Genomics, what will be the impact in Medicine?

Transcription

1

2 Genomics, what will be the impact in Medicine? Guy A. Rouleau, MD PhD FRCP OQ Director, Montreal Neurological Institute and Hospital McGill University

3 Outline Background Examples Now Soon In a while Mainly in Dx but Dx is critically important, and some Dx can be transformative for care

4 All diseases are the result of the interaction between genes and the environment Spectrum: genetic and environmental contribution Complex diseases eg: schizophrenia, autisme, diabetes, etc. ex: accident ex: DMD 100% environnement 100% genetics

5 The genetic effect depends on two factors: penetrance and allelic frequency

6 Genetic Variability nucléotides AATTAGCCAGGCGTCGTGACATGTGCCTGTAGTCTTAGCTATCTTGGAGGCTGAGGTAGGTGGAATA CTTGAAACTGGAGGTGGA(C)GGCTGTAGTGAGCTGTGACATCACTGCACTCCAGCCTGAGCAACA GAGCAAGAGCCTGTCTCAAAACAAAAACAAAAACAAAAAAGAAAATGCAAGTTAAGTTATTTTCATTT TAGGGAAAAGTGAAGATATACGTCTATTTTTATGGACATGGATATTTACAACATTTTGTTGAGGAAAG GTAGCAAGTTACAAAAGTACATATATGATCTCATTCATCTAAAACAATATGTGGGCCAGGCACAGAGG TGCACACTTGTAATCCCGGCACTTTGGGAGGCCGAGGCGGAAGGATCGTTTGAGCAAAGGAGTTTG AGACCAGTCTGGGCAACATGGTGAAACTCCGTCTCTACAAAAAAAATACAAAAATTAGCTGGGCATG GTAGCGGACACCTGTAGTCCCACCTACTTGGGAGGCTGATTGGGAGGATCACTTGCACCCAAGAGG TCGAAGCTGTAGTGAGCTGTGATTGCACCACTGTGCTCCAGCTTGGGCGACAGACCTTGTCTCAAA ACAACAACAACATGTGTACGTGCTTACAGGCAAATAAGAAAGACTCTAGAAGGATGTTTAAAATGCC AACAGCAGGCCCAGCGTGGTGGCTCATGCCTGTAATCCTAGCACTTTGGGAGGCCGAGGTGGGCA GATCACAAGGTCAAGAGATGAAGACCATCCTGGCCAACATGGCGAAACCCTATCTCTACTAAAAATA CAAAAATTAGCTGGGCATGGTGGCGCGCACCTGTAGTCCCAGCTAGTCAGGAGGCTGAGGCGGGA GAATCGCTTGAACCAGGGAGGCAGAGGTTGCAGTGAGCTGAGATCGCACCACTGCACTCCAGCCTG GCGACAGTGTGACTCTGTCTCAAAATAAATAAATAAATAAATAAATAAGTAAGTAATAAAATAAAATGC CAACAGCAAAAGTAACTTTTAGGCTATTATGCACCAACAAATTTATGTGATATCGAGAAGTGTTAAAC AGTTTTAGTTGCATTACACTTTGCATAATATACACAAAACACTAAACATGTTAATAAATGTTTGATATAA TAAGATGACCTAAGTTTAAGTGTAATTTTGACTCCTTTTACTGTACCTGTGTTTTCCCCCACTAACTGA CTAGTCAAGTGCTGACTGGTTTTTAAGAGATGGGGTCTTGCTCTGTTGCCCAGGCTGGCCTCAAACT CCTGGGCTCAAGTGATTTTCCCACCTCAGCCTCCCAAGTAGGTGGA(G)ACTACAGGTGTGCATCAC CATACCCGGCTTAACGTCTGTTTTTATATTTGTAGCCACATGGTACAAAGTACAGAACAGGTGTTCTT AACCTTTTTCTGCCATGGACCCTTTTGGCCTTCTGGACCCCTCCTCAGAAGAATGT 0.1%-0.4% diversity ~ 6 X X 106 differences Copy number variation

7 de novo Mutations New germline mutation Affected child - About 60 de novo mutations per genome, one coding - Are a continuous source of new mutations in the population

8 Rare diseases: hugely complex and they affect many people Known Genes ~3000 Unknown Genes ~3500 Predicted monogenic diseases ~4500 ~8000 diseases under the surface

9 Rare variants contribute to common diseases Disease frequency Extremely rare Very rare SchinzelMiller GiedionSyndrome Syndrome Mutation spécifique 1 gène Rare Common Deficiency of complexe I of the respiratory chain Intelectual deficiency, epilepsy, autism, schizophrenia, etc. 2-3 gènes Number of genes Adapté de Gilissen C et al, Genome Biol, 2011 Many genes (1000 genes for ID or mitochondrial diseases

10 Molecular Dx in Mendelien diseases - Often necessary for a precise etiological Dx * phenotype often non-specific, especially in young children * genetic heterogeneity: one disease/many genes - Impact of a Dx on patients and families * Importance of knowing * Genetic counselling/prenatal Dx * Secondary prevention ex: pre-symptomatic test for cardiomyopathies * For specifique treatments * The optimal treatment rests on an accurate Dx * More and more treatments swill become available Towards personalized medicine

11 Next generation sequencing Human Genome Project ) bp ( ec neu q és e d é t i t nau Q Bene G s na d e és o per t ne e ga ç neu q és e d t ûo C ) es a b / S U $ ( 12 yrs and $US Hi-Seq (Illumina) A few days exome: 800$ génome: 2,500$

12 Genomics will transform Dx In the clinic - Traditionally, to confirm a clinically suspected Dx sequence one or a few genes - Genomics allows the testing of all the genes at once: a revolution in molecular Dx

13 Genome sequencing allows the identification of all mutations Meyerson et al, 2010

14 Next Gen sequencing 1) Targetted sequencing to investigate heterogeneous diseases caused by a limited number of genes. ex: aortopathies 2) Exome sequencing - to investigate heterogeneous diseases caused by a large or ever growing number of genes: * Intellectual deficiency (> 300 known genes; > 1000 unknown genes!) * Lerche et al (2011): 50 new genes in one paper - Clinical presentations can be non-specific and atypical. Exemple: FORGE

15 FORGE Rate of Discovery 132 Total Genes Identified 77 Novel Genes 36 New phenotype associated with known disease gene 5 Atypical presentation associated with known disease gene 12 Known gene 24

16 Example of a Dx made by sequencing the exome E.S. is a 7 yr old boy with a neurodegenerative disease with spasticity, plus some dystonia and ataxia Three neurologists evaluated the child, with three different Dx: spastic paraplegia (>50 genes), spinocerebellar ataxia (> 15 genes), mitochondrial disease (> 300 genes). The neurologists proposed the seqeuncing of 20 genes, that would cost >40,000 $. Clinical exome sequencing cost ~ 3000 $.

17 Results for E.S. Disease Inheritance Pattern Gene Amino Acid Zygosity Reference/Commen ts Autosomal dominant spastic paraplegia 4 AD SPAST p.r499h Hétéro Variant pas présent chez mère et père COACH syndrome; Joober syndrome; Meckel AR RPGRIP1L p.v647i Hétéro Père hétéro pour le variant; mère négative Congenital disorder of glycolysation, type II AR ALG9 p.s232t Hétéro Rs AR NEB p.r4169w Hétéro Mère hétéro pour le variant; père négative Neonatal adrenoleukodystroph y; Zelhweger syndrome AR ARPEX10 p.g258r Hétéro Rs Spinal muscular atrophy, distal AR 4 AR PLEKHG5 p.v109m Hétéro Père hétéro pour le variant; mère négative Hydrolethalus syndrome 2, Joober syndrome Nemaline myopathy 2 This analysis shows a de novo mutation in a gène (SPAST) associated withhétéro a formmère of spastic AR/digenic KIF7 p.g1176c hétéro pour le variant; paraplegia. This mutation is the cause of père the négative disease in this patient.

18 Population screening for recessive mutations 1) In Founder populaitons: * Jewish Ashkenazi population * French-Canadian population of Saguenay/Lac St-Jean * Cree population 2) We each carry about 5 recessive mutations. At one point it will be cost effective to screen all individuals for these. * Bell et al., (2008): - screening for mutations in 448 genes that cause recessive diseases in children; found an average of 2.8 mutations/individual * challenge: interpretation of variants of unknown clinical significance

19 Molecular diagnostics in Cancer Impact of molecualr Dx on treatments * Poor prognosis: - avoid futile or overly agressive treatments * personalized treatments - ex: Gleevec in AML * follow residual disease

20 Non invasive prenatal Dx for aneuploïdies + Fetal circulating DNA in the maternal blood Next Gen sequencing François Rousseau Guy Rouleau

21 Each year in Canada Pregancies Prenatal testing Amniocentisis 70 Normal foetuses lost 268 T21 detected n = 450,000 Weeks of gestation n = 315, n = 10,

22 Second tier Dx test? pregnancy Prenatal tests Amniocentesis 70 1 non affected X 71 lost X T21 detected n = 450,000 Weeks of gestation 22 n = 315, X n = 10,

23 First tier test? Pregnancy Amniocentesis X 70? non affected lost X 268? 269 T21 detected n = 450,000 Weeks of gestation 23 n = 315,000 +? X n = 10,000? An early Dx

24 Circulating fetal DNA and preeclampsia Levine et al, AJOG 2004

25 Soon Sequencing of fetal DNA in all pregnancies to find large structural variants (ex trisomy 21). Eventually identify most CNV, de novo mutations and recessive diseases

26 Neurodevelopmental disorders There are many Some are quite common Schizophrenia 1% Autism 1% Intellectual deficiency 2-3% Sub optimal treatments, at best a great unmet medical need

27 Schizophrenia Schizophrenia is a major life long mental disorder. The disease is characterized by a wide spectrum of symptoms that profoundly affects cognitive, behavioral and emotional processes.

28 Family Studies of Schizophrenia (Source: Gottesman, 1991)

29 Twin Studies in Schizophrenia Over 30 twin SCZ studies have been conducted: Twin studies of SCZ before 1980s: selected kindreds, MZ 31-78%, DZ 4-27%; heritability ; Second generation of SCZ twin studies: systematic, clinic-based, MZ approximate 2 x DZ; heritability ; Contemporary twin studies of SCZ: population-based, MZ 41-50%, DZ 0-14%; heritability In every study, MZ SCZ concordance >> SCZ DZ concordance!

30 SCZ Genetics Linkage and GWAs studies have largely failed to explain the bulk of the heritability. Only a few genes have been convincingly linked to SCZ. CNV and sequencing studies show a role for rare and de novo CNVs. De novo mutations and rare variants probably explain the bulk of the heritability

31 Autism Autistic spectrum disorders (ASD) are characterized by deficits in three core domains: reciprocal social interaction communication deficits repetitive and restricted patterns of behaviour. age of onset at months, which corresponds to the period when spatial and temporal transcriptional cascades lead to remodeling and elaboration of neuronal circuitry.

32 AUT Genetics Twin and family studies show a high heritability ~90%, with significant genetic heterogeneity. Linkage and GWAs studies have largely failed to explain the bulk of the heritability. A number of genes have been identified, each responsible for only a very small number of cases De novo mutations and rare variants probably explain the bulk of the heritability

33 The same genes in different people predispose to ASD, SCZ and ID: diseases overlap! Genetic Examples Genes ASD SCZ/COS NSID Tourette Syndrome NLGN4 SHANK1 SHANK2 SHANK3 NRXN1 SYNGAP1 DISC1 CNTNAP2 MECP2 FOXP1 Bipolar ADHD Rett Syndrome

34 Genetic Architecture of SCZ/AUT/ID Multiple rare penetrant variants in many different genes Fits with complexity of the brain and that idea that SCZ/AUT/ID are syndromes. However, there must be a selection against these deleterious alleles. For these diseases to remain at high frequency in the population, they must be replenished.

35 De novo mutations: a source of rare variants De novo mutations are common New deleterious mutations occur about 1 per zygote. Example: Rett Syndrome; incidence: 1 in 10,00015,000 females; new mutation rate of one in 5,0007,500 live birth for this small gene of 498 aa. Assuming 20,000 genes and 2x108 births, every year every gene in the human genome is mutated to a null 10,000 times

36 Conclusion Hundreds, maybe thousands of genes predispose to AUT, SCZ, ID and other neurodevelopmental disorders Many genes seem to be involved in the synapse, particularly regulating synaptic plasticity

37 How can sense be made of this? Genes code for polypeptides, which assemble to make proteins, that assemble to make molecular machines Molecular machines perform a function, that results in one or many outputs It is predicted that genes that cause neurodevelopmental diseases will assort into a number of different molecular machines (pathways)

38 Molecular machines It should be possible to target functions of the molecular machines that would partially correct the defects Evidence is slowly unfolding. ex.: Glatamatergic system in ID and SCZ Fetal Prefrontal Cortical Network in SCZ NMDA and GABA modulation in RETT syndrome

39 X-linked intellectual disability -Excess of males with ID: 25% - X-linked ID: more than 100 known genes -Incidence of Fragile X syndrome: 1/6000 (2% of males with ID) -Incidence of mutations in sporadic males cases of ID: ARX 0.13 % MECP % SLC6A % -X-linked ID would account for 10% of males with ID. Ropers et al., Nature Rev./Genetics, 6:46-57, 2005

40 FRAGILE X syndrome

41 FRAGILE X syndrome

42 Exaggerated mglur5-ltd in FMR1y/- mice Bassell and Gross, Nature Medicine, 2008

43 Impact of mglur5 anatagonists in Fmr1y/- mice - Dendritic spine: - Protein synthesis: - LTP: - Prepulse inhibition: - Seizures: - Learning: - Motor behavior: rescue rescue no rescue rescue? rescue??? rescue Reviewed in Hagerman et al., Modeling Fragile X syndrome, Results and Problems in Cell Differentiation, 54: , 2012.

44 Fragile X: clinical trials with mglur5 antagonists -Berry-Kravis et al., J. Med. Genet., 2009: - fenobam, single-dose, open-label trial - improvement of communication and eye contact - improvement of prepulse inhibition -Jacquemont et al., Sci Transl Med, 2011: - AFQ056, double blind, ramdomized - no effect on the Aberrant Behavior Checklist (ABC-C) score - potential effect in patients with full methylation vs partial methylation Reviewed in Hagerman et al., Modeling Fragile X syndrome, Results and Problems in Cell Differentiation, 54: , 2012.

45 Plasticity The human brain is plastic. Brain connections, synapses, are continuously made and unmade throughout life, based on interaction with the environment. There is a complex molecular machinery that enables this plasticity. Plasticity is maintained throughout life even into old age.

46 Examples of plasticity in humans

47 With respect to blind individuals: Are they better than the sighted in tasks involving the auditory modality? Is there a difference between the early blind and late blind

48 Sound Discrimination in Far Space in the Blind Figure: Performance of the Three Groups on the Minimum-Audible-Distance Discrimination Results show that the early- and late-onset groups perform similarly and better than the sighted control group, the latter group of subjects performing at chance level even at the maximum distance of 1 m. On the right side of the figure is illustrated the experimental setup. Correct responses on catch trials (not included in the figure) were as follows: sighted (79%), late (80%), and early (81%).

49 Segmented hippocampus Segmented hippocampus. In A) the saggital, B) coronal and C) horizontal plane. The yellow-green scale corresponds to the right hippocampus and the blue-purple scale to the left hippocampus. The head (dark green) can clearly be distinguished from both the body (light green) and tail (yellow-green) in the saggital slice. The mean total and partial hippocampal volumes for both the early blind (green), the late blind (orange) and the sighted (yellow) are shown in the graph.

50 The Boston Keratoprosthesis re-establishes vision in adults with darkened lenses Adlave, 2009; Dagher & Dohlman, 2008; Dohlman, 2007; Khan et al., 2008

51 Ventral occipito-temporal pathway is activated when a person must discriminate a face Haxby et al., PNAS, 1991; Kanwisher et al., The Journal of Neuroscience, 1997

52 Ventral Pathway- after three days see activation changes in temporal cortex- fmri results when comparing a face with scrambled visual noise Before 3 days after

53 Conclusion For Neurodevelopmental diseases Lifelong diseases that affect 4-5% of the world population First molecular genetic definition of the underlying genetic cause Targeted correction of the specific defects With plasticity there should be some improvement in function of all persons treated

54 Questions?