Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Size: px
Start display at page:

Download "Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821"

Transcription

1 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

2 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes genes to be expressed in a parent-of-origin-specific manner. Forms of genomic imprinting have been demonstrated in fungi, plants and animals. There are about 150 imprinted genes known in the mouse and about half that in humans. 2. To understand how genomic imprinting alters expected gene expression when compared to Mendelian inheritance patterns. Genomic imprinting is an inheritance process independent of classical Mendelian inheritance patterns. It is an epigenetic process that involves DNA methylation and chromatin remodeling without altering the genetic sequence. Epigenetic marks are established ("imprinted") in the germline (sperm or egg cells) of the parents and are maintained through mitotic cell divisions in the somatic cells of an organism. 3. To appreciate the implications of genomic imprinting in human health. Appropriate imprinting of certain genes is important for normal development. Human diseases involving genomic imprinting include Angelman syndrome and Prader Willi syndrome. Imprinting and cancer

3 Mendel s Famous Peas

4 Mendel s Famous Peas

5 Genomic imprinting is an epigenetic phenomenon that causes genes to be expressed in a parent-of-origin-specific manner. Some important definitions: Haploid: contains only one set of chromosomes Diploid : contains 2 sets of chromosomes Biallelic expression: a gene is expressed from both the maternal and paternal alleles. You have 2 expressed copies of the gene (Most genes) Monoallelic expression: A gene is expressed from only one of the parental alleles. You have only one expressed copy of the gene (Imprinted genes) Differentially Methylated Region (DMR): Methylated on one parental allele and not the other.

6

7

8 Parental Conflict Theory Also known as the kinship theory of genomic imprinting: The inequality between parental genomes due to imprinting is a result of the differing interests of each parent in terms of the evolutionary fitness of their genes. The father's genes that encode for imprinting gain greater fitness through the success of the offspring, at the expense of the mother. The mother's evolutionary imperative is often to conserve resources for her own survival while providing sufficient nourishment to current and subsequent litters. Paternally expressed genes tend to be growth-promoting whereas maternally expressed genes tend to be growth-limiting.

9 Imprinted genes and development

10 Nuts and Bolts

11 Brief reminder of key regulators of active and repressed genes

12 Active Euchromatin Accessible to transcriptional activators Low density of nucleosomes H2A H2B H3 H4 H3K9ac H3K14ac H3K4me2 H3K4me3 H3K36me3 H4K16ac

13 Repressed Heterochromatin Densely packed nucleosomes X Transcriptionally inaccessible H2A H2B H3 H4 H3K27me2 H3K27me3 H3K9me H3K9me2 H3K9me3 DNA methylation

14 CTCF

15

16 Genomic imprinting is just monoallelic gene silencing inherited in a parent of origin specific fashion

17 Imprinting control region (ICR) Regulatory elements which control imprinting of one or more genes. Differentially methylated regions of DNA rich in cytosine and guanine nucleotides Hemi-methylated: cytosine nucleotides methylated on one copy but not on the other. Associate with non-coding RNAs to recruit CTCF and are essential for imprinting of genes in their corresponding regions.

18 Methylation Cytosine 5-Methylcytosine DNA methyltransferase S-adenosyl methionine See Dr. Smiraglia s Lecture from last week

19

20 lncrna as a regulator of chromatin complex remodeling CTCF

21 Putting it all together

22 Imprint acquisition and erasure in mammalian development Imprints are present in gametes Imprint maintained after fertilization Imprintes ERASED in gonad before sex determination Imprints are acquired by gametes The parental alleles are differentially marked by DNA methylation during gametogenesis when the genomes are in separate compartments. This is how the methylation machinery distinguished the paternal vs. maternal allele.

23 Model for the establishment of male germline imprinting marks. The Journal of Pathology Volume 211, Issue 3, pages , 18 DEC 2006 DOI: /path

24 Real world consequences

25

26 Angelman s syndrome Prader Willi Syndrome start at 3:50:

27 Chromosome 15 region that controls PWS and AS

28 Chromosome 15 region that controls PWS and AS DNA methylation? lncrna? CTCF?

29 Genomic imprinting in cancer

30 Loss of imprinting (LOI) of the Igf2/H19 loci has been linked to colon cancer Loss of Imprinting (LOI) of the Igf2 gene correlates with colon cancer Result= Maternal Igf2 gene is turned on With family history- 5X more likely to show LOI Polyps detected- 3X more likely to show LOI Personal history- 22X more likely to show LOI

31 Other links Mice engineered to be imprintfree are tumor prone Normal imprinting of some genes is disrupted in tumors PEG1 in lung cancer TP73 in gastric cancer CDKN1C in pancreatic cancer IGF2 in Beckwith-Wiedemann Syndrome(BWS): a cancer predisposition syndrome results from abnormal expression of imprinted genes on chromosome 11 Wilms tumor Adrenocortical carcinoma Rhabdomysarcoma Hepatoblastoma Hepatocellular carcinoma Breast cancer Lung cancer Colorectal cancer Leiomyosarcoma Testicular germ cell cancer Renal cell carcinoma Kidney clear cell carcinoma Choriocarcinoma Cervical carcinoma Oesophageal cancer AML

32 Beckwith-Wiedemann Syndrome (BWS) Overgrowth and cancer predisposition syndrome fold increased risk to specific embryonal tumors (i.e. Wilms tumor) Enlarged tongue (macroglossia) Enlarged kidneys Enlarged pancreas Other developmental defects Imbalance in the expression of one or more 11p15.5 imprinted genes (contains both the IGF2/H19 cluster and the KvDMR1 cluster) Main causes: Over-activity of IGF2 / loss of CDKN1C expression >50% of cases due to abnormal DNA methylation

33 Imprinted genes and cancer?

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON ... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE

More information

Lecture 27. Epigenetic regulation of gene expression during development

Lecture 27. Epigenetic regulation of gene expression during development Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation

More information

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.

More information

Epigenetics and Chromatin Remodeling

Epigenetics and Chromatin Remodeling Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory

More information

OVERVIEW OF EPIGENETICS

OVERVIEW OF EPIGENETICS OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

Final Project Genomic Imprinting: Relevance to human disease and theories of origin

Final Project Genomic Imprinting: Relevance to human disease and theories of origin Biochem 158/258 Siina Bruce Final Project Genomic Imprinting: Relevance to human disease and theories of origin Introduction Genomic imprinting is an epigenetic phenomenon in which the expression of a

More information

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of

More information

High resolution melting for methylation analysis

High resolution melting for methylation analysis High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells

More information

Genetics and Genomics in Medicine Chapter 6. Questions & Answers

Genetics and Genomics in Medicine Chapter 6. Questions & Answers Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the

More information

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the

More information

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:

More information

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects

More information

4/8/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Epigentics. Questions to Consider

4/8/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Epigentics. Questions to Consider Objectives Epigentics Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome inactivation. Describe the modifications/mechanisms

More information

Epigenetic Inheritance

Epigenetic Inheritance (2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)

More information

Beckwith-Wiedemann syndrome: imprinting in clusters revisited. Perspective. Eamonn R. Maher 1 and Wolf Reik 2 1

Beckwith-Wiedemann syndrome: imprinting in clusters revisited. Perspective. Eamonn R. Maher 1 and Wolf Reik 2 1 Beckwith-Wiedemann syndrome: imprinting in clusters revisited Perspective SERIES on epigenetic regulation Eamonn R. Maher 1 and Wolf Reik 2 1 Section of Medical and Molecular Genetics, Department of Paediatrics

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the

H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 825 H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the BY CLAES HOLMGREN ACTA UNIVERSITATIS

More information

Patterns of Single-Gene Inheritance Cont.

Patterns of Single-Gene Inheritance Cont. Genetic Basis of Disease Patterns of Single-Gene Inheritance Cont. Traditional Mechanisms Chromosomal disorders Single-gene gene disorders Polygenic/multifactorial disorders Novel mechanisms Imprinting

More information

Dedicated to my family

Dedicated to my family Dedicated to my family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Mohammad F*, Pandey RR*, Nagano T, Chakalova L, Mondal

More information

The significance of genomic imprinting in assisted reproduction

The significance of genomic imprinting in assisted reproduction Gynaecological Clinic Rigshospitalet Copenhagen University The significance of genomic imprinting in assisted reproduction Øjvind Lidegaard Øjvind Gynaecological Lidegaard Clinic Rigshospitalet Copenhagen,

More information

GENDER James Bier

GENDER James Bier GENDER 2005-2008 James Bier Objectives 1. State the method of determining gender in several genetic systems. 2. List the three regions of the Y chromosome. 3. Describe the events that promote sexual development

More information

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,

More information

Mendelian Genetics. Gregor Mendel. Father of modern genetics

Mendelian Genetics. Gregor Mendel. Father of modern genetics Mendelian Genetics Gregor Mendel Father of modern genetics Objectives I can compare and contrast mitosis & meiosis. I can properly use the genetic vocabulary presented. I can differentiate and gather data

More information

Biology 2C03 Term Test #3

Biology 2C03 Term Test #3 Biology 2C03 Term Test #3 Instructors: Dr. Kimberley Dej, Ray Procwat Date: Monday March 22, 2010 Time: 10:30 am to 11:20 am Instructions: 1) This midterm test consists of 9 pages. Please ensure that all

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University

More information

Transcriptional repression of Xi

Transcriptional repression of Xi Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.

More information

The Chromosomal Basis Of Inheritance

The Chromosomal Basis Of Inheritance The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.

More information

Review Article Epigenetic Mechanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted Regions in Mammals, Plants, and Insects

Review Article Epigenetic Mechanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted Regions in Mammals, Plants, and Insects Genetics Research International Volume 2012, Article ID 585024, 17 pages doi:10.1155/2012/585024 Review Article Epigenetic echanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted

More information

Long Noncoding RNAs in Imprinting and X Chromosome Inactivation

Long Noncoding RNAs in Imprinting and X Chromosome Inactivation Biomolecules 2014, 4, 76-100; doi:10.3390/biom4010076 Review OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Long Noncoding RNAs in Imprinting and X Chromosome Inactivation Joseph

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these

More information

FACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet:

FACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet: Important points It is increasingly clear that translation of the genetic code into proteins is not the only way that our genes influence our growth, development and health and that changes in the genetic

More information

GENOMIC IMPRINTING RESULTS

GENOMIC IMPRINTING RESULTS GENOMIC IMPRINTING RESULTS in parent-specific gene expression, that is, in a difference in gene expression depending on which parent contributed the gene. In the usual case, an allele is silent when inherited

More information

Epigenetics, brain evolution and behaviour

Epigenetics, brain evolution and behaviour Available online at www.sciencedirect.com Frontiers in Neuroendocrinology xxx (2008) xxx xxx Review Epigenetics, brain evolution and behaviour Eric B. Keverne a, *, James P. Curley b a Sub-Department of

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance

More information

Chromosomes, Mapping, and the Meiosis-Inheritance Connection. Chapter 13

Chromosomes, Mapping, and the Meiosis-Inheritance Connection. Chapter 13 Chromosomes, Mapping, and the Meiosis-Inheritance Connection Chapter 13 Chromosome Theory Chromosomal theory of inheritance - developed in 1902 by Walter Sutton - proposed that genes are present on chromosomes

More information

Information leaflet for patients and families. Uniparental Disomy (UPD)

Information leaflet for patients and families. Uniparental Disomy (UPD) Information leaflet for patients and families Uniparental Disomy (UPD) What are genes and chromosomes? Our genes are the unique set of instructions inside every cell of our body which make each of us an

More information

The Biology and Genetics of Cells and Organisms The Biology of Cancer

The Biology and Genetics of Cells and Organisms The Biology of Cancer The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried

More information

2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No

2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No 2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No. 26 2989 3000 Tumor development in the Beckwith Wiedemann syndrome is associated with a variety of constitutional molecular 11p15

More information

Genetic Assessment and Counseling

Genetic Assessment and Counseling Genetic Assessment and Counseling Genetic counseling is the communication of information and advice about inherited conditions and a person seeking such advice is called a consultand. This process includes

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

Epigenetics and diseases. Genetical analysis Irma takács

Epigenetics and diseases. Genetical analysis Irma takács Epigenetics and diseases Genetical analysis Irma takács 30.11.2010. Epigenetic diseases Introduction Mechanism Diseases Miracle: Identical DNA different cells EPIGENETICS Epigenetics C.H. Waddington in

More information

Unit 5 Review Name: Period:

Unit 5 Review Name: Period: Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Calico cats are female because 1) A) the Y chromosome has a gene blocking orange coloration.

More information

Epigenetic contribution to birth defects. David Amor 20 th June 2011

Epigenetic contribution to birth defects. David Amor 20 th June 2011 Epigenetic contribution to birth defects David Amor 20 th June 2011 Genomic imprinting Genomic imprinting is the biological process whereby a gene or genomic domain is biochemically marked with information

More information

Genetic Variation Junior Science

Genetic Variation Junior Science 2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction

More information

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice. Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

A. Incorrect! Cells contain the units of genetic they are not the unit of heredity.

A. Incorrect! Cells contain the units of genetic they are not the unit of heredity. MCAT Biology Problem Drill PS07: Mendelian Genetics Question No. 1 of 10 Question 1. The smallest unit of heredity is. Question #01 (A) Cell (B) Gene (C) Chromosome (D) Allele Cells contain the units of

More information

Lecture 7. Chapter 5: Extensions and Modifications of Basic Principles, Part 2. Complementation Test. white squash x white squash WwYy x WwYy

Lecture 7. Chapter 5: Extensions and Modifications of Basic Principles, Part 2. Complementation Test. white squash x white squash WwYy x WwYy Lecture 7 white squash x white squash WwYy x WwYy Chapter 5: Extensions and Modifications of Basic Principles, Part 2 Problem Set 1B due on Monday Genotype W_Y_ 9/16 W_yy 3/16 wwy_ 3/16 wwyy 1/16 Phenotype

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Locating Genes on Chromosomes A century

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

Imprinting diseases and IVF. Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark

Imprinting diseases and IVF. Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark Imprinting diseases and IVF Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark Li/03 What is the difference between a mule and a hinny? Stallion Hingst Horse

More information

Sexual Reproduction & Inheritance

Sexual Reproduction & Inheritance Sexual Reproduction & Sexual Reproduction & Overview Asexual vs Sexual Reproduction Meiosis Genetic Diversity Mendel & The Laws of Sexual Reproduction Sexual Reproduction Asexual Reproduction Prokaryotes

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

EPIGENETICS AND HUMAN DISEASE

EPIGENETICS AND HUMAN DISEASE Annu. Rev. Genomics Hum. Genet. 2004. 5:479 510 doi: 10.1146/annurev.genom.5.061903.180014 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on June

More information

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene

More information

Epigenetic regulation of endogenous genes and developmental processes

Epigenetic regulation of endogenous genes and developmental processes Epigenetic regulation of endogenous genes and developmental processes Epigenetic programming in plants helps control developmental transitions Embryonic to vegetative transition Vegetative to reproductive

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

Epigenetics in evolution and disease

Epigenetics in evolution and disease Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger

More information

Biology Unit III Exam» Form C

Biology Unit III Exam» Form C Directions: For each of the following questions, decide which of the choices is best and fill in the corresponding space on the answer document. 1. Which of these sets of chromosomes is found in a single

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH

More information

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single 8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those

More information

Histones modifications and variants

Histones modifications and variants Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

Genetic basis of inheritance and variation. Dr. Amjad Mahasneh. Jordan University of Science and Technology

Genetic basis of inheritance and variation. Dr. Amjad Mahasneh. Jordan University of Science and Technology Genetic basis of inheritance and variation Dr. Amjad Mahasneh Jordan University of Science and Technology Segment 1 Hello and welcome everyone. My name is Amjad Mahasneh. I teach molecular biology at Jordan

More information

Information for You and Your Family

Information for You and Your Family Information for You and Your Family What is Prevention? Cancer prevention is action taken to lower the chance of getting cancer. In 2017, more than 1.6 million people will be diagnosed with cancer in the

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

The bases on complementary strands of DNA bond with each other in a specific way A-T and G-C

The bases on complementary strands of DNA bond with each other in a specific way A-T and G-C 1 Bio 1101 Lecture 6 (Guided Notes) Ch. 8: Cellular Basis of Reproduction 2 3 4 5 6 Cellular Basis of Reproduction & Inheritance In order for an organism to replace dead cells or to grow and produce new

More information

Introduction to Genetics and Heredity

Introduction to Genetics and Heredity Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes

More information

Human Genetics (Learning Objectives)

Human Genetics (Learning Objectives) Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,

More information

Problem Set 5 KEY

Problem Set 5 KEY 2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development

More information

Epigenetic marks in offspring of. cryopreserved immature ovary of mouse

Epigenetic marks in offspring of. cryopreserved immature ovary of mouse 6th Workshop on Mammalian folliculogenesis and oogenesis: from basic science to the clinic Epigenetic marks in offspring of cryopreserved immature ovary of mouse Nadine Binart Inserm U845, Paris, France

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Mitosis and Meiosis. See Mitosis and Meiosis on the class web page

Mitosis and Meiosis. See Mitosis and Meiosis on the class web page Mitosis and Meiosis Mitosis and Cellular Reproduction. A cell s hereditary material (DNA) is located on chromosomes in the cell s nucleus. In the process called mitosis, a cell s hereditary material is

More information

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide

More information

Epigenetics and Genomic Imprinting. IOM Workshop Arthur L. Beaudet JUNE 16, 2005

Epigenetics and Genomic Imprinting. IOM Workshop Arthur L. Beaudet JUNE 16, 2005 Epigenetics and Genomic Imprinting IOM Workshop Arthur L. Beaudet abeaudet@bcm.tmc.edu JUNE 16, 2005 EPIGENETICS ONE DEFINITION The study of changes in gene function that are stable and heritable (or potentially

More information

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are

More information

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance

More information

Mendelian Genetics. Activity. Part I: Introduction. Instructions

Mendelian Genetics. Activity. Part I: Introduction. Instructions Activity Part I: Introduction Some of your traits are inherited and cannot be changed, while others can be influenced by the environment around you. There has been ongoing research in the causes of cancer.

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 15 The Chromosomal Basis of Inheritance

More information

SEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation

SEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation Genetic Variation: The genetic substrate for natural selection Sex: Sources of Genotypic Variation Dr. Carol E. Lee, University of Wisconsin Genetic Variation If there is no genetic variation, neither

More information

A reprint from American Scientist

A reprint from American Scientist A reprint from American Scientist the magazine of Sigma Xi, The Scientific Research Society This reprint is provided for personal and noncommercial use. For any other use, please send a request to Permissions,

More information

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 02 Lecture - 06 Let us test your understanding of Pedigree

More information

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research

More information

I. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross?

I. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross? Chapter 5 Extensions and Modifications of Basic Principles I. Multiple Alleles The ABO blood group has multiple alleles codominance and complete dominance. In codominance, both alleles are expressed simultaneously.

More information

MMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco

MMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco MMB (MGPG) 2017 Non traditional Inheritance Epigenetics A.Turco NON TRADITIONAL INHERITANCE EXCEPTIONS TO MENDELISM - Genetic linkage (2 loci close to each other) - Complex or Multifactorial Disease (MFD)

More information

Epigenetics and Human Disease

Epigenetics and Human Disease Epigenetics and Human Disease May 28, 2014 1 Angelman Syndrome & Prader-Willi Syndrome Sister Syndromes Angelman Syndrome ~1/20,000 births happy disposition smile often bouts of laughter minimal verbal

More information

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of

More information