Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
|
|
- Wendy Coral Warner
- 5 years ago
- Views:
Transcription
1 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
2 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes genes to be expressed in a parent-of-origin-specific manner. Forms of genomic imprinting have been demonstrated in fungi, plants and animals. There are about 150 imprinted genes known in the mouse and about half that in humans. 2. To understand how genomic imprinting alters expected gene expression when compared to Mendelian inheritance patterns. Genomic imprinting is an inheritance process independent of classical Mendelian inheritance patterns. It is an epigenetic process that involves DNA methylation and chromatin remodeling without altering the genetic sequence. Epigenetic marks are established ("imprinted") in the germline (sperm or egg cells) of the parents and are maintained through mitotic cell divisions in the somatic cells of an organism. 3. To appreciate the implications of genomic imprinting in human health. Appropriate imprinting of certain genes is important for normal development. Human diseases involving genomic imprinting include Angelman syndrome and Prader Willi syndrome. Imprinting and cancer
3 Mendel s Famous Peas
4 Mendel s Famous Peas
5 Genomic imprinting is an epigenetic phenomenon that causes genes to be expressed in a parent-of-origin-specific manner. Some important definitions: Haploid: contains only one set of chromosomes Diploid : contains 2 sets of chromosomes Biallelic expression: a gene is expressed from both the maternal and paternal alleles. You have 2 expressed copies of the gene (Most genes) Monoallelic expression: A gene is expressed from only one of the parental alleles. You have only one expressed copy of the gene (Imprinted genes) Differentially Methylated Region (DMR): Methylated on one parental allele and not the other.
6
7
8 Parental Conflict Theory Also known as the kinship theory of genomic imprinting: The inequality between parental genomes due to imprinting is a result of the differing interests of each parent in terms of the evolutionary fitness of their genes. The father's genes that encode for imprinting gain greater fitness through the success of the offspring, at the expense of the mother. The mother's evolutionary imperative is often to conserve resources for her own survival while providing sufficient nourishment to current and subsequent litters. Paternally expressed genes tend to be growth-promoting whereas maternally expressed genes tend to be growth-limiting.
9 Imprinted genes and development
10 Nuts and Bolts
11 Brief reminder of key regulators of active and repressed genes
12 Active Euchromatin Accessible to transcriptional activators Low density of nucleosomes H2A H2B H3 H4 H3K9ac H3K14ac H3K4me2 H3K4me3 H3K36me3 H4K16ac
13 Repressed Heterochromatin Densely packed nucleosomes X Transcriptionally inaccessible H2A H2B H3 H4 H3K27me2 H3K27me3 H3K9me H3K9me2 H3K9me3 DNA methylation
14 CTCF
15
16 Genomic imprinting is just monoallelic gene silencing inherited in a parent of origin specific fashion
17 Imprinting control region (ICR) Regulatory elements which control imprinting of one or more genes. Differentially methylated regions of DNA rich in cytosine and guanine nucleotides Hemi-methylated: cytosine nucleotides methylated on one copy but not on the other. Associate with non-coding RNAs to recruit CTCF and are essential for imprinting of genes in their corresponding regions.
18 Methylation Cytosine 5-Methylcytosine DNA methyltransferase S-adenosyl methionine See Dr. Smiraglia s Lecture from last week
19
20 lncrna as a regulator of chromatin complex remodeling CTCF
21 Putting it all together
22 Imprint acquisition and erasure in mammalian development Imprints are present in gametes Imprint maintained after fertilization Imprintes ERASED in gonad before sex determination Imprints are acquired by gametes The parental alleles are differentially marked by DNA methylation during gametogenesis when the genomes are in separate compartments. This is how the methylation machinery distinguished the paternal vs. maternal allele.
23 Model for the establishment of male germline imprinting marks. The Journal of Pathology Volume 211, Issue 3, pages , 18 DEC 2006 DOI: /path
24 Real world consequences
25
26 Angelman s syndrome Prader Willi Syndrome start at 3:50:
27 Chromosome 15 region that controls PWS and AS
28 Chromosome 15 region that controls PWS and AS DNA methylation? lncrna? CTCF?
29 Genomic imprinting in cancer
30 Loss of imprinting (LOI) of the Igf2/H19 loci has been linked to colon cancer Loss of Imprinting (LOI) of the Igf2 gene correlates with colon cancer Result= Maternal Igf2 gene is turned on With family history- 5X more likely to show LOI Polyps detected- 3X more likely to show LOI Personal history- 22X more likely to show LOI
31 Other links Mice engineered to be imprintfree are tumor prone Normal imprinting of some genes is disrupted in tumors PEG1 in lung cancer TP73 in gastric cancer CDKN1C in pancreatic cancer IGF2 in Beckwith-Wiedemann Syndrome(BWS): a cancer predisposition syndrome results from abnormal expression of imprinted genes on chromosome 11 Wilms tumor Adrenocortical carcinoma Rhabdomysarcoma Hepatoblastoma Hepatocellular carcinoma Breast cancer Lung cancer Colorectal cancer Leiomyosarcoma Testicular germ cell cancer Renal cell carcinoma Kidney clear cell carcinoma Choriocarcinoma Cervical carcinoma Oesophageal cancer AML
32 Beckwith-Wiedemann Syndrome (BWS) Overgrowth and cancer predisposition syndrome fold increased risk to specific embryonal tumors (i.e. Wilms tumor) Enlarged tongue (macroglossia) Enlarged kidneys Enlarged pancreas Other developmental defects Imbalance in the expression of one or more 11p15.5 imprinted genes (contains both the IGF2/H19 cluster and the KvDMR1 cluster) Main causes: Over-activity of IGF2 / loss of CDKN1C expression >50% of cases due to abnormal DNA methylation
33 Imprinted genes and cancer?
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationLecture 27. Epigenetic regulation of gene expression during development
Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationFinal Project Genomic Imprinting: Relevance to human disease and theories of origin
Biochem 158/258 Siina Bruce Final Project Genomic Imprinting: Relevance to human disease and theories of origin Introduction Genomic imprinting is an epigenetic phenomenon in which the expression of a
More informationMethylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine
Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of
More informationHigh resolution melting for methylation analysis
High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells
More informationGenetics and Genomics in Medicine Chapter 6. Questions & Answers
Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the
More information4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider
Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationEpigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics
Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects
More information4/8/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Epigentics. Questions to Consider
Objectives Epigentics Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome inactivation. Describe the modifications/mechanisms
More informationEpigenetic Inheritance
(2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)
More informationBeckwith-Wiedemann syndrome: imprinting in clusters revisited. Perspective. Eamonn R. Maher 1 and Wolf Reik 2 1
Beckwith-Wiedemann syndrome: imprinting in clusters revisited Perspective SERIES on epigenetic regulation Eamonn R. Maher 1 and Wolf Reik 2 1 Section of Medical and Molecular Genetics, Department of Paediatrics
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationH19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the
Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 825 H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the BY CLAES HOLMGREN ACTA UNIVERSITATIS
More informationPatterns of Single-Gene Inheritance Cont.
Genetic Basis of Disease Patterns of Single-Gene Inheritance Cont. Traditional Mechanisms Chromosomal disorders Single-gene gene disorders Polygenic/multifactorial disorders Novel mechanisms Imprinting
More informationDedicated to my family
Dedicated to my family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Mohammad F*, Pandey RR*, Nagano T, Chakalova L, Mondal
More informationThe significance of genomic imprinting in assisted reproduction
Gynaecological Clinic Rigshospitalet Copenhagen University The significance of genomic imprinting in assisted reproduction Øjvind Lidegaard Øjvind Gynaecological Lidegaard Clinic Rigshospitalet Copenhagen,
More informationGENDER James Bier
GENDER 2005-2008 James Bier Objectives 1. State the method of determining gender in several genetic systems. 2. List the three regions of the Y chromosome. 3. Describe the events that promote sexual development
More informationBasic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH
Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,
More informationMendelian Genetics. Gregor Mendel. Father of modern genetics
Mendelian Genetics Gregor Mendel Father of modern genetics Objectives I can compare and contrast mitosis & meiosis. I can properly use the genetic vocabulary presented. I can differentiate and gather data
More informationBiology 2C03 Term Test #3
Biology 2C03 Term Test #3 Instructors: Dr. Kimberley Dej, Ray Procwat Date: Monday March 22, 2010 Time: 10:30 am to 11:20 am Instructions: 1) This midterm test consists of 9 pages. Please ensure that all
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More informationTranscriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
More informationThe Chromosomal Basis Of Inheritance
The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.
More informationReview Article Epigenetic Mechanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted Regions in Mammals, Plants, and Insects
Genetics Research International Volume 2012, Article ID 585024, 17 pages doi:10.1155/2012/585024 Review Article Epigenetic echanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted
More informationLong Noncoding RNAs in Imprinting and X Chromosome Inactivation
Biomolecules 2014, 4, 76-100; doi:10.3390/biom4010076 Review OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Long Noncoding RNAs in Imprinting and X Chromosome Inactivation Joseph
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationThe Chromosomal Basis of Inheritance
The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these
More informationFACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet:
Important points It is increasingly clear that translation of the genetic code into proteins is not the only way that our genes influence our growth, development and health and that changes in the genetic
More informationGENOMIC IMPRINTING RESULTS
GENOMIC IMPRINTING RESULTS in parent-specific gene expression, that is, in a difference in gene expression depending on which parent contributed the gene. In the usual case, an allele is silent when inherited
More informationEpigenetics, brain evolution and behaviour
Available online at www.sciencedirect.com Frontiers in Neuroendocrinology xxx (2008) xxx xxx Review Epigenetics, brain evolution and behaviour Eric B. Keverne a, *, James P. Curley b a Sub-Department of
More informationThe Chromosomal Basis of Inheritance
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance
More informationChromosomes, Mapping, and the Meiosis-Inheritance Connection. Chapter 13
Chromosomes, Mapping, and the Meiosis-Inheritance Connection Chapter 13 Chromosome Theory Chromosomal theory of inheritance - developed in 1902 by Walter Sutton - proposed that genes are present on chromosomes
More informationInformation leaflet for patients and families. Uniparental Disomy (UPD)
Information leaflet for patients and families Uniparental Disomy (UPD) What are genes and chromosomes? Our genes are the unique set of instructions inside every cell of our body which make each of us an
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More information2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No
2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No. 26 2989 3000 Tumor development in the Beckwith Wiedemann syndrome is associated with a variety of constitutional molecular 11p15
More informationGenetic Assessment and Counseling
Genetic Assessment and Counseling Genetic counseling is the communication of information and advice about inherited conditions and a person seeking such advice is called a consultand. This process includes
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationEpigenetics and diseases. Genetical analysis Irma takács
Epigenetics and diseases Genetical analysis Irma takács 30.11.2010. Epigenetic diseases Introduction Mechanism Diseases Miracle: Identical DNA different cells EPIGENETICS Epigenetics C.H. Waddington in
More informationUnit 5 Review Name: Period:
Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Calico cats are female because 1) A) the Y chromosome has a gene blocking orange coloration.
More informationEpigenetic contribution to birth defects. David Amor 20 th June 2011
Epigenetic contribution to birth defects David Amor 20 th June 2011 Genomic imprinting Genomic imprinting is the biological process whereby a gene or genomic domain is biochemically marked with information
More informationGenetic Variation Junior Science
2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction
More informationStrategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.
Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationA. Incorrect! Cells contain the units of genetic they are not the unit of heredity.
MCAT Biology Problem Drill PS07: Mendelian Genetics Question No. 1 of 10 Question 1. The smallest unit of heredity is. Question #01 (A) Cell (B) Gene (C) Chromosome (D) Allele Cells contain the units of
More informationLecture 7. Chapter 5: Extensions and Modifications of Basic Principles, Part 2. Complementation Test. white squash x white squash WwYy x WwYy
Lecture 7 white squash x white squash WwYy x WwYy Chapter 5: Extensions and Modifications of Basic Principles, Part 2 Problem Set 1B due on Monday Genotype W_Y_ 9/16 W_yy 3/16 wwy_ 3/16 wwyy 1/16 Phenotype
More informationThe Chromosomal Basis of Inheritance
Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Locating Genes on Chromosomes A century
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationImprinting diseases and IVF. Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark
Imprinting diseases and IVF Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark Li/03 What is the difference between a mule and a hinny? Stallion Hingst Horse
More informationSexual Reproduction & Inheritance
Sexual Reproduction & Sexual Reproduction & Overview Asexual vs Sexual Reproduction Meiosis Genetic Diversity Mendel & The Laws of Sexual Reproduction Sexual Reproduction Asexual Reproduction Prokaryotes
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationEPIGENETICS AND HUMAN DISEASE
Annu. Rev. Genomics Hum. Genet. 2004. 5:479 510 doi: 10.1146/annurev.genom.5.061903.180014 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on June
More informationChapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes
Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene
More informationEpigenetic regulation of endogenous genes and developmental processes
Epigenetic regulation of endogenous genes and developmental processes Epigenetic programming in plants helps control developmental transitions Embryonic to vegetative transition Vegetative to reproductive
More informationThe Chromosomal Basis of Inheritance
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationEpigenetics in evolution and disease
Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger
More informationBiology Unit III Exam» Form C
Directions: For each of the following questions, decide which of the choices is best and fill in the corresponding space on the answer document. 1. Which of these sets of chromosomes is found in a single
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationGenetic basis of inheritance and variation. Dr. Amjad Mahasneh. Jordan University of Science and Technology
Genetic basis of inheritance and variation Dr. Amjad Mahasneh Jordan University of Science and Technology Segment 1 Hello and welcome everyone. My name is Amjad Mahasneh. I teach molecular biology at Jordan
More informationInformation for You and Your Family
Information for You and Your Family What is Prevention? Cancer prevention is action taken to lower the chance of getting cancer. In 2017, more than 1.6 million people will be diagnosed with cancer in the
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationThe bases on complementary strands of DNA bond with each other in a specific way A-T and G-C
1 Bio 1101 Lecture 6 (Guided Notes) Ch. 8: Cellular Basis of Reproduction 2 3 4 5 6 Cellular Basis of Reproduction & Inheritance In order for an organism to replace dead cells or to grow and produce new
More informationIntroduction to Genetics and Heredity
Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes
More informationHuman Genetics (Learning Objectives)
Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,
More informationProblem Set 5 KEY
2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development
More informationEpigenetic marks in offspring of. cryopreserved immature ovary of mouse
6th Workshop on Mammalian folliculogenesis and oogenesis: from basic science to the clinic Epigenetic marks in offspring of cryopreserved immature ovary of mouse Nadine Binart Inserm U845, Paris, France
More informationThe Chromosomal Basis of Inheritance
Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationThe Chromosomal Basis of Inheritance
Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationMitosis and Meiosis. See Mitosis and Meiosis on the class web page
Mitosis and Meiosis Mitosis and Cellular Reproduction. A cell s hereditary material (DNA) is located on chromosomes in the cell s nucleus. In the process called mitosis, a cell s hereditary material is
More informationChromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide
More informationEpigenetics and Genomic Imprinting. IOM Workshop Arthur L. Beaudet JUNE 16, 2005
Epigenetics and Genomic Imprinting IOM Workshop Arthur L. Beaudet abeaudet@bcm.tmc.edu JUNE 16, 2005 EPIGENETICS ONE DEFINITION The study of changes in gene function that are stable and heritable (or potentially
More informationSingle Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions
Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are
More informationBiochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure
Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,
More informationThe Chromosomal Basis of Inheritance
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance
More informationMendelian Genetics. Activity. Part I: Introduction. Instructions
Activity Part I: Introduction Some of your traits are inherited and cannot be changed, while others can be influenced by the environment around you. There has been ongoing research in the causes of cancer.
More informationThe Chromosomal Basis of Inheritance
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance
More informationSEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation
Genetic Variation: The genetic substrate for natural selection Sex: Sources of Genotypic Variation Dr. Carol E. Lee, University of Wisconsin Genetic Variation If there is no genetic variation, neither
More informationA reprint from American Scientist
A reprint from American Scientist the magazine of Sigma Xi, The Scientific Research Society This reprint is provided for personal and noncommercial use. For any other use, please send a request to Permissions,
More informationHuman Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur
Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 02 Lecture - 06 Let us test your understanding of Pedigree
More informationAN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
More informationI. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross?
Chapter 5 Extensions and Modifications of Basic Principles I. Multiple Alleles The ABO blood group has multiple alleles codominance and complete dominance. In codominance, both alleles are expressed simultaneously.
More informationMMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco
MMB (MGPG) 2017 Non traditional Inheritance Epigenetics A.Turco NON TRADITIONAL INHERITANCE EXCEPTIONS TO MENDELISM - Genetic linkage (2 loci close to each other) - Complex or Multifactorial Disease (MFD)
More informationEpigenetics and Human Disease
Epigenetics and Human Disease May 28, 2014 1 Angelman Syndrome & Prader-Willi Syndrome Sister Syndromes Angelman Syndrome ~1/20,000 births happy disposition smile often bouts of laughter minimal verbal
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More information