other bacteria used in this study were clinical isolates obtained from the Washington State Health Lab, Fred Hutchinson Cancer Research Center, Seattle, or kindly provided by Gertrud Schmidt of the University of Washington, Seattle. Purified DNA isolated from Neisseria spp., Mycobacterium spp., a Ureaplasma sp., and a Mycoplasma sp. were kindly provided by Marilyn Roberts, University of Washington, Seattle. These bacteria are listed in Table 1. Growth and purification of organism. All chlamydial strains listed above were adapted to grow in a HeLa-229 cell culture (12). Subsequently, C. pneumoniae isolates were grown in HL cells as previously described (11). Chlamydial organisms were purified with a linear gradient of meglumine diatrizoate (Hypaque-76; Winthrop-Breon Laboratories, New York, N.Y.) (10). The titers (measured in inclusionforming units [IFUs]) of the purified organism preparations were determined by the method of Furness et al. (4).

2 VOL. 30, 1992 PCR DETECTION OF CHLAMYDIA PNEUMONIAE 435 Organism and strain or serovar Acinetobacter calcoaceticus var. anitratus Acinetobacter calcoaceticus var. lwoffi Bacteroides fragilis Bacteroides oralis Campylobacter fetus subsp. jejuni Candida albicans Candida tropicalis Chlamydia psittaci FP GPIC Mn OA 6BC Chiamydia trachomatis B/TW-5/OT C/TW-3/OT D/UW-3/Cx E/UW-5/Cx F/UW-6/Cx H/UW-4/Cx I/UW-12/Ur L2/434/Bu Enterococcus faecalis ATCC Escherichia coli ATCC Fusobacterium nucleatum TABLE 1. Clinical samples. The clinical samples used were from past and current studies of acute respiratory tract infection with C. pneumoniae (6) and sexually transmitted diseases due to C. trachomatis (1). The throat and urethral swabs were eluted in 1 ml of chlamydia transport medium containing sucrose and glutamic acid in potassium phosphate buffer. Lung tissue from which C. psittaci was isolated came from an adult male who died of pneumonia; the tissue was sent to us for diagnosis by H. Dowda, South Carolina Department of Health and Environmental Control, Columbia. For all clinical specimens, serodiagnosis of C. pneumoniae was done by using the microimmunofluorescence test (19). For C. pneumoniae, patients were diagnosed as seropositive for current infection if a fourfold antibody titer rise in sequential serum samples or, in a single serum sample, an IgM titer greater than 1:16 or an IgG titer greater than 1:512 was observed (5). An IgG titer of.1:16 and <1:512 indicates past infection (5). IgG and IgM titers of.1:8 are considered nondiagnostic. Dot blot analysis. To test reactivity of the 474-bp restriction fragment with purified chromosomal DNA, 0.1 to 1,ug of DNA was added per well. For analysis of PCR products with the C. pneumoniae 474-bp fragment as the probe, 10 to 30 RI of the reaction product was added per well. Samples were boiled for 10 min in 0.3 M NaCl, and 2.0 M ammonium acetate was added to a final volume of 400,ul. Samples were applied either to nitrocellulose (Trans-Blot; Bio-Rad Laboratories, Richmond, Calif.) or to nylon (Zeta-Bind, for analysis of PCR products; Bio-Rad) with a Bio-Dot microfiltration apparatus (Bio-Rad) according to the directions of the manufacturer. Filters were baked at 80 C for 2 h prior to hybridization. Hybridizations. Probe DNA was labeled by using the multi-prime labeling kit (Amersham, Arlington Heights, Ill.) according to the directions of the manufacturer. Generally, 3 x 106 cpm was added per hybridization. The hybridization reaction buffer included 50% formamide, 5 x Denhardt's 11 Organisms tested Organism and strain Haemophilus influenzae ATCC Klebsiella pneumoniae ATCC Legionella pneumophila Legionella micdadei Micrococcus luteus Moraxella catarrhalis Mycobacterium bovis Mycobacterium intracellulare Mycoplasma hominus Neisseria gonorrhoeae Neisseria meningitidis Neisseria perflava Proteus mirabilis Proteus vulgaris ATCC Pseudomonas aeruginosa Salmonella typhimurium ATCC Staphylococcus aureus ATCC and Staphylococcus epidermidis Staphylococcus agalactiae Streptococcus pneumoniae Streptococcus pyogenes Ureaplasma sp. Veillonella parvula Yersinia enterocolitica ATCC reagent, 5x SSPE (1x SSPE is 180 mm NaCl, 10 mm NaH2PO4, and 1 mm EDTA [ph 7.4]), 10,ug of salmon sperm DNA per ml, and 0.1% sodium dodecyl sulfate. After hybridization for 18 h at 42 C, three washes were done in 0.lx SSC (lx SSC is 0.15 M NaCl plus M sodium citrate) and 0.1% sodium dodecyl sulfate for 15 min each at 52 C followed by three washes with 0.1x SSC. DNA sequence analysis. The Sanger dideoxy-chain termination method of DNA sequencing (17) was carried out on single-stranded fragments cloned into M13mpl8 by using a Sequenase kit (United States Biochemical Corp., Cleveland, Ohio). Nested deletions were generated by using the Erasea-Base kit (Promega, Madison, Wis.). Sequence analyses were performed by the Pustell sequence analysis program (IBI) and the University of Wisconsin Genetics Computer Group programs. PCR. The nucleotide sequences of the different primers (from the 5' to 3' end) are as follows: HL-1, GTTGTTCA TGAAGGCCTACT; HM-1, GTGTCATTCGCCAAGGTT AA; and HR-1, TGCATAACCTACGGTGTGTT. Samples were amplified for 40 cycles. Each cycle consisted of the following: denaturation at 94 C for 1 min, annealing (temperature varied depending on the primer set [see Results]) for 1 min, and primer extension at 72 C for 1 min. The buffers and reagents used were those supplied in the GeneAmp kit (Perkin-Elmer Cetus, Norwalk, Conn.). Amplification products were analyzed by electrophoresis through a 1.5% agarose gel by standard methods (13). For optimization of the PCR conditions, the optimal annealing temperature and concentrations of the different PCR components were chosen as those giving the greatest yield of amplification product without any nonspecific amplification. For screening, two different organism concentrations were used, 1 x 102 to 5 x 102 IFUs and 1 to 5 IFUs. Conditions resulting in the best amplification of 1 to 5 IFUs were determined to be optimal. These parameters were subsequently retested on the other Chlamydia spp. and

3 436 CAMPBELL ET AL. J. CLIN. MICROBIOL. HL-1 1cCATTA1TCAccGTcGTACAGCAGAMTcGTGTTCATGAAGGcCTACTCTrTGATCAAGAGCAA6TAAAcGGATAGAAAGTTCTTCTAAATCACTGAGA 101 GTTGAAAGGACTCTATCAGATTAAGAAA CCTAGAAATCAATTAT MGACTGAAGTT GAAATGGATTAGCATTACATACTTTCACAATTcGAATGATAGCTCTT1TGcTATAG1TGcATCTTArTUCTGACTTCAA HM TAAGAGAAAACTTCAAGTTGGAGATAAA CTCGTATAAGCACTCCCTCTACGTCTAAATCTAGTACCACAGTAAGCGG TcCAATCAGATGCACGGAGATTCTTIGAAGTTCAACCTCTATTT 301 ATCGTTcCAAA GA3GATATGcCATATCTCTCTAACGGAGAAACTGTACAAATGATCTG 401 AACCCCXOCTCGGTGCC& GAACTGACAGGTATTAGAMCACACCGTAGGTTATGCAGCAAAAC HR-1 FIG. 1. DNA sequence of the C. pneumoniae-specific 474-bp PstI restriction fragment. Primers are illustrated by dashed lines, with arrows indicating direction of polymerization. selected respiratory tract organisms to ensure that the conditions did not result in any nonspecific amplification. Sample preparation, PCR amplification, and analysis of amplification products were performed in separate rooms. The room in which samples were prepared consisted of three individual cubicles with sliding doors and germicidal UV bulbs. The cubicle within this room that was used for sample preparation for PCR was used for this purpose only. Clinical specimens were stored in a different room in which no aspect of sample preparation or analysis was done. Clinical specimens and frozen cultures of C. pneumoniae were stored in separate boxes. All specimens tested were stored and treated in the same manner. Sample preparation. Chlamydial organisms in the purified preparations or clinical samples (0.05 to 0.3 ml) were pelleted by centrifugation (15,000 x g, 30 min) and incubated in proteinase K (100 [ug/ml)-0.5% Tween % Nonidet P-40 at 60 C for 60 min. Subsequently, the samples were boiled for 10 min. Alternatively, DNA was isolated as previously described (2). For testing the specificity of the C. pneumoniae-derived primers, bacterial suspensions were standardized to 1 McFarland unit and 103 to 105organisms was added per reaction mixture. GenBank analysis, G+C ratio, and absence of secondary structure. The primers and their location on the 474-bp C. pneumoniae PstI fragment are shown in Fig. 1. The expected amplification products of the HL-1-HR-1 primer pair and the HM-1-HR-1 primer pair are 437 and 229 bp, respectively. Specificity of primers for C. pneumoniae. Purified DNA from several isolates of C. pneumoniae (TW-183, AR-39, AR-388, LR-65, KA-5C, AC-43, 2023, CWL-29, and CWL- 50), C. trachomatis (serovars B/TW-5/OT, C/TW-3/OT, D/UW-3/Cx, E/UW-5/Cx, F/UW-6/Cx, H/UW-4/Cx, I/UW- 12/Ur, and L2/434/Bu), and C. psittaci (GPIC, 6BC, Mn, OA, and FP) were tested for their ability to be amplified by the HL-1-HR-1 or HM-1-HR-1 primer sets. All of the C. pneumoniae isolates were amplified with both primer sets, with the resulting amplification products of 437 bp (HL-1- HR-1) and 229 bp (HM-1-HR-1) (Fig. 2). None of the C. trachomatis or C. psittaci strains tested were amplified by either primer pair. RESULTS Selection of C. pneumoniae-specific fragments for amplification. In previous studies, several clones were isolated from a C. pneumoniae genomic library that were specific for C. pneumoniae and could be used for its differentiation from the other Chlamydia spp. (2). One of these clones, a 474-bp PstI fragment, was further tested by dot blot hybridization for recognition of DNA from normal throat flora or common respiratory tract agents including Neisseria spp., Mycobacterium spp., a Mycoplasma sp., a Haemophilus sp., Streptococcus spp., and Bacteroides spp. None of the samples hybridized to the C. pneumoniae DNA probe. Subsequently, the 474-bp C. pneumoniae PstI fragment was sequenced in both orientations and primers were chosen on the bases of :M FIG. 2. Amplification of C. pneumoniae DNA. (A) HL-1-HR-1 primer pair; (B) HM-1-HR-1 primer pair. Lanes: C. pneumoniae isolates KA-5C (lane 1), CWL-29 (lane 2), CWL-50 (lane 3), AC-43 (lane 4), AR-458 (lane 5), AR-277 (lane 6), LR-65 (lane 7), AR-39 (lane 8), and AR-388 (lane 9); C. trachomatis serovar L2/434/Bu (lane 10); C. psittaci GPIC (lane 11); HeLa cells (lane 12). Arrows indicate the amplification products.

4 VOL. 30, 1992 To ensure that the amplified products of the expected size represented the target sequence, the products were digested with restriction enzymes known to cut within the target sequence. The 229- and 437-bp amplification products were digested with AccI and DdeI (data not shown). Cleavage of the HL-1-HR-1 amplification product with AccI yielded the expected 207- and 230-bp fragments. Digestion with DdeI produced the expected 195- and 242-bp fragments. For the HM-1-HL-1 amplification product, cleavage with AccI resulted in 22- and 207-bp fragments; digestion with DdeI yielded 34- and 195-bp fragments. Both amplification products were recognized in dot blot hybridization when the radiolabeled C. pneumoniae 474-bp fragment was used as the probe (data not shown). The ability of the C. pneumoniae-derived primers to amplify normal flora and pathogens found in the respiratory tract was tested. None of the bacteria listed in Table 1 was amplified by either primer pair. Optimization of reaction conditions. Several parameters were varied for each primer set to obtain optimal reaction conditions. Annealing temperatures of 37, 42, 48, 55, and 60 C were tested. The following MgCl2, primer, and oligonucleotide concentrations were analyzed in all possible combinations: MgCI2, 1 to 10 mm; primers, 0.2, 0.5, 1.0, and 2.0,uM; and, oligonucleotides, 20, 50, 100, and 200 R,M. The parameters that resulted in maximum amplification for each primer set were as follows: for HL-1-HR-1, 55 C, 1 U of Taq polymerase, 5 mm MgCl2, 50,M deoxynucleoside triphosphates (dntps), and 0.5,uM primer; for HM-1-HR-1, 48 C, 1 U of Taq polymerase, 3 mm MgCl2 200,uM dntps, and 0.5,uM primer. By using the parameters determined for each primer set, chlamydial organisms for which the number of IFUs per milliliter had been determined were tested in various dilutions to determine detection limits of amplification products. As shown in Fig. 3, the HM-1-HR-1 primer pair detected fewer IFUs than the HL-1-HR-1 primer pair. Both primer sets detected less than 1 IFU. Detection of C. pneumoniae in clinical specimens. Throat specimens were tested from patients that were seropositive and isolation positive (one to nine inclusions were observed per cell monolayer on a 12-mm-diameter coverslip) for C. pneumoniae (n = 8), seropositive and isolation negative for C. pneumoniae (n = 8), and seronegative and isolation negative for C. pneumoniae (n = 20). In addition, urethral or cervical samples from patients with proven C. trachomatis infection and a lung specimen from a patient from whom C. psittaci was isolated were also tested. In initial experiments shown in Fig. 4, throat specimens from patients from whom C. pneumoniae was isolated (isolates AR-1130, AR-1140, and AR-1150) and a seropositive patient from whom the organism (AR-1128) was not isolated were amplified by PCR by using the C. pneumoniae-specific primers. In contrast, no amplification product was observed in the seronegative and isolation-negative specimens (AR-1129 and AR-1141) or in specimens from patients with known C. trachomatis infections or from a patient with a C. psittaci infection. Of those tested, 8 of 8 seropositive and isolation-positive samples were positive by PCR, 4 of 8 seropositive and isolationnegative samples were PCR positive, and none of the 20 seronegative samples were amplified by C. pneumoniae primers. All of the PCR-positive specimens were amplified by both primer pairs. None of the four specimens from C. trachomatis or C. psittaci patients were amplified by these primers. All PCR-positive specimens yielded products that were detected by agarose gel electrophoresis and were PCR DETECTION OF CHLAMYDIA PNEUMONIAE 437 FIG. 3 Detection limits of amplified C. pneumoniae organisms by PCR and gel electrophoresis. Tenfold dilutions of purified organisms of strain AR-39 were amplified by using the parameters described in the text for the corresponding primer set. (A) HM-1- HR-1 primer set; (B) HL-1-HR-1 primer set. Lanes: 1, 5 x 103 ; 2, 5 X 102 ; 3, 5 x 101; 4, 5 x 100; 5, 5 x 10-1; 6, 5 x 10-2; 7, 5 x 10' (all in IFUs). confirmed by dot blot hybridization. All PCR-negative reactions were also negative by dot blot. DISCUSSION Primers complementary to sequences on a C. pneumoniae 474-bp Pstl fragment were identified for use in PCR for detection of C. pneumoniae. By using the optimal reaction conditions determined for each primer pair, specific amplification of C. pneumoniae was achieved. All C. pneumoniae isolates tested from different geographical locations were amplified by PCR; however, C. trachomatis, C. psittaci, and other organisms tested were not amplified by either primer pair. Thus, these results suggest that this method should provide an alternative method to immunofluorescence (6) or enzyme-linked immunosorbent assay (none yet available) for direct detection of this organism in clinical specimens. Several factors have contributed to the difficulty in diagnosing C. pneumoniae infection by isolation or direct detection methods. First, because the anatomical site of colonization has not been defined, the best source of specimens for routine culturing is not known. While many isolations have been made from throat swab specimens in our laboratory, the lower frequency of diagnosis of acute infection by isolation in comparison to that by serodiagnosis may indicate a suboptimal sample site. Second, most isolation-positive clinical specimens contain a small number of IFUs per

5 438 CAMPBELL ET AL. FIG. 4. Amplification of C. pneumoniae DNA from clinical specimens. Samples were concentrated by centrifugation and amplified by using the HL-1-HR-1 primer set. Lanes: 1 and 10, molecular weight markers; 2, specimen seropositive and isolation negative for C. pneumoniae AR-1128; 3 to 5, specimens seropositive and isolation positive for C. pneumoniae AR-1130 (lane 3), AR-1140 (lane 4), and AR-1150 (lane 5); 6, specimen isolation positive for C. trachomatis isolates R03 and D/UW-334/Ur; 7, specimen isolation positive for C. psittaci (psittacine isolate Ps-2); 8 and 9, specimens seronegative and isolation negative for C. pneumoniae AR-1129 and AR-1141, respectively. specimen. In our studies, of 38 samples in which the organism was isolated from throat swab specimens, 87% contained only 1 to 100 IFUs per swab specimen. On the basis of detection limits of PCR determined by amplification of purified chlamydial preparations, PCR could detect less than 1 IFU and, therefore, would be expected to be as sensitive, if not more so, than culture. Preliminary studies using available specimens suggested that this is true since C. pneumoniae was detected by PCR in all clinical specimens from the isolation-positive patients tested and in four of eight samples from patients that had C. pneumoniae infection on the basis of serodiagnosis but from whom the organism was not isolated. Lastly, PCR should increase detection in patients who have begun antibiotic therapy before diagnosis or who have developed high-titer IgG antibody by the time specimens are obtained. While antibiotic treatment and the presence of antibody diminish the chances of C. pneumoniae isolation, detection by PCR is not affected by the viability of organisms. In the studies reported in this article, the appropriate concentration of clinical specimen to use for amplification differed among the specimens. In most cases, amplification could be achieved by concentrating 50 to 300,ul of sample and resuspending it in lysis buffer. However, in some cases, concentration resulted in inhibition of the PCR, presumably because of inhibitors of the Taq polymerase that were present in the clinical samples. In these cases, dilution of the sample specimens or DNA purification circumvented the inhibition. Further studies are needed to define the best method for preparation of clinical specimens, and a larger J. CLIN. MICROBIOL. number of specimens should be tested to determine sensitivity and specificity. However, the results suggest that the C. pneumoniae-specific primers should prove valuable for diagnosis and application to epidemiological studies. ACKNOWLEDGMENTS This study was supported by Public Health Service grant Al We thank Quiyu Ding for technical assistance. REFERENCES 1. Brunham, R. C., C.-C. Kuo, C. E. Stevens, and K. K. Holmes Therapy of cervical chlamydial infection. Ann. Intern. Med. 97: Campbell, L. A., C.-C. Kuo, and J. T. Grayston Characterization of the new Chlamydia agent, TWAR, as a unique organism by restriction endonuclease analysis and DNA-DNA hybridization. J. Clin. Microbiol. 25: Claas, H. C., W. J. Melchers, H. De BruiJn, M. De Graaf, W. C. van Dijk, J. Lindeman, and W. G. Quint Detection of Chlamydia trachomatis in clinical specimens by the polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 9: Furness, G., D. M. Graham, and P. Reeve The titration of trachoma and inclusion blenorrhoea viruses in cell culture. J. Gen. Microbiol. 23: Grayston, J. T., L. A. Campbell, C.-C. Kuo, C. Mordhorst, P. Saikku, D. Thom, and S.-P. Wang A new respiratory tract pathogen: Chiamydia pneumoniae, strain TWAR. J. Infect. Dis. 161: Grayston, J. T., C.-C. Kuo, S.-P. Wang, and J. Altman A new Chiamydia psittaci strain, TWAR, isolated in acute respiratory tract infections. N. Engl. J. Med. 315: Gronhagen-Riska, C., P. Saikku, H. Riska, B. Froseth, and J. T. Grayston Antibodies to TWAR, a novel type of Chlamydia in sarcoidosis, p In C. Grassi, G. Rizzato, and E. Pozzi (ed.), Sarcoidosis and other granulomatous disorders. Excerpta-Medica, New York. 8. Hahn, D. L., R. W. Dodge, and R. Golubjatnikov Association of Chlamydia pneumoniae (strain TWAR) infection with wheezing, asthmatic bronchitis, and adult-onset asthma. JAMA 266: Holland, S. M., C. A. Gaydos, and T. C. Quinn Detection and differentiation of Chlamydia trachomatis, Chlamydia psittaci, and Chlamydia pneumoniae by DNA amplification. J. Infect. Dis. 162: Howard, L., N. S. Orenstein, and N. W. King Purification on Renografin density gradients of Chlamydia trachomatis grown in the yolk sac of eggs. Appl. Microbiol. 27: Kuo, C.-C., and J. T. Grayston A sensitive cell line, HL cells, for isolation and propagation of Chlamydia pneumoniae, strain TWAR. J. Infect. Dis. 162: Kuo, C.-C., S.-P. Wang, and J. T. Grayston Growth of trachoma organism in HeLa 229 cell culture, p In D. Hobson and K. K. Holmes (ed.), Nongonococcal urethritis and related infections. American Society for Microbiology, Washington, D.C. 13. Maniatis, T., E. F. Fritsch, and J. Sambrook Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 14. Ostergaard, L., S. Birkelund, and G. Christiansen Use of polymerase chain reaction for detection of Chlamydia trachomatis. J. Clin. Microbiol. 28: Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim Enzymatic amplification of B-globin genomic sequences and restriction site analysis for the diagnosis of sickle-cell anemia. Science 230: Saikku, P., K. Mattila, and M. S. Nieminen Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction. Lancet ii: Sanger, F., S. Nicklen, and A. R. Coulson DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.

6 VOL. 30, 1992 USA 74: Thom, D. H., S.-P. Wang, J. T. Grayston, D. S. Siscovick, D. K. Stewart, R. A. Kronmal, and N. S. Weiss Chlamydia pneumoniae strain TWAR antibody and angiographically demonstrated coronary artery disease. Arteriosclerosis Thrombosis 11: Wang, S.-P., and J. T. Grayston Microimmunofluorescence serological studies with the TWAR organism, p PCR DETECTION OF CHLAMYDIA PNEUMONIAE 439 In J. D. Oriel, G. Ridgway, J. Schachter, D. Taylor-Robinson, and M. Ward (ed.), Chlamydial infections. Proceedings of the Sixth International Symposium on Human Chlamydial Infections. Cambridge University Press, Cambridge, England. 20. Watson, M. W., P. R. Lambden, and I. N. Clarke Genetic diversity and identification of human infection by amplification of the chlamydial 60-kilodalton cysteine-rich outer membrane protein gene. J. Clin. Microbiol. 29: