Notch Pathway Blockade in Human Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment

Transcription

1 Notch Pathway Blockade in Human Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment by Erick Ka Ming Ling A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto Copyright by Erick KM Ling 2012

2 Notch Pathway Blockade in Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage Commitment Erick Ka Ming Ling Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto 2011 Glioblastoma is the commonest form of brain neoplasm and among the most malignant forms of cancer. The identification of a subpopulation of self-renewing and multipotent cancer stem cells within glioblastoma has revealed a novel cellular target for the treatment of this disease. The role of developmental cell signaling pathways in these cell populations remains poorly understood. Herein, we examine the role of the Notch signaling pathway in glioblastoma stem cells. In this thesis we have demonstrated that the canonical Notch pathway is active in glioblastoma stem cells and functions to inhibit neuronal lineage commitment in a subset of patient derived glioblastoma stem cells in vitro. Gamma secretase (γ-secretase) small molecule inhibitors or dominant-negative co-activators inhibit glioblastoma stem cell proliferation and induce neuronal lineage commitment in a fashion that synergizes with Wingless pathway activation via GSK-3β blockade. Our data suggest that subsets of patient samples show a Notch gene expression profile that predicts their abilities to undergo neuronal lineage differentiation in response to ii

3 γ-secretase small molecule inhibitors. Additionally, the data suggests that Notch may perturb the relative fractions of cells undergoing symmetric division, in favour of asymmetric division, limiting clonal expansion from single cells. These data may have important implications for treating human glioblastoma, and suggest that in addition to inhibition of proliferation, influencing lineage choice of the tumor stem cells may be a mechanism by which these tumors may be pharmacologically inhibited. iii

4 Acknowledgments The work required to complete the text and figures contained within this thesis is, without a doubt, the most difficult challenge I have ever undertaken. The completion of this document and the growth of my character would not have been possible without the influence of so many talented and patient individuals. Thank you Peter for giving me the privledge of tackling cancer and teaching me how to be a man of science. Thank you Ian for being critical, teaching me to accept criticism and making me better with it. Thank you Leanne, Ryan, Lilian, Phedias, Kevin, Caroline and Renee for being part of my fondest and most cherished moments. Mom and Emily, I could not have finished this without your unwavering love and support. For my Father especially, this achievement is as much yours as it is mine. You have showed me the importance of hard work and dedication. I love you all and will always aim to make you proud. To my loving wife Nancy who has always stood by my side. We did it! It would have been impossible to do this without you. When any challenge seems too difficult or when any barrier seems insurmountable, you have been with me to help me through it. I really am the luckiest man in the world. Finally, for all those who are afflicted by cancer: you provided me with the motivation to chip at this complex problem. I am honored to have the privledge of working with you and look forward to the day when the solution is found. Thank you. iv

5 LIST OF ABBREVIATIONS ABCG2 - ATP-binding cassette sub-family G member 2 AML Acute Myeloid Leukemia Ach Acetylcholine AD Alzheimer s disease AMP Adenosine Monophosphate APC Adenomatous Polyposis Coli APH-1 Anterior Pharynx-defective 1 APP Amyloid Precursor Protein ATRA All trans retinoic acid Bax - Bcl2-Associated-X-Protein BDNF Brain Derived Neurotrophic Factor bhlh Basic Helix Loop Helix BIO - 6-bromoindirubin-3'-oxime BMP Bone morphogenetic protein BSA Bovine Serum Albumin BTE- Basic Transcription Element BTSC Brain Tumor Stem Cell C Carboxyl terminus CBF-1- C Promoter-binding factor 1 CD Cluster of Differentiation CDK Cyclin Dependent Kinase CNTF Ciliary Neurotrophic Factor CNS Central Nervous System CSL CBF-1/Suppresor of Hairless/Lag-1 D - dextrorotatory DAPI 4',6-diamidino-2-phenylindole DAPT - N-f-L-alanyl-2-phenyl]glycin e-1,1-dimethylethyl ester Dll Delta Like DMEM Dubelcco s Modified Eagle Medium DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid DN-MAML Dominant negative mastermind like dntp Deoxyribonucleotide triphosphate DRD2 Dopamine receptor D2 e embryonic day ECD Extracellular Domain EC50 Half maximal effective concentration EDTA Ethylene diamine tetra-acetic acid ED50 Half maximal effective dose EGF Epidermal Growth Factor egfp enhanced Green Fluorescent Protein ER Endoplasmic Reticulum ES Embryonic Stem Cell FACS Fluoresence activated cell sorting FAP Familial Adenomatous Polyposis FBS Fetal Bovine Serum v

6 FBW7 - F-box and WD repeat domain-containing 7 FGF (bfgf) Basic fibroblast growth factor FITC Fluorescein Isothiocyanate GABA γ-aminobutyric acid GBM Glioblastoma multiforme GFAP Glial Fibrilary Acidic Protein Gli Glioma associated oncogene zinc-finger protein G-NS Glioblastoma Stem Cell GRIA1 Glutamate receptor 1 γs γ-secretase γsi γ-secretase inhibitor GSK-3β Glycogen synthase kinase 3 beta HD Heterodimerization Domain HDAC Histone Deacetylase HEPES (4-(2-hydroxyethl)-1-1piperazineethansulfonic acid) Hh - Hedgehog HRP Horseradish peroxidase HSC hematopoietic stem cell HTS High throughput screening INP Intermediate Neural Precursors Jag Jagged KLF - Krüppel-Like Family L - Levorotatory LIF Leukemia inhibitory factor LDA Limiting Dilution Analysis Mash1 - Human Achaete-Scute homologue 1 Ms - mouse MAML Mastermind like MAPK Mitogen-activated protein kinase MB - Medulloblastoma mrna Messenger Ribonucleic Acid MTT - 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N Amine terminus NICD Notch intracellular domain NGS Normal goat serum NGF- Neuronal growth factor NLS Nuclear Localization Signal NMDA N-methyl-D-aspartic acid NOD-SCID - Non-obese diabetic severe combined immunodeficiency NS Neural Stem NSAID Non-steroidal anti-inflammatory drug NSC Neural Stem Cell NSE Neuron Specific Enolase P - Phosphate P53 Tumor protein 53 PBS Phosphate buffered saline PCR Polymerase Chain Reaction PEN2 Presenilin enhancer 2 vi

7 PEST Proline-Glutamic Acid-Serine-Threonine domain PFA - Paraformaldehyde PI Propidium Iodide PLO Poly-L-ornithine PTEN - phosphatase and tensin homolog RAM RBP-jK Associated Molecule Rb - Retinoblastoma RBP-jκ Recombination signal-binding protein for immunoglobulin kappa-j region. RNA Ribonucleic acid RT Reverse Transcriptase RT-PCR Reverse transcriptase polymerase chain reaction SDS-PAGE - sodium dodecyl sulfate polyacrylamide gel electrophoresis SGZ Subgranular zone SVZ Subventricular zone Sox - (sex determining region Y)-box T-ALL T-lineage acute lymphoblastic leukemia TBST Tris-Buffered Saline Tween-20 TLE1 Transducin-Like Enhancer of Split 1 TH Tyrosine Hydroxylase VZ Ventricular zone WHO World health organization Wnt Wingless integration-1 WT Wild Type vii

8 Table of Contents ACKNOWLEDGMENTS... IV TABLE OF CONTENTS... VIII LIST OF TABLES... XII CHAPTER INTRODUCTION Cancer Brain Cancer Cancer Biology Cell Signaling Notch Signaling Pathway Non-canonical signaling and crosstalk Stem Cells and Cancer Stem Cells Normal neural stem and progenitor cells Notch Signaling in Stem Cells Cancer Stem Cells Brain Tumor Stem Cells Notch in cancer and cancer stem cells The Function of Notch Brain Cancer and Brain Cancer Stem Cells Specific Aims...17 CHAPTER USING NOTCH PATHWAY BLOCKADE TO DEFINE HUMAN GLIOMA STEM CELL HETEROGENEITY AND SENSITIVITY TO NEURONAL LINEAGE DIFFERENTIATION...19 viii

9 2.1 Introduction Glioblastoma Multiforme Rationale Results Primary Patient Glioma Express Notch Receptors and Ligands Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell Markers Tumor Precursor Lines Express Notch Receptors and Ligands Notch receptors are activated in Glioma NS lines Notch Pathway antagonism decreases cell proliferation γ-secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of canonical Notch signal transduction Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals Notch blockade promotes neuronal lineage differentiation Neuron like cells are negative for neurotransmitter synthesis genes Hierarchical clustering of signaling pathway genes reveals differential expression of Notch components between tumor lines Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency Gene expression between Responsive and Non-responsive NS tumor lines Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade induced differentiation Neuronal precursors treated with γsi and BIO are less proliferative Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth Discussion The Notch-Hes Axis as a Therapeutic Target Modulating Canonical and Non-Canonical Elements of the Notch pathway Functional Synergism in BTSCs Clinical Implications...88 Materials and Methods Primary Patient Samples Tissue Culture Vectors and Transfection Immunocytochemistry Semi-Quantitative and Real Time PCR Flow Cytometry Animals...98 ix

10 Microarray Data and Analysis...98 CHAPTER SYMMETRIC VERSUS ASYMMETRIC SELF RENEWAL IN CANCER STEM CELLS Introduction Results Self-renewing BTSCs persist in γsi treated cultures Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment Discussion Replating Assay Limiting Dilution Analysis Differentiation Protocol Lineage Trees CHAPTER NOTCH1 RECEPTOR MUTATIONS IN BRAIN TUMOR STEM CELLS Introduction Results Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors Discussion Materials and Methods Genomic DNA extraction Nested Polymerase Chain Reaction Sequencing CHAPTER 5 GENERAL DISCUSSION Targeting Notch in Brain Cancers Cancer Stem Cells are Controversial x

11 Cancer Stem Cells as a Therapeutic Target Notch and the Cancer Niche Insight from Neurodegenerative Disease Treatment Therapeutic Specificity Forcing lineage choice as a treatment for cancer Glioblastoma prevention Origins and mechanisms of brain tumors A neural stem cell as the cancer stem cell Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells Cancer as a caricature of development Future Direction How can we target non-neurogenic glioblastoma? Targeting Notch in CNS tumors REFERENCES xi

12 List of Tables Table Table Table Table List of Figures Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure xii

13 Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Supplemental Figure Supplemental Figure Supplemental Figure Supplemental Figure Supplemental Figure Supplemental Figure Supplemental Figure xiii

14 1 Chapter 1 1 Introduction 1.1 Cancer Brain Cancer Cancer is one of the leading causes of mortality in North America and only second to accidents in the death of children 1. In Canada, over 40% of women and 45% of men will develop some form of cancer in their lifetime with approximately 1 in 4 Canadians succumbing to this disease 2. Among the new cases of cancer reported in Canada in 2009, 1.5% of these were brain neoplasms. Mortality from this disease represented 2.3% of all Canadian cancer deaths and results in a dismal death to case ratio (0.67) which is exceeded by few other cancers. Malignant brain tumors also have the highest death to case ratio in childhood cancers (0.30). Despite initial responses to treatment, many of these tumors recur, leaving only few long term survivors 3. In particular, glioblastoma multiforme (GBM), the most common malignant primary brain tumor in adults, has a 2 year survival of less than 10%. As well, histologically benign brain tumors of the glial lineage can confer a poor prognosis in cases where growth occurs in surgically inaccessible areas. In addition, it is well known that longer term survivors of this disease, particularly children and young adults, often suffer from the adverse side effects of aggressive chemotherapy and radiation. Our poor understanding of the cellular and molecular mechanisms governing this cancer is one of the limiting factors in the development of new strategies to treat this disease Cancer Biology Cell divisions are regulated by a chorus of cellular processes. Tumor suppressors such as P53 and Rb, function to prevent tumor cell division in part by inhibiting regulators of the cell cycle and by integrating with the molecular controls regulating programmed cell death. Conversely, oncogenes such as EGFR, facilitate cell cycle progression, migration and survival. Lesions (point mutations, translocations, deletions, epigenetic alterations) in these genes can lead to a state where cells acquire one or more of the classic oncogenic properties, such as: 1. Evading apoptosis, 2. Self-sufficiency in growth signals, 3. Insensitivity to anti-growth signals, 4. Sustained angiogenesis, 5. Limitless replicative potential, and finally, 6. Tissue invasion and

15 2 metastasis 4. While these individual characteristics do not necessarily confer pathological properties, the accumulation of loss-of-function mutations in tumor supressors 5 and gain-offunction mutations in oncogenes support the development of a full blown malignant neoplasm which possesses all of the hallmarks of cancer enumerated above. The development of effective therapies against all forms of cancer will hinge on the understanding, and ultimately control of, cellular processes which regulate these characteristics. 1.2 Cell Signaling Many of the cell signaling pathways critical for normal organismal and tissue development are now recognized as contributors to neoplastic transformation. Notch, Sonic Hedgehog and Wingless pathways amongst others, all have fundamental functions in developmental patterning and regulation of post-developmental homeostasis. These pathways are known to be active in many cancers, such as those occurring in the brain, gastrointestinal, and lung 6. Defining the role of these pathways in growth and propagation of cancer will likely help identify new targets for therapeutic interventions Notch Signaling Pathway Over the past several decades the Notch signaling pathway has emerged as one of the most important pathways implicated in development, stem cell biology and cancer. Due to the diversity of actions, and complexity of signaling mechanisms, the exact role for Notch in many biological processes remains incompletely understood. The study of a Drosophila melanogaster mutant with Notched wings led Thomas Hunt Morgan in 1916 and subsequently D. F. Poulson in 1937, to identify insufficiency at the Notch locus as a cause of the improper wing development 7. Since then, it has been revealed that Notch is a key regular in all facets of Drosophila growth, including (but not limited to) wing, eye, oocyte and neural development. Studies in Caenorhabditis elegans and Drosophila have shown that Notch regulates cell fate decisions through a process termed lateral specification 8. In the developing Drosophila neuroblast, signaling between adjacent neural progenitors with stochastic differences in cell surface Notch receptor and ligand expression represses neuronal differentiation in the Notch activated cell and inhibits adjacent cells from adopting the same fate 9. In 1991, the first human Notch gene was identified and, in the same study, linked to human cancer 10. It is now clear that Notch signals are highly conserved across many organisms and serve a diverse set of functions including

16 3 developmental patterning, stem-cell maintenance and differentiation, all of which are regulated in a complicated context-dependent specificity. In mammals, there are four Notch receptor homologues (Notch1-4)(Figure 1-1). The precursor of each receptor is manufactured in the endoplasmic reticulum, exported to the golgi for posttranslational modification by fringe glycosylases 11 and further processed by furin like proteases 12. Notch receptors are then exported and assembled at the cell surface into a heterodimeric transmembrane receptor that is maintained in a stabile conformation by Ca 2+ ions 13, 14. In the absence of ligand the receptor assumes a conformationally inactive state whereby the cleavage site in the heterodimerization domain is protected from activation. The signaling cascade is initiated when the mature receptor comes into physical contact with one of five canonical ligands (Jagged1, 2, Delta-like1, 3, 4) expressed on the cell surface of an adjacent cell. Despite the large combination of potential ligand and receptor interactions, specificity is dictated by glycosylation of the receptor 11,15. Ligand-receptors interactions are mediated through the extracellular EGF-like motifs in Notch and initiate internalization of ligand into the ligandpresenting cell. Ligand internalization is thought to generate physical force which assists in deforming the tertiary structure of the receptor, displacing extracellular Ca2+ ions 13,16 and unmasking receptor cleavage sites. At this point, TNF-α-converting-enzyme (TACE) cleaves Notch at the newly exposed S2 cleavage site within the heterodimerization domain 17. At the intracellular face of the plasma membrane, γ-secretase cleaves the intracellular domain 18. Composed of the subunits nicastrin 19,20, presenilin 21,22,23, presenilin enhancer 2 (PEN2) 24, and anterior pharynx-defective 1 (APH-1) 24, and regulated by modifying proteins such as TMP21 25,26, γ-secretase cleaves the Notch receptor at the S3 cleavage site. The released Notch intracellular domain (NICD) translocates into the nucleus where it binds to the Jκ recombination signal-binding protein (RBP-Jκ/CBF-1/CSL) and recruits co-activators such as Mastermind-Like (MAML) 27. This transcriptional activation complex disrupts RBP-jκ complexes containing corepressors such as N-CoR 28,29. The RBP-Kκ/co-activator complexes binds to promoter elements and regulate transcription of target genes that include basic helix loop helix transcription factors (bhlh), primarily Hes1, Hes5, and Hes related proteins (Hey and Herp) 7. The bhlh transcription factors, in turn, form dimeric and heterodimeric complexes which have the capacity to function as either transcriptional activators or repressors 30. The resulting effect of Notch signaling is therefore highly context dependent and varies from tissue to tissue (Figure 1.2).

17 4 While the Notch signaling pathway was one of the first to be identified, it has yet to be fully defined. The Delta and Serrate ligands have been studied for decades 31, however, novel Notch ligands such as weary (Wry) are still being discovered. Drosophila weary mutations contribute to cardiomyopathy 32. Additionally, longstanding components have been found to function through previously underappreciated mechanisms. For example, negative regulation of receptor activity can occur via cis-inhibition of Notch by Delta in development of Drosophila photoreceptors 33,34. In the murine brain, Epidermal growth factor-like domain 7 has been identified as a secreted factor that binds to the ligand binding domain of Notch, antagonizing receptor function in neural stem cells 35. Even the long held views of receptor activation may require rethinking with the recent discovery that Notch1 is capable of forming homodimers 36. These findings underscore how much remains to be discovered with respect to Notch signaling and its role in development.

18 5 Figure 1-1 Structure of the four known mammalian Notch receptors. All Notch receptors have an N- terminal extracellular domain, which consists of multiple EGF repeats and three cysteine rich Lin-12 repeat (LNR) domains 37. These regions are responsible for direct ligand interaction and function to shield cleavage sites from ligand-independent activation, respectively. Ligand binding initiates proteolytic cleavage of the receptor at the heterodimerization domains (HD). Subsequent downstream signaling is dependent on cytoplasmic domain sequences. Nuclear localization sequences (NLS) are required for nuclear shuttling 38, whereas the ankyrin (ANK) domains mediate protein-protein interactions with various transcriptional co-activators 39,40. Importantly, RBP-jK binding occurs at the RBP-jK associated module (RAM) 41. Ultimately, proline-glutamic acid-serine-threonine (PEST) rich sequences in the C-terminus are responsible for activated receptor degradation 42.

19 6 Figure 1-2 Schematic of the canonical Notch signaling pathway. Notch receptors are activated by direct contact of ligands presented on the plasma membrane of adjacent cells. Pathway activation is regulated at many levels including the ligand, receptor and nucleus. Receptor modulation includes cis-delta-like 3 interactions, Numb degradation, γ-secretase regulators and others. Ligands are regulated by a class of proteins call neuralized, which endocytose and ubiquitinate ligands on the ligand presenting cell. Finally, proteins such as FBW7 assist in the turnover of activated Notch. In the absence of receptor activation, target gene expression is suppressed by co-repressors in the cell nucleus. Ligand binding unmasks target sites for TACE proteolysis within the extracellular domain and γ-secretase proteolysis within the transmembrane domain. The liberated intracellular domain translocates to the nucleus where it binds RBP-jK and MAML to induce transcription of downstream basic helix-loop-helix transcription factors and other target genes.

20 Non-canonical signaling and crosstalk As a result of the decades of study and increasing technical sophistication of biochemical assays to detect active Notch signaling, there is a growing appreciation for the idea that signaling pathways link together to form networks with considerable power to integrate across multiple membrane inputs. Defining these networks is a prerequisite for the rational development of novel anti-cancer drugs. Interestingly, there is growing evidence to demonstrate crosstalk between Wnt and Notch pathways and their integration within a common network in development and oncogenesis. For example, β-catenin, a fundamental player of the canonical Wnt pathway (Figure 1-3), is capable of binding to and stabilizing the activated domain of Notch 43. Curiously, the NICD co-activator MAML1 has recently been shown as a binding partner and transcriptional co-activator of the β-catenin mediated TCF/LEF complex 44. MAML also binds to and regulates P53 signaling 45, showing that some of the fundamental players in Notch signaling are more involved with cell homeostasis than previously thought. Conversely, some cell cycle regulators have been discovered to extensively modulate Notch. HIF-1α, a global regulator of oxygen homeostasis, binds to and stabilizes the Notch intracellular domain in C2C12 myogenic cell lines, suppressing differentiation and supporting an undifferentiated state 46. Further, HIF-1α may even upregulate components of γ-secretase, leading to activation of the receptor in hypoxic environments 47. In addition, non-bhlh targets of the RBP-jK activation complex have been identified and are important to consider in neural stem cell biology. For example, Notch can directly regulate expression of Brain Lipid Binding Protein (BLBP) 48, ABCG2 49 and Nestin 50 genes. Clearly, direct crosstalk between signaling pathways and many of the non-canonical downstream targets of Notch have important implications for disease and development.

21 8 Figure 1-3 Schematic summary diagram of canonical Wingless signaling. A) In the absence of activating ligands, β-catenin is bound and phosphorylated by the destruction complex which includes GSK-3β, APC and Axin 51. B) Binding of ligands to the frizzled receptor and LRP induces a cascade of events, which promote association of Axin with LRP, thereby disrupting the destruction complex. Subsequently, β-catenin accumulates in the cytoplasm, translocates to the nucleus, and binds to TCF/LEF. Binding of TCF/LEF to β-catenin dismantles the transcriptional repressor complex, nucleates assembly of a transcriptional activation complex and induces transcription of downstream targets.

22 9 1.3 Stem Cells and Cancer Stem Cells Normal neural stem and progenitor cells Seminal experiments conducted by James Till and Ernest McCulloch in 1963 identified a population of hematopoietic cells, which were capable of self-renewal, giving rise to spleen colonies in irradiated mice 52. These experiments identified hematopoietic stem cells as the blood borne cellular element capable of reconstituting an immune compromised host. The discovery of a stem cell compartment in blood led to similar discoveries in the gut 53, skin 54, mammary gland 55 and other tissues 56. Despite evidence to demonstrate the existence of a proliferative population in brains of songbird canaries 57, dogma persisted that the brain lacked regenerative potential. In 1992, Reynolds and Weiss cultured a population of cells from striata of 3 to 18 month old mice. When grown at clonal densities with the mitogens, epidermal growth factor (EGF) and fibroblast growth factor (FGF), non-adherent spheroid colonies grew, which contained cells positive for the intermediate filament Nestin and negative for neuronal and glial markers. Additionally these cells were found to be capable of self-renewal, generating clonally derived spheres possessing the same primitive properties. Furthermore, neurosphere initiating cells were capable of multilineage differentiation, with single cells differentiating into neuronal-specific enolase (NSE) positive neurons or glial fibrillary acidic protein (GFAP) positive astrocytes 58. This study demonstrated the existence of neural stem cells in the brain. Since then, our understanding of neuroanatomy revolving around NSCs has developed significantly. Postnatal neural stem cells are situated in at least two regions of the brain: the subventricular zone (SVZ) of the lateral ventricles and the subgranular layer of the dentate gyrus 59. In the SVZ, elegant studies by Doetsch, et al., demonstrated that a population of GFAP positive cells termed type-b astrocytes are uniquely capable of regenerating migratory neuroblasts and immature precursors following chemical ablation of cells lining the lateral ventricles 60. In murine models, neural stem cells have now been demonstrated to play an active role in postnatal olfactory development 61,62 and neuroprotective functions following brain trauma 63,64,65,66 thus dispelling the long held dogma that the brain is a postmitotic organ. Indeed, populations of proliferative cells, which contribute to neurogenesis, have been identified in the adult human brain 67. These cells may function in memory formation 68 and may even compose a human equivalent of the murine rostral migratory stream 69.

23 Notch Signaling in Stem Cells Notch signaling is a key regulator of embryonic and postnatal central nervous system development. Isolation of the Notch1 or Hes5 positive cell populations from the developing mouse forebrain enriches for cells with a greater clonogenic ability, suggesting a role in neural stem cells 70,71. Consistent with these findings, knockout of pathway elements such as Notch1 and Notch2 result in widespread CNS cell death and embryonic lethality at E10, a period of rapid neurological expansion 72. Knockout mice deficient for RBP-jK or presenilin are incapable of forming secondary or tertiary neurospheres in culture 73 and neural stem cells isolated from Hes1 - /- and Hes5 -/- double knockouts have similar self renewal impairments 74. Conversely, over expression of Notch1 75 or Notch3 76 in the murine brain induces radial glial phenotypes and astroglial cell fate specification. Over expression of Notch2 inhibits differentiation in the cerebellum by promoting proliferation of cerebellar granule neuron precursors 77, and over expression of Hes1 and Hes5 in the telencephalon maintains neural stem cells in an undifferentiated state 74. In the postnatal murine brain, RNA in-situ hybridization analysis of Notch receptors and ligands reveals strong expression within the subventricular zones and subgranular layers of the dentate gyrus 78, regions known to harbor neural stem cells 60, suggesting that Notch signaling, in addition to its developmental roles may be required to regulate postnatal NSCs. Indeed, it has been demonstrated that Notch regulates self renewal of murine neural stem cells in post-natal animals putatively through Jagged1 signaling 79. Mechanisms of NSC self renewal are being developed as it is now understood that Notch may co-operate with other signaling pathways such as EGFR 80. While Notch signals are required to promote self renewal and expansion of neural stem cells, it also provides instructive signals for lineage cell fate decisions in neural precursors. Expression of Notch receptors and ligands is critical for neuronal and astrocytic patterning in the E11.5 midgestational telencephalon 81. Regulation of cell fates occurs partly through Hes1 and Hes5, Notch targets known to inhibit downstream pro-neural transcription factors, leading to a block in neuronal lineage differentiation and promotion of glial lineage specification. Ectopic expression of activated Notch in the postnatal murine forebrain result in expansion of the radial glial putative stem cell compartment at the expense of differentiated neurons 75. Conversely, blockade of Notch signaling with pharmacologic inhibitors of γ-secretase induces neuronal lineage differentiation in endothelial co-culture experiments 82 and human fetal slice cultures 83. Notch

24 11 also signals through the non-canonical ligand F3/Contactin, to promote oligodendrocytes differentiation 84,85,86. Interestingly, the discovery that Hes proteins are regulated in an oscillatory mechanism, where adjacent neural precursors express varying levels of Notch targets genes yet retain primitive characteristics 87 demonstrates that many nuances regarding Notch in neural stem cells have yet to be defined. Paradoxically, Notch signaling has also been shown to function in terminally differentiated cells 88,89. Notch signals are critical for maintenance of post-mitotic neurons and are responsible for neuronal maturation and dendrite formation. Clearly, the Notch pathway is a multifaceted signaling mechanism with important functions at all levels of the stem cell hierarchy. 1.4 Cancer Stem Cells Central to the development of novel therapies is an understanding of how a disease state is maintained. Some of the first reports to shed light upon heterogeneity of cancer were highly unethical experiments conducted by Southam and Brunschwig in Through the dissociation of human tumors and re-injection of cell suspensions sub-cutaneously into the same patients, they observed that tumor formation occurred at a low frequency 90. Further studies of murine myeloma demonstrated that the efficiency of in-vivo spleenic colony formation was very low 91. While the idea that only a unique population of cells with tumorigenic potential was postulated 92,93, the stochastic hypothesis that most or all the cells in the tumor had equivalent, albeit low, tumorigenic potential retained prominence for almost four decades (Figure 1-4). The concept of cancer clones existing as a functional tumor hierarchy was firmly put forward in the studies by Lapidot and Dick in 1994, and by Bonnet and Dick in In these studies on acute mylogenous leukemia (AML), Lin-/CD34+/CD38- cells prospectively isolated from patient samples were observed to possess the unique capability to recapitulate the disease in-vivo upon transplantation into NOD/SCID mouse models 94. This population of leukemic cells possessed the capacity to replenish the entire repertoire of aberrant cell types found in the original patient cancer; demonstrating the capability for hierarchical organization 94. Furthermore, this work provided evidence to support the idea that the leukemogenic event occurs in primitive hematopoietic stem cells. Subsequent studies in a number of solid tumors have mirrored these results. For example, a study by Al-Hajj, et al., characterized a population of CD44+/CD24- cells isolated from patient breast cancers that were uniquely capable of forming tumors when

25 12 serially passaged in NOD/SCID mice. Secondary tumors reconstituted the phenotypically mixed population of cells found within the original patients tumor 95. The demonstration that both hematopoietic and solid cancers are driven by unique and relatively rare populations has led to characterization of cancer stem cells in many different cancer types. Thus far, cancer stem cells (CSCs) have now been identified in prostate 96, brain 97,98, colon 99,100, pancreas 101, mesenchyme 102, skin 103,104, ovaries 105, head & neck 106 and lung 56 malignancies.

26 13 Figure 1-4 Stochastic and hierarchical models of cancer growth. A) The stochastic model of cancer growth proposes that each cell within a malignancy has a small but equal capacity to give rise to neoplasia in-vivo. B) In contrast, the cancer stem cell hypothesis suggests that not all cells within a tumor are capable of propagating the malignancy. In this model, only a subpopulation of cells has the ability to self-renew and give rise to the phenotypic heterogeneity found within the cancer

27 Brain Tumor Stem Cells Pathologists have long recognized on histologic analysis of primary samples of glioblastoma that these tumors contained cells with a primitive appearance, often mixed with more differentiated cells. With the discovery of culture conditions that show a capacity to maintain viable proliferating populations of stem cells from the normal brain, Singh, et al., successfully cultured a population of cells from human tumors (medulloblastoma and glioma) that formed clonally derived tumorspheres. These Nestin positive sphere derived cells had the ability to self-renew and could generate Nestin negative, β-iii-tubulin (BIIIT) positive neurons and Nestin negative, GFAP positive astrocytes upon serum induced differentiation 107. Furthermore, these characteristics were only found in primary brain tumor cells expressing the cell surface antigen CD133. CD133 was previously identified as a marker used to enrich for spherogenic populations from the human fetal brain, as well to also identify populations of normal human hematopoietic stem cells. Importantly, only CD133+ human glioblastoma cells were capable of tumor initiation in vivo,. Upon orthotopic injection of as few as 10 2 cells into the brains of NOD-SCID mice, the CD133+ population was capable of engrafting and forming a tumor that recapitulated the original patient phenotype. Conversely, the CD133- population was not capable of generating spheres in-vitro and injection of several orders of magnitude more cells invivo did not result in tumor formation 97. The tumors that arose recapitulate the same phenotype as the original patient s tumor and were capable of regenerating disease upon serial transplantation, demonstrating cardinal features of in-vivo self-renewal capability. The existence of a cancer stem cell population in brain cancer and others, may explain why many malignancies are difficult to treat. Since only small numbers of cancer stem cells are required to propagate disease, removing the bulk of the malignant cells but sparing small numbers of CSCs may leave small populations of cells capable of regrowing the tumor, leading to clinical relapse. Perhaps the existence of CSCs may explain why many cancers recur despite aggressive chemotherapy treatment. Anti-mitotic drugs such as 5-fluorouracil 108 inhibit rapidly dividing cells, and thus by virtue of their mechanism of action, target the large numbers of precursors which are rapidly dividing but limited in self-renewal, thus sparing CSCs which retain unlimited self-renewal but which may be more relatively quiescent. In addition to this passive resistance, CSCs may possess a more active resistance to drugs. One of the hallmarks of stem cells is expression of ATP-binding cassette (ABC) transporters. Hematopoetic stem cells express high

28 15 levels of the efflux pump ABCG2, which is down regulated in more mature blood cells 109. Indeed, this property has been utilized to prospectively isolate stem cells from bone marrow 110, muscle 111 and other tissues based on the ability of pump-expressing cells to efflux fluorescent dyes. The physiological function of these transporters, also known as multidrug resistance genes, is to transport hydrophilic and hydrophobic compounds across the cell membrane as well as playing important roles in blood-brain and blood-testis barriers 112. However, expression of transporters in CSCs has also been theorized to be the cause of significant drug resistance as many common drugs are actively effluxed by these pumps. Indeed, elevated pump expression has been detected in CSCs of brain 113, breast 114, lung 114 and mesenchymal tumors 102. Another common strategy in targeting cancer is the use of radiation to induce DNA damage and cell death in areas of cancer growth. Remarkably, cancer stem cells may also possess DNA damage repair mechanisms that enable them to be particularly resilient to conventional radiation treatments 115. Thus, current strategies may only target bulk cells and spare the cancer stem cells which possess long term self-renewal ability. Understanding molecular mechanisms and cellular requirements that regulate cancer stem cells will be of critical importance for development of effective and specific therapies Notch in cancer and cancer stem cells. Considering the degree of resistance to traditional therapies, there has been a strong impetus to identify molecular mechanisms critical to growth of cancer stem cells that may confer vulnerability when targeted by anti-cancer treatments. One pathway that has been implicated in multiple tumors and more recently in CSCs is the Notch pathway. Aberrant Notch signaling is associated with a number of neoplasms 116. In particular, Notch has a significant role in the pathogenesis of T-cell acute lymphoblastic leukemia by virtue of genetic rearrangements and mutations (T-ALL). First identified in 1991 by Ellisen, et al., a translocation on chromosomes 7 and 9 caused a breakpoint in an intron of the Notch1 gene resulting in fusion of the 3 end of Notch1 to the TCRβ locus 10. This translocation resulted in expression of a constituatively activated intracellular domain (ICD) fragment of Notch1. The contribution of Notch1 to the pathogenesis of T-ALL was further demonstrated in 2004 when Weng, et al., showed that over 50% of T-ALL samples harboured mutations in the heterodimerization (HD) and/or PEST domains of Notch Point mutations found in the HD domain are thought to increase sensitivity of the receptor to activation, while PEST domain mutations increase the half-life of

29 16 activated Notch. Ultimately, both mutations cause ectopic activation of Notch1 during T- versus B-cell lineage choice of hematopoietic progenitors. Under normal circumstances, Notch1 inactivation supports development of B-cells at the expense of T-cells 118,119 while activation of the receptor supports the opposite 120. Most T-ALL leukemic cells are arrested at the CD4+CD8+ double-positive stage of development and committed to the αβ lineage suggesting that ectopic Notch1 pathway activation occurs during maturation of hematopoietic precursors 112. The role of Notch in this hematopoietic neoplasm is relatively well characterized, however, while Notch1 functions as an oncogene in the blood 117,10 and brain 121, it serves the opposite role, as a tumor suppressor, in some forms of skin, lung and cervical cancers 122,123,124. In addition to its direct contribution to oncogenesis, Notch activation also regulates tumor angiogenesis 125,126. From the first report of Notch in T-ALL over 19 years ago, the Notch signaling pathway is now implicated in development of many solid and hematopoietic cancers The Function of Notch Brain Cancer and Brain Cancer Stem Cells Active Notch signaling has been implicated across all spectrums of central nervous system neoplasms. Benign tumors of the choroid plexus can be initiated in mouse models by over expression of Notch3 and human tumors have been found to possess elevated levels of Notch In medulloblastoma, the aggressive pediatric cerebellar tumor, the role of Notch is more controversial. In some mouse models, active Notch signaling is required for the development and/or propagation of spontaneous medulloblastoma within Patched heterozygous mice 128,129,130. Yet other models of murine medulloblastoma point to a Notch independent role. Here, RBP-jκ knockout models did not prevent the generation of aggressive tumors in mice 131,132. Despite the controversy in model systems, Notch receptor activity has been identified in human medulloblastoma with Notch2 possessing oncogenic properties in these cerebellar tumors 133. Within gliomas, a spectrum of tumors with glial characteristics, activated Notch1 was detected in primary patient samples of oligoastrocytomas, anaplastic astrocytoma, glioblastoma and serum derived glioblastoma cells lines 121,134. Dysregulated expression of Notch1 through disruption of the negative microrna regulator mirna-146a may lead to uncontrolled signaling 135. It is postulated that many of these cancers may signal through canonical Notch ligands. Jagged1 signaling is active downstream of the developmental regulator inhibitor of differentiation 4 (ID4) 136 and knockdown of Dll1 was effective in preventing the growth of serum derived cell lines 121, all suggesting that these canonical binding partners are activated.

30 17 Considering the diverse and context dependent roles of Notch in normal tissue development and homeostasis, the precise role for this signaling pathway in the pathogenesis of glioblastoma is far from clear. With the identification of tumor initiating cells, efforts to identify key signaling pathways have intensified. In medulloblastoma, Fan and colleagues reported that proliferation of a serum derived medulloblastoma stem cell lines can be reduced with γ-secretase inhibitors 137, an effect that is rescued by ectopic expression of Notch2-ICD. Interestingly, Notch1 antagonized the oncogenic effects of activated Notch2 in these tumors, suggesting that Notch receptors have discrete and unique functions. Several groups have demonstrated that in-vitro and in-vivo growth of glioblastoma derived neurospheres can be blocked by administration of γ-secretase inhibitor (γsi) and this effect is Notch specific 138,139,140. In these studies, pharmacologic inhibitors attenuated the formation of glioma derived neurospheres derived from established lines and low passage cultures. Implantation of γsi impregnated beads along with glioblastoma stem cells lead to reduced tumor formation in orthotopic models. Targeting Notch in stem cells may also be an effective mechanism to sensitize BTSCs to current anti-neoplastic strategies. High rates of recurrence are thought to be due, in part, to inherent radioresistance of cancer stem cells 115. Blockade of Notch signaling in glioma has been shown to reduce tumorigenicity by sensitizing cancer stem cells to radiation therapy 141,142. This preliminary body of knowledge has lead to a push to understand the contribution of Notch to glioma stem cell self-renewal and differentiation. Herein, we propose that cancer stem cells, which drive growth of human brain cancer, are regulated by Notch signaling. Activation of the Notch receptor is required for self-renewal and also functions to suppress differentiation of cancer stem cells. Notch pathway antagonism may therefore be an effective strategy to treat brain tumors. 1.5 Specific Aims The objective of this thesis is to identify the function and significance of Notch signaling in human brain tumor stem cells derived from glioblastoma. My objectives are summarized in the chapters following.

31 18 Aim 1: Establish whether Notch components are expressed in glioblastoma. We will determine whether pathway antagonism using genetic and pharmacologic blockade is a feasible strategy to target the CSC. We will characterize the functional effect of Notch blockade in-vitro and invivo. Aim 2: Elucidate a cellular mechanism of Notch pathway mediated tumorigenesis.

32 19 Chapter 2 2 Using Notch Pathway Blockade to Define Human Glioma Stem Cell Heterogeneity and Sensitivity to Neuronal Lineage Differentiation. 2.1 Introduction Glioblastoma Multiforme Glioblastoma is the most frequent primary brain neoplasm and most malignant. Found mainly in adults between the ages of and localized most commonly in cerebral hemispheres, this class of tumor accounts for 12-15% of all intracranial tumors. Histologically, this disease presents as a poorly differentiated and highly mitotic entity. Prognosis is very poor, with mean survival of 9.5 months for patients under 50 years of age with progressively worse prognosis for older patients 3. Treatment strategies involve surgical resection, radiation and chemotherapy. Even with high doses of temozolomide, often described as one of the few successes in glioblastoma treatment options, mean survival is only extended by 60 days 143. Despite surgical resection, recurrence is frequent and often in close proximity to the original tumor site 144. With considerable phenotypic heterogeneity, is it possible to use genetic profiling to identify vulnerabilities? This approach has been useful for the treatment of some malignancies. For instance approximately 30% of invasive ductal breast cancer exhibit over expression of ErbB2 (Her2) 145, a discovery that has lead to use of humanized monoclonal antibodies against this variant of cancer, which results in significantly increased 1-year survival in patients with this disease 146. Thus under the pretense of creating individualized therapies, there has been a great effort to understand the genetics and susceptibility markers behind this disease. Great efforts have been undertaken to genotype large cohorts of glioblastoma. A large screen of 91 bulk tumor samples revealed that NF1, EGFRvIII and PI(3)K are recurring instigators in a large proportion of tumors 147. However, the identification of cancer stem cells in GBM suggests that one must consider the role and genomic profile of these particular tumor cells to obtain a more realistic picture of the molecular drivers of brain tumor growth.

33 20 Our laboratory has previously demonstrated that brain tumors are maintained by a rare subpopulation of cancer cells, which retain stem-like properties, and we have also established methods for their culture in vitro. Unlike the majority of cells isolated from primary tumors, CSCs are uniquely capable of self-renewing in-vitro and in-vivo to give rise to tumors in murine models, which recapitulate human disease 97. Preliminary reports have suggested that many of the signaling pathways which regulate normal neural stem cells, may have a similar function in regulating the self renewal of cancer stem cells. Amongst these putative regulatory pathways, the role of Notch signaling in CSCs remains an oft implicated player. Based on the knowledge of the phenotypic diversity surrounding glioblastoma multiforme, we dissected the role of signaling pathways in glioblastoma stem cells with the objective of elucidating novel targets for chemotherapy Rationale Developmental signaling pathways are known to play an important part in normal neural stem cell maintenance and expansion 148. Among these pathways, the Notch signaling pathway has been shown to regulate neural stem cell self renewal 73,149 as well as to regulate gliogenesis 150,151,152,76 and the morphology of mature neurons 153,154. These apparently opposing functions (or context dependency) are integrated with the finding that GFAP positive radial glial stem cells are Notch positive 155,75,83. Glioblastoma stem cells derived from patient tumors possess self-renewal and proliferative properties similar to that of normal NSCs 97,107,98. Therefore, we will investigate whether Notch pathway mechanisms regulate similar roles in stem and lineage characteristics of glioblastoma stem cells. 2.2 Results Primary Patient Glioma Express Notch Receptors and Ligands Studies have illustrated Notch receptor expression in bulk brain tumors 121 and therefore we initially validated Notch receptor and downstream pathway expression in our primary patient samples. Semi-quantitative PCR of mrna isolated from bulk primary patient tumors shows that glioblastoma express Notch1, Notch2 and Notch3 receptors. Immunohistochemistry in paraffin embedded primary patient tumor samples and scoring for nuclear localization show that all

34 21 tumors express nuclear Notch1 (15/15), 83% (26/31) express nuclear Hes1 protein and 87% (27/31) express Hes5 protein (Figure 2-1).

35 22 Figure 2-1 Notch components are expressed in primary patient tissue. RNA was isolated from unsorted primary tumor tissue. A) Patient 144 and Patient 179 express Notch1, Notch2, Notch3, Jagged1 and Hes1 by semi-quantitative RT-PCR. B,C,D) Representative immunohistochemistry from Patient 309 illustrating nuclear localization (brown) of Notch1, Hes1 and Hes5 in paraffin embedded bulk tumor tissues. Primary patient samples were 4% paraformaldehye fixed and paraffin embedded. Localization of protein expression was resolved with peroxidase staining and counterstained with hematoxylin.

36 Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell Markers. Since we have identified Notch pathway component expression in at least a few bulk tumors, we were then interested to study the pathway in more detail in the cell population, which drives tumor growth. To obtain enriched populations of cancer stem cells from human glioblastoma, we needed to turn to culture systems, particularly those that retain tumorigenic potential in vivo. One of the potential methods to study this population is the neurosphere culture system. While an important tool that has been used since the mid 1990 s, neurosphere culture have limitations. Neurospheres culture conditions do not support the long term growth of tumor cells and tend to lose replating activity after 5 passages, limiting their usefulness for many mechanistic studies. In addition, due in part to the complex three-dimensional aspect of sphere colonies, more differentiated cells are localized to the nutrient deficient and spatially restricted centre while primitive stem-like cells are favored at the nutrient accessible and spatially unrestricted surface of the colony 156. Therefore spheres contain mixed cell populations and cannot be considered as pure cancer stem cell cultures. To circumvent these technical limitations, we cultured freshly dissociated glioblastoma samples on laminin/poly-l-ornithine coated surfaces. The cells, grown in 2D culture, have a much higher degree of morphologic and phenotypic homogeneity, reduced spontaneous cell death and a greater success rate forming cell lines in-vitro with long term passage potential 157. In contrast to neurosphere cultures, NS cultures contain few cells that express markers of differentiation like β-iii-tubulin (βiiit) and express high percentages of primitive markers such as CD133, CD44, CD15 130, Nestin and Sox2 (Table 2-1) (Figure 2-5). GFAP is expressed at low levels, perhaps highlighting its role as both a neural stem cell marker in addition to marking differentiated astrocytes 60. The adherent culture system therefore is an excellent tool to asses the genomic and functional differences that exist between normal neural stem cells and glioblastoma stem cells. Indeed, while the NS system is permissive for homogeneous stem cell cultures each line retains some unique characteristics such as cell morphology, primitive marker expression signature and lineage marker expression upon differentiation. Relative to human fetal neural stem cells, glioblastoma stem cells often have abnormal nuclear morphology and exhibit varied cell morphologies ranging from bipolar (G179NS) to flat (G144NS). Each glioblastoma NS line exhibits a unique profile in flow cytometry reflecting diverse differences in cell size, granularity and surface marker expression

37 24 (Fig 2-5), (Table 2-1). Additionally, each line exhibits fundamentally unique characteristics upon in-vitro differentiation (Supplementary Figure-1), rates of in-vivo tumorigenesis and histologic appearance 157. Since we have a robust and versatile system to expand cancer stem cells, we can characterize glioblastoma stem cells and identify factors that sensitize these cells to pharmacologic intervention and other forms of treatments. Stem Cell Line CD133(%) CD15(%) CD44(%) HF240NS 98.1± ± ±10.8 G144NS 74.8± ± ±16.6 G179NS 65.4± ± ±12.8 GliNS1 94.7± ±22.5 n/a Table 2-1 CD133/CD15/CD44 percentage cell populations in established NS lines. Glioma NS lines are highly enriched for CD133 relative to neurosphere cultures. Mean expression of CD133 from NS lines is 78.3±14.9%, a significant enrichment over 18.3±22.6% found in unmatched neurospheres (n=3). Interestingly, other markers such as CD15 demonstrate marked variability, underscoring the heterogeneity between tumors. n/a = not assayed.

38 25 Figure 2-2 Glioblastoma stem cell lines express stem cell markers and exhibit morphologic heterogeneity. Nestin and Sox2, primitive markers commonly expressed in stem cells, are expressed when cultured with EGF/FGF. Immunofluoresence staining of cells shows filamentous cytoplasmic Nestin and nuclear Sox2. Quantitative FACS demonstrates the variability of CD133 and CD15 expression among cell lines. Scale bar 50μm

39 Tumor Precursor Lines Express Notch Receptors and Ligands Since expression of Notch receptors and ligands in bulk tumor tissue may not be representative of the primitive stem like population, we conducted RT-PCR to assay for receptor and ligand mrna expression. Expression by semi-quantitative PCR showed that both human fetal (HF240NS, HF286NS, HF289NS) and tumor (GliNS1, G166NS, G179NS) lines express Notch1, Notch2 and Notch3 receptors as well as the Jagged1 ligand. The downstream target Hes1 was expressed in all lines. Interestingly, Hes5 was expressed in HF240NS, HF286NS, HF289NS, and G179 but was detected in low abundance in GliNS1 and G166NS. We have demonstrated that Notch components and downstream targets are expressed in glioblastoma NS lines suggesting that the pathway is active and may have a role in regulating CSCs.

40 27 Figure 2-3 Semi-quantitative RT-PCR of Notch components in human fetal stem cell and glioblastoma stem cell lines. All lines express Notch1, Notch2, Notch3, Hes1 and Jagged1. Hes5 is detected in HF240NS, HF286NS, HF289NS and G179NS. Hes5 is expressed in low abundance in GliNS1 and G166NS.

41 Notch receptors are activated in Glioma NS lines We have shown that Notch 1-3 transcripts are expressed in human NS lines. To further delineate the functional relevance of Notch expression in cancer stem cells, we probed receptor expression by immunofluorescence staining of the various glioblastoma stem cell cultures. Of the four mammalian Notch homologues, data from the literature has shown that Notch1 is critical in the maintenance of murine NSCs. Hitoshi and colleagues demonstrated that Notch1-/- murine forebrains were incapable of forming neurospheres and that forced expression of NICD1 was sufficient to rescue NSC self-renewal 73. Therefore, we looked for Notch1 receptor activation and nuclear localization with immunofluorescence microscopy in HF240NS, G144NS and G179NS lines. We first validated our antibodies with EDTA induced constitutive Notch activation 14 and also with ectopic expression of activated Notch1 38 (Figure 2-9) by looking for nuclear localization of activated Notch1. Under proliferative conditions with EGF/FGF, glioblastoma lines demonstrate a high percentage of activated Notch1 positive nuclei (Figure 2-4). Scoring random fields of nuclei double positive for DAPI and NICD1, HF240NS was 89±7%, G144NS was 87±3% and G179NS was 91±8% positive. G144NS, which contains multinucleated cells, demonstrated positive staining in all nuclei. NICD1 negative cells, a minority in these stem cell cultures, were often morphologically indistinguishable from the NICD1 positive cells and occured in low cell density and high cell density areas. Importantly, at lower cell densities, cells would also express NICD despite appearing to lack contacts with adjacent cells, indicating that expression was cell autonomous, at least in part, not dependent on contact with neighbouring cells. Since immunocytochemistry is a snapshot of fixed and permeabilized cells, these observations may suggest that NS cells are capable of cell autonomous self Notch activation. Another possibility is that due to motility, these cells were activated by transient contact with other cells before the fixation.

42 29 Figure 2-4 Nuclear localization of activated Notch1 in human fetal and glioblastoma stem cell lines. Endogenous activated Notch1 can be detected in fixed cultures by immunofluorescence staining. Consistent with the mechanism of Notch activation, the fluorescent signal is localized to the nucleus. Scale bar 100μm.

43 Notch Pathway antagonism decreases cell proliferation. We have shown that NS lines express mrna of Notch components and show nuclear localization of the activated Notch1 receptor. Since Notch has a fundamental role in murine self renewal, we hypothesize that blockade of Notch signals will reduce glioblastoma stem cell self renewal and cell proliferation. Utilizing a pharmacologic inhibitor of Notch, we challenged glioblastoma stem cell lines with an effective γ-secretase inhibitor L-685,458. We previously demonstrated that this compound is more effective than the γsi DAPT 158 in reducing the sphere forming ability of human fetal neurospheres (Supplementary Figure-2). Culture of glioblastoma stem cell lines and a control human fetal neural stem cell line with γsi induced dose dependent reductions in proliferation that could be monitored by the reduction of tetrazolium (MTT) into insoluble formazan crystals by mitochondria in active cells. Averaged together, NS lines exhibited a mean EC50 of 4.6±2.5μM which is over 9-fold lower than that of the cell line U87 (EC50=40.6μM), a serum cultured glioma line documented to have growth regulated independently of Notch signaling 134 (Figure 2-5). Of five NS lines profiled (G144NS, G179NS, GliNS1, G174NS, and G166NS); G174NS was the most sensitive line with an EC50 of 0.9μM. G179NS possessed the highest EC50 of 7.4μM. Since mitochondrial metabolism may not always adequately reflect cell numbers in-vitro, we utilized real-time microscopy to observe the effect of Notch inhibitor in real-time. Consistent with MTT, GliNS1 treated with γsi underwent fewer cell divisions compared with control. Using an Incucyte video microscope (Essen Bioscience), we measured the surface area of the microscope field occupied by cells. Automated tracking software determined that glioblastoma stem cells cultured with vehicle achieved 43% confluence in 16 days. These control cells were highly motile and made contact with adjacent cells over the course of the observation period. The high motility may explain the activity of Notch signaling among cells apparently lacking ligand presenting partners. In contrast, cultures plated at an identical starting density in 6μM or 10μM γsi achieved 25% and 18% confluence respectively in the same period of time. GliNS1 treated with γsi adopted a dramatic change in cell morphology and motility. After 7 days in culture, the cells became less motile and projected bipolar processes. After 14 days, the morphologic changes in the cells were more dramatic, the cells aggregated into adherent spheroid colonies and extended long filamentous processes that resembled the axons of mature

44 31 neurons (Figure 2-6). Thus, the presence of γ-secretase inhibitor definitively reduced cell proliferation and induced morphologic cell changes resembling differentiation. We have demonstrated the efficacy of pharmacologic inhibitors in modulating glioblastoma stem cell proliferation and altering cell morphology. γ-secretase is responsible for processing several cell surface receptor proteins. A few of the characterized targets are Notch, CD44 159, ErbB4 160 and Ryk 161. To investigate the possibility that we were more strongly affecting other γ-secretase dependent cell surface receptors, we used a more specific molecular targeting strategy to block Notch signaling downstream of the γ-secretase stage of the pathway by inhibiting the RBP-jK activation complex. Mastermind-like 1 (MAML) is a crucial co-activator in the binding interaction between NICD and RBP-jK 162,163. We used a dominant negative variant of this protein (a generous gift from Dr. Jon Aster). As a pan-notch inhibitor, Dominant Negative- MAML (DN-MAML) binds activated Notch but is unable to assemble the transcriptional activation unit with RBP-jK. GliNS1 transfected with DN-MAML-GFP and sorted for viable GFP positive cells were cultured in NS conditions to probe the effect of DN-MAML on doubling time and confluence. Tracking transfected cells by Incucyte over a period of 14 days showed a proliferative impairment conferred by Notch blockade (Fig 2-7). GFP sorted vector control cells approached 63% confluence whereas DN-MAML transfected cells reached 23% confluence in the same 16 day observation period. Here, we have shown that pharmacologic antagonists of the γ-secretase complex and downstream dominant-negative pathway specific inhibitors induce a robust blockade of glioblastoma stem cell proliferation in vitro.

45 32 Figure 2-5 Dose response analysis of NS lines cultured for 7 days with γsi. A) Structure of L-685,458, a potent γ-secretase inhibitor which acts as a transition state analogue in the catalytic region of the holoenzyme. B) All cell lines demonstrate sensitivity to low doses of γsi in proliferation assays. Average EC50 for all NS lines is 4.6±2.5μM. The EC50 for U87, a serum derived glioma line that does not possess stem cell characteristics is 40.6μM.

46 33 Figure 2-6 γsi inhibits growth and alters cell morphology of GliNS1 A) GliNS1 was cultured for 18 days with 6μM γsi. Day 18 culture with 6μM γsi illustrates bipolar morphology and axon-like processes. Scale Bar 200μm. B) Proliferation of cells is inferred from combined cell surface area and expressed as a percentage of maximum confluence. 6μM γsi for days impairs growth of GliNS1 by a factor of 0.58.

47 34 Figure 2-7 GliNS1 dominant-negative Mastermind-like1 Notch antagonism prevents cell proliferation. Representative growth curve of DN-MAML-eGFP transiently transfected glioblastoma stem cells that were machine sorted for GFP. DN-MAML transfected GliNS1 cells proliferate slower compared to vector transfected egfp sorted control. Note that the inflections in the curve at 240 and 320 hours are artifacts of growth media replenishment.

48 γ-secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of canonical Notch signal transduction. Since the Notch pathway is active in glioblastoma stem cell cultures (G-NS lines) as demonstrated by nuclear staining of activated Notch1, we blocked pathway activation by targeting the γ-secretase complex critical for receptor activation, and demonstrated reduction in cell proliferation and alteration in cell morphology. In proliferating conditions with EGF/FGF, normal human fetal NS cell lines and glioblastoma NS lines exhibit punctuate nuclear immunoflourescence staining pattern when using antibodies specific for activated Notch1. This staining pattern may be indicative of transcriptionally active sub-nuclear bodies 164. To determine if the reduction in proliferation was due to specific effects on Notch signaling, we conducted experiments using the inhibitors together with rescue of signaling with downstream pathway activation. The number of cells that exhibit this activated Notch1 staining pattern was reduced by 3-fold in HF240NS and G144NS cells cultured in the γsi L-685, for 24hrs (Figure 2-8AB) to 3 weeks (Figure 2-8CD). This reduction in numbers of positive nuclei is restored under conditions which promote ligand independent activation, with transduction of the cells with NICD1 (Figure 2-9). A third cell line, GliNS1, which demonstrates ubiquitous activation of Notch1 in 95±7% of cells was reduced to 35±22% upon 12hr γsi treatment. Transfection of NICD1 restored immunoreactivity in 100% of cell nuclei (Figure 2.9 and Figure 2.10). Canonical Notch pathway components Hes1 and Hes5 were examined by quantitative PCR after treatment with γsi. While all of the cell lines profiled demonstrated significant reductions in Hes5 transcript expression after a 10 day exposure, only some of them demonstrated significant reductions in Hes1 expression (Supplemental Figure-4). Hes1 was undetectable in G174NS, the cell line most sensitive to γsi in proliferation assays and reduced by approximately 50% in G166NS. However, Hes1 expression was not affected by antagonist in G179NS or HF240NS. We examined downstream signaling more closely in GliNS1. Hes5 and Hes1 transcript expression was robustly diminished more than 20-fold and 6-fold respectively when cultured with a 24h exposure to γsi (Figure 2-12A). Further, the proneural downstream target of Hes transcription factors, Ascl1 (Mash1), is increased 4.7-fold with γsi. This finding suggests that

49 36 the canonical Notch-Hes axis that functions to prevent neuronal differentiation is intact at least in some glioblastoma stem cell cultures and may serve a role in maintaining a more proliferative primitive stem cell state. Forced expression of NICD1 in GliNS1 induced a 5-fold increase in Hes5. Surprisingly, ectopic NICD1 did not significantly increase Hes1 beyond exogenous expression (Figure 2-12B). This data may suggest that transcription of Hes genes are regulated independently of each other and that each gene may require a different repertoire of co-activators that, in this context, may function as a limiting reagent for Hes1. It also suggests that Hes5 may be the more critical Notch1 target in glioblastoma stem cell populations. Finally, Hes1 and Hes5 expression is protected by NICD1 when challenged by γsi. Hes1 and Hes5 expression is unaffected by γsi when NICD1 is overexpressed, reinforcing observations that Hes genes are a target of Notch downstream signaling. We have demonstrated immunofluorescence localization of activated Notch in glioblastoma stem cells, but immunoflorescence staining is difficult to quantify. Therefore, we also conducted analysis by western blot. Using two different antibodies specific for the activated Notch1, we demonstrate that signaling is abrogated in a dose dependent manner (G166NS). Consistent with PCR analysis, Hes1 protein persisted in the presence of γsi (Figure 2-11). At the time of this study, reliable antibodies for Hes5 are not available and therefore we are not able to quantify Hes5 protein levels by Western. We continued to recognize that pharmacologic antagonists can have off target effects. To address this issue, GliNS1 was transiently transfected for DN-MAML-GFP and sorted for GFP+ cells two days post transfection. GFP positive cells had a significant 3-fold reduction in Hes1 and a 6-fold reduction in Hes5 by RT-PCR. There was a concurrent 2-fold increase in Ascl1 expression though this observation did not achieve statistical significance (Figure 2-12C). Reduced Hes1 and Hes5 transcript expression was observed in all NS lines assayed with Hes5 being more sensitive to pathway blockade (Supplemental Figure 3). The evidence that we have presented herein suggests that Hes signaling downstream of Notch1 is active in glioblastoma stem cells. Furthermore, we have presented data to show that Hes5 is a more specific indicator of Notch1 signaling in cultured glioblastoma stem cells. Hes5 demonstrates greater upregulation upon Notch1 activation and is more sensitive to Notch blockade compared to Hes1.

50 37 * * Figure 2-8 γsi treated cells have a reduction in nuclear activated Notch1. A) G144NS cultured with γsi for 24hrs (n=3) demonstrates B) over 4-fold reduction in nuclear localization. C) HF240NS (n=2) cultured with 10μM γsi for 3weeks demonstrate D) over 5-fold reduction in nuclear localization. Scale bar 50μm. *t-test, P<0.005.

51 38 * * Figure 2-9 Activated Notch1 nuclear localization can be blocked with γsi and rescued with NICD1 in G144NS glioblastoma line. A&B) γsi robustly blocks intracellular processing and nuclear localization of Notch1 in the tumor line G144NS after 24hrs of treatment. This is rescued with ectopic NICD expression. Scale bar 100μm. C) Activated Notch1 is not detected despite constitutive ligand independent activation with Ca 2+ chelators. Scale bar 20μm. *t-test, P<0.005.

52 39 * Figure 2-10 Activated Notch1 can be blocked with γsi and rescued with NICD. Immunofluorescence staining of GliNS1 illustrates punctuate nuclear staining with vehicle treatment in 95±7% of cells. γsi treatment reduces this pattern of staining to 35±22%. NICD1 over expression protects NICD1 nuclear localization from pharmacologic blockade. Scale bar 100μm. *t-test, P<0.05.

53 40 A B Figure 2-11 Quantitative Western blot of Activated Notch1 in Glioma lines. A) Notch1 activation is potently diminished at low concentrations of γsi in G166NS. B) Activated Notch1 protein can be detected with two different antibodies when cultured in NS media containing EGF/FGF. Blockade of Notch1 with 6μM γsi for 3 weeks in G166NS can be detected with Val1744 specific antibody and Despite γsi treatment, Hes1 protein persists.

54 41 Figure 2-12 Downstream targets of activated Notch signaling are interrupted with Notch antagonism. Quantitative RT-PCR conducted in GliNS1 glioblastoma line. A) Transcription of target helix-loop-helix transcription factors are downregulated upon pharmacologic blockade. B) Blockade can be circumvented by expression of activated Notch1. C) DN-MAML downregulates Hes1 and Hes5 targets. * t-test, P<0.05

55 Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals. We have demonstrated that γsi treated glioblastoma stem cell lines are less proliferative and have reduced Hes5 expression. Of these treated lines, morphological changes with γsi Notch blockade were most pronounced in GliNS1. Upon treatment with γsi, this line is characterized by bipolar morphology and extension of cellular processes. We hypothesized that these cells were no longer showing stem-like properties and were acquiring differentiated characteristics. We examined expression of Sox2 and Nestin, markers of neural precursor cells, in four NS lines treated with vehicle or 6μM γsi for 3 weeks (HF240NS, GliNS1, G166NS, G174NS). We observed in all of the lines a reduction in nuclear Sox2 and cytoplasmic Nestin filaments by immunostaining (Figure 2-13). To demonstrate that these observations were specifically due to blockade of Notch, NICD1 stably transfected GliNS1 (GliNS1-NICD1) was treated with 6μM γsi in culture for 14 days. GliNS1-Vector vehicle control treated cells are uniformly 99% Nestin/Sox2 double positive. Upon γsi administration to GliNS1-Vector transduced cells, the Nestin and Sox2 double positive cell population was abolished (0±1% double positive). Of all the vector transduced cells, 4±4% were Nestin positive only, 18±18% of these cells were Sox2 positive only and the vast majority (76±15%) was double negative for both stem cell markers. GliNS1-NICD1 vehicle control treated cells showed Sox2 and Nestin colocalization in all cells (100±0%). In contrast to vector controls, enforced NICD1 expression maintained coexpression of both Sox2 and Nestin in γsi treated GliNS1 cells. 56±6% of cells examined were doubly positive for both primitive markers demonstrating a rescue of a more primitive stem cell phenotype population (Figure 2-14). Quantitative western blot of γsi cultures demonstrates that NICD1 protects Nestin expression in GliNS1 cells. Thus, the existence of the stem like population in the GliNS1 glioblastoma cells appears to be dependent in part on Notch1 signaling activity. Rapid cell proliferation is often seen as a hallmark of cancer. To determine whether cell proliferation was regulated by Notch, we examined whether NICD1 was capable of rendering glioblastoma stem cells insensitive to the proliferative deficit caused by γsi. Proliferation of G411NS was diminished to 53±12% of vehicle controls when treated with 7.5μM γsi for 5 days. The same cells transfected with NICD1 were insensitive to the effects of γsi (99±11% of vehicle

56 43 control) (Figure 2-15). We have demonstrated that Notch blockade causes glioblastoma stem cells to loose stem cell marker expression. In normal neural stem cells and embryonic development, Notch signals are known to be instructive for glial differentiation at the expense of neurons 7,166,82,81. We postulated that changes in cellular morphology following γsi treatment may be secondary to neuronal lineage differentiation in response to diminished precursor signals.

57 44 Figure 2-13 Nestin and Sox2 protein expression is reduced upon Notch blockade. A) GliNS1, B) HF240NS, C)G166NS, D)G174NS lines have a robust decrease in Nestin and Sox2 protein expression by immunocytochemistry when treated with 6μM γsi. Scale bar 100μm.

58 45 Figure 2-14 Nestin and Sox2 expression in GliNS1 can be rescued with NICD1. A) Representative image of GliNS1 pcdna or NICD transfected cultured for 18 days with 6μM γsi. Nestin and Sox2 expression is retained in GliNS1-NICD1 upon γsi treatment. Scale bar 100μm. B) Quantification of Nestin and Sox2 by cellular localization. C) Quantitative Western blot of GliNS1 stably transfected with NICD and treated with γsi.

59 46 * Figure 2-15 NICD1 protects cell proliferation from γsi. MTT proliferation assay of G411NS supplemented with 7.5μM γsi for 5 days. Proliferation of cells is protected by NICD1. Error bars ± SEM. * p<0.05, t-test.

60 Notch blockade promotes neuronal lineage differentiation To determine whether glioblastoma stem cells are differentiating because of Notch signaling blockade, we studied the expression of astrocytic (GFAP) and neuronal lineage (β-iii-tubulin) markers of differentiation in a human fetal NS line and 9 glioblastoma stem cell lines after 2 weeks of treatment in 5μM γsi compared to vehicle controls. At the end of the culture period, cells were examined for marker expression by immunofluoresence. We quantified expression of lineage markers by sampling random fields and scoring cells as β-iiit positive, GFAP positive or both. Under vehicle control conditions with EGF/FGF, GFAP positive cells are detected in 9/10 stem cell lines. GFAP is protein that marks dual populations: labeling stem cells and also identifying differentiated astrocytes. In 4/10 cell lines, β-iiit positive cells can be detected as a minority population in vehicle treated cultures. The G-NS line with the most numerous cells acquiring spontaneous neural marker expression is 377NS with 26±13% of cells positive with β- IIIT. The relatively low expression of neuronal markers in most G-NS lines demonstrates that EGF and FGF culture conditions maintain a primitive cell phenotype. Supplementing γsi to EGF/FGF growth conditions, the majority (7/10) of cell lines downregulated GFAP after two weeks. 5 of 10 lines demonstrated an increase in β-iii-tubulin immunoreactivity compared to vehicle treated cells (HF240NS, G144NS, GliNS1, G377NS)(Figure 2.17). In the remaining 50%, β-iiit expression was not affected (G166NS, G179NS, G174NS, G361NS, G362NS) (Figure 2.16). In this group of non-neurogenic cells, 3/5 lines downregulated GFAP suggesting that Notch blockade has functional consequencecs on either the GFAP positive primitive cell or impacts the astroglial cell fate choice. Very rarely were cells double positive for neuronal and glial markers in any line. Since Notch is known to be a pro-glial and anti-neuronal stimulus during developmental, we have demonstrated that some glioblastoma stem cells maintain a responsiveness to Notch signals that recapitulates neural development. Since GliNS1 is well characterized 157 and demonstrates the highest induction of neuronal lineage differentiation in response to γsi, this line was chosen for further study. To test our hypothesis that Notch signaling regulates cell fate decisions in brain tumor stem cells, we transduced GliNS1 glioblastoma stem cells with NICD1 (or empty vector) and grew the cells in stem cell conditions with γsi. Consistent with previous results, vector transfected GliNS1 exposed to γsi increased the numbers of cells showing β-iii-tubulin expression by 9-fold (8.5±9.5% vs

61 ±7.6%) compared to vehicle treatment and GFAP expressing cells were reduced (10±7% vs 0±0%). Forced expression of NICD1 in vehicle treated GliNS1 cells induced a 5-fold increase in numbers of GFAP positive cells (10±7% vs 56±22%). Ectopic expression of NICD1 in γsi treated cells increased the numbers of GFAP (27±7% vs 0±0%) cells and suppressed β-iiit (28±13% vs 68±1%) expression compared to vector transfected γsi treated cells, demonstrating that activated Notch is contributes to the maintenance of a primitive GFAP positive phenotype in GliNS1 (Figure 2-18). Since transfected cells may be heterogenous with respect to copy number and transgene expression, some cells may remain sensitive to Notch inhibition. We then demonstrated that the neuronal lineage commitment was specific to Notch signaling using DN-MAML. We transfected glioblastoma lines with DN-MAML-GFP and tracked cell fate for a period of 3 weeks. G144NS and GliNS1, two lines that were observed to exhibit neuronal differentiation with γsi, were transiently transfected. Cells that maintained DN- MAML-GFP expression over the observation period acquired neuronal lineage markers and never expressed GFAP. To contrast these observations, a cell line that did not acquire neuronal markers with γsi (G166NS), was not positive for neuronal markers in DN-MAML-GFP cells (Figure 2-19). We have demonstrated that patterns of neuronal marker expression between different NS lines can be recapitulated with DN-MAML expression, but not all patient derived glioblastoma stem cell cultures show this ability to generate β-iii-tubulin+ cells with Notch signaling blockade. Ultimately, we have demonstrated that blockade of Notch, both at the receptor cleavage and downstream transcriptional activation is effective in reducing GFAP expression in most (7/10) cell lines and significantly increases β-iii-tubulin expression in 50% (5/10) of cell lines. Herein, we will refer to HF240NS, GliNS1, G144NS, G377NS and G362NS as neurogenic reflecting the propensity to express neuronal lineage markers in response to Notch antagonism. We will refer to G166NS, G179NS, G174NS, G361NS and G364NS as non-neurogenic to reflect their resistance to neuronal lineage differentiation in the absence of Notch pathway activation. Differences between tumor responses to Notch blockade raise the question of whether we are inducing more mature neuronal differentiation. Further, can the genetic factors which distinguish neurogenic versus non-neurogenic properties be identified and what are the functional implications of this observation?

62 49 Figure % of stem cell lines do not express markers of neuronal lineage differentiation with pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γsi. Cells were scored as GFAP+, β-iiit+, or double positive by sampling random fields and visually localizing marker expression. Scale bar 100μm.

63 50 Figure % of stem cell lines express markers of neuronal lineage differentiation with pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γsi. Cells were scored as GFAP+, β-iiit+, or double positive by sampling random fields and visually localizing marker expression. Scale bar 100μm.

64 51 Figure 2-18 NICD1 blocks glial marker expression induced by γsi Notch blockade in GliNS1. i) GliNS1 cells have low basal expression of GFAP and β-iiit lineage markers. ii) γsi induces neuronal lineage marker expression in vector transduced cells. iii) NICD1 expression in vehicle treated cultures upregulates GFAP expression. iv) NICD1 transfected cells treated with γsi express both GFAP and β-iiit markers. Quantification by random field cell counting shows that NICD1 renders GliNS1 cells less sensitive to the neurogenic effect of γsi. Scale bar 100μm. Error bars ± SEM.

65 52 Figure 2-19 DN-MAML Notch blockade induces β-iiit expression in neurogenic NS lines. GliNS1 and G144NS neurogenic stem cell lines co-express neuronal lineage markers when transfected with DN-MAML for 21 days. DN-MAML-GFP GliNS1 do not express glial markers. White arrowheads are indicative of DN-MAML/β-IIIT double positive cells. G166NS non-neurogenic line, does not co-express neuronal markers in DN-MAML positive cells. Scale bar 50μm.

66 Neuron like cells are negative for neurotransmitter synthesis genes Functional neurons can be defined as cells expressing neuronal lineage markers 167, neurotransmitters & neurotransmitter receptors 168 and displaying electrophysiological properties 169. We speculated that in-vitro blockade of Notch signals induces functional neuronal lineage differentiation in neoplastic cells. Since β-iii-tubulin is a primitive marker of early differentiated neurons, we investigated whether Notch blockade can induce the expression of the mature neurotransmitter receptors, that identify more mature neuronal subtypes, upon neuronal differentiation 170. Using GliNS1, the NS line with the greatest increase in β-iii-tubulin positive cells induced by γsi, we profiled the expression of receptors from the muscarinic, cholinergic, dopaminergic, glutamatergic and GABA receptor subclasses. After a two week exposure to 6μM GSI, none of the receptors we profiled were increased in their expression. On the contrary, many of the neurotransmitter receptors (6/8) across several different classes had significantly diminished mrna expression (M3, CHRNA9, GARB2, Gria1, Gria4). The change in gene expression was most pronounced in CHRNA9 and Gria1 with an undetectable and 10-fold reduction respectively in gene expression compared to controls. For two receptors, DRD2 and Gria2, gene expression was unchanged (Figure 2-20). It is possible that the differentiated glioblastoma stem cells reflect additional neurotransmitter subclasses that we did not analyse. We also did not exhaustively test for other markers that are associated with differentiated neurons. Another critical point is that a full differentiation may not be possible in neoplastic cells, which have many genetic and epigenetic alterations affecting cell behavior. The results presented here show that neurotransmitter receptors are not expressed in γsi treated cultures. Berninger et al, demonstrated that murine neurospheres differentiated into neurons with growth factor withdrawal and BDNF administration acquired a default GABAergic neuron fate in standard differentiation conditions that was reinforced with expression of Mash How is it then, that our cells do not express these markers? In our experiments, we have differentiated cancer stem cells with γsi over the course of 7-21 days. In the experiments conducted by Berninger and colleagues, they demonstrated that murine neural stem cells only demonstrate functional GABAergic activity in periods between days. Murine NS lines are able to differentiate in 7-12 days 172 versus days required for human NS line differentiation 173. Therefore, considering that murine models often demonstrate faster growth and differentiation

67 54 kinetics, it may be possible that human models of neuronal differentiation may also require longer periods of maturation.

68 55 Figure 2-20 GliNS1 neurogenic line downregulates neurotransmitter receptors upon Notch blockade. A panel of neurotransmitter receptors was examined in neurogenic GliNS1 to evaluate neuronal differentiation. Neurotransmitter receptors are predominantly downregulated when cultured with γsi for 14days. Quantitative RT-PCR normalized to β-actin. Error bars ± SEM. t-test, **P<0.0001, * P<0.05.

69 Hierarchical clustering of signaling pathway genes reveals differential expression of Notch components between tumor lines. We have shown 44% (4/9) of glioblastoma stem cell lines in EGF/FGF respond to Notch blockade by upregulating β-iii-tubulin protein expression and 56% (5/9) downregulate GFAP expression without upregulating of β-iii-tubulin under the same conditions. Since Notch is known to regulate lineage choice in neural stem cells, we examined whether patterns of Notch pathway expression in populations of glioblastoma stem cells may predict the propensity for a particular line to undergo neuronal lineage differentiation and thus reveal clinically relevant glioblastoma subtypes. We conducted an analysis of pathway expression data from human fetal NS lines, glioblastoma NS lines and human adult non-neoplastic cortical resections. Compiling a list of known stemness genes, canonical and non-canonical Notch pathway elements, we conducted complete linkage hierarchical clustering analysis using the program Cluster 174. Dendrogram and heat-map plots (Figure 2-21) demonstrate that signaling pathway components expressed in nine adherent precursor cultures contrast greatly with non-neoplastic adult human cortex (Figure 2-6BC). Human cortical samples originate from resections of fully differentiated tissues. Canonical Notch pathway components often associated with stemness (Notch1 and Hes1) were decreased relative that of NS lines. Cortical samples expressed Notch components associated with terminal differentiation such as Jagged2 and negative regulators of Notch signaling such as Numb and Numblike. The expression of Jagged2 in human cerebral cortex and not precursor cultures is consistent with murine studies showing that the expression of this ligand is restricted to more differentiated areas of the brain 78. To contrast cortical samples, normal and glioblastoma stem cell lines have high relative expression of Notch2, Hes1 and Jagged1; genes associated with stemness. Numb and deltex1, known negative regulators of Notch 175,176,177 are relatively under expressed in both normal and glioblastoma NS lines compared to cortical samples. Notch4, Jagged2, MAML2-3 and HeyL were enriched in cortical samples and indeed, these components are not known to have defined functions in normal or cancer stem cells. Interestingly, hierarchical clustering identifies two distinct sub-groups within NS lines. The first cluster includes all the human fetal lines (HF240NS, HF289NS and HF286NS), GliNS1, GliNS2, and G144NS. This group includes the class of cell lines which we have previously defined as neurogenic based upon the ability to express β-iiit without Notch signals. The second cluster included three glioblastoma lines and consisted of G166NS, G179NS and G174NS. This group

70 57 consisted of cells, which we have previously defined as non-neurogenic based on the inability to express β-iiit. To distinguish the genes that differentiated these two groups, inspection of the heat-map reveals a cluster of genes that were exclusive to neurogenic lines. Notch1, Ascl1 (MASH1) and Dll3 are all highly expressed in neurogenic lines compared to cortical samples and non-neurogenic lines. Consistent with the transcriptome analysis, Ascl1 expression by real-time PCR was highest in GliNS1 with over 24-fold expression compared to G179NS, the NS line that expressed the least amount of Ascl1 (Supplementary Figure-5). One Notch target gene, Hey2, was exclusive to neurogenic tumors only and was relatively under expressed in HF240NS despite clustering with the other neurogenic lines. Interestingly, β-iiit (TUBB3) mrna is highly expressed in neurogenic lines. The relative abundance of this transcript but lack of protein expression with EGF/FGF could indicate that neurogenic lines are primed to differentiate in the appropriate conditions. We have demonstrated that Notch component gene expression in-vitro can classify glioblastoma stem cell lines into two distinct groups. Furthermore, this classification recapitulates the functional classification based on lineage outcome upon Notch antagonism. Therefore, evidence presented here strongly supports the hypothesis that lineage potential of glioblastoma stem cell lines can be predicted via analysis of gene expression. Furthermore, these data raise an important potential therapeutic question. Can we identify a subset of patient derived populations of glioblastoma stem cells that may show the potential to differentiate in response to manipulation of Notch signaling?

71 Non- Neurogenic 58 Non- Neurogenic

72 59 Figure 2-21 Hierarchical complete linkage clustering data of Notch pathway genes from 9 NS lines and 5 samples of non-neoplastic human cortex. A) Differences in gene expression between neurogenic and non-neurogenic NS lines. B) Notch pathway genes, which are elevated in NS lines relative to human cortex. C) Notch pathway genes, which are decreased in NS lines relative to human cortex. Red and Green represent expression data higher and lower compared to the median respectively. Black is median expression.

73 Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency. We demonstrated that neuronal lineage differentiation of glioblastoma stem cell lines in-vitro can be predicted based upon Notch pathway gene expression. To determine whether these neuronlike cells possess reduced in-vivo self renewal or engraftment, we ex-vivo treated GliNS1 glioblastoma stem cells with 10μm γsi or vehicle for a period of 17 days and orthotopically injected treated cells into forebrains of NOD/SCID mice (Figure 2-23A). Single cell suspensions of 100,000 live cells, inspected for viability by trypan blue exclusion, robustly formed tumors in vehicle control treated mice at a median survival of 90 days. Mice injected with ex-vivo treated γsi cells still developed tumors but had a significantly (P=0.029, Logrank test) improved median survival of 115 days, demonstrating that γsi treated cells have increased tumor latency (Figure 2-23B). G166NS, a non-neurogenic line that does not acquire neuronal markers, was treated ex-vivo to determine whether these cell lines are responsive in-vivo in the same manner as the neurogenic lines. After the ex-vivo treatment and in-vivo orthotopic injection, G166NS vehicle treated injected mice had a median survival of 172 days, consistent with differential survival from different patient derived glioblastoma stem cell lines. Mice that were injected with γsi treated cells had a median survival of 215 days. These survival curves are not statistically significant (P=0.34, Logrank Test) (Figure 2.25). Taken together these results indicate that neurogenic lines treated with Notch inhibitors have reduced tumorigenicity or engraftment in-vivo whereas nonneurogenic lines are not significantly affected, although the numbers in these experiments were small. To elucidate the molecular and cellular differences in the tumors that arise in vehicle and γsi treated cells, we fixed and paraffin embedded the xenografted brain samples for analysis by immunohistochemistry. Gross examination of the NOD/SCID brains after sacrifice did not reveal significant phenotypic differences between vehicle and γsi treated tumors. Large frank tumors of approximately equal size in both cohorts were found intracranially, possessed invasive properties, and local areas of necrosis consistent with human glioblastoma. In-vivo BrdU labeling of GliNS1 showed proliferative cells throughout the tumor with no apparent differences between vehicle and ex-vivo γsi treated cells. Tumors arising from treated and untreated NS lines

74 61 harbored foci of GFAP and Nestin positive cells. Some regions within the tumor arising from γsi treated cells expressed β-iiit, suggesting that a prior Notch blockade can specify lineage commitment in the developing tumor. As not all the cells in the ex-vivo treated culture differentiate into β-iiit positive cells, we suspect that tumors may arise from the non differentiated glioblastoma cells in the treated culture, or alternatively, that the differentiation is lost without continued Notch blockade in-vivo. The formation of tumors demonstrates that cells treated with Notch inhibitors maintain in-vivo self renewal and therefore ex-vivo Notch blockade alone is insufficient to completely suppress tumorigenicity.

75 62 Figure 2-21 GliNS1 ex-vivo treated with γsi and transplanted orthotopically. A) Cells were treated exvivo for two weeks and transplanted orthotopically utilizing a sterotactic apparatus. B) Tumor free survival of mice injected with 100,000 γsi treated cells was longer than mice injected with 100,000 Vehicle treated cells. Mean survival 115 days versus 90 days, p<0.026, Logrank Test. C) Both vehicle and γsi treated cells are proliferative by BrdU incorporation and express glial markers throughout the tumor. Tumors arising from γsi treated cells possess tracts of βiiit positive cells indicating lineage specification in the absence of continuous Notch blockade.

76 63 Figure 2-22 G166NS ex-vivo treated with γsi and transplanted orthotopically form tumors in-vivo. Median survival of vehicle control is 172 days versus 215 days for γsi treated. Logrank Test, P>0.05.

77 Gene expression between Responsive and Non-responsive NS tumor lines. We have demonstrated that gene expression of Notch pathway and downstream components in glioblastoma stem cells correlates with sensitivity to γsi induced neuronal differentiation. Since there may be genes outside of the Notch pathway that confer γsi sensitive properties in neurogenic lines, we compared gene expression of neurogenic versus non-neurogenic lines to evaluate which genes, Notch inclusive, may contribute to neuronal lineage commitment in glioblastoma. We conducted an unbiased principle component analysis of global gene expression between the neurogenic group (GliNS1, HF240NS and G144NS) and non-neurogenic group (G166NS, G179NS and G174NS). Using the data analysis program Partek, we identified genes that were differentially expressed between the two groups. The analysis returned 1255 probesets representing 879 unique genes with significant (p<0.05) differences between the two groups. Amongst the most significant hits (Table 2-2), several are relevant to neuronal lineage commitment and survival. Some are genes relating to mature neuronal phenotypes such as NMDA receptor regulated-1 like (NARG1L). Expression of Glutamate Receptors (Grik4, Gria3, Gria4) and γ-aminobutyric Acid A-receptor α-5 (GABRA5), may explain why some lines are predisposed to neuronal differentiation as expression of neurotransmitter receptors may prime cells for neuronal differentiation. Ascl1, a gene studied in our original clustering analysis (Figure 2-22), is highly elevated in neurogenic lines, as is β-iii-tubulin and Sox4, a transcription factor which is required for the survival of sympathetic neurons in the CNS 178. Interestingly, adenomatous polyposis coli (APC), a fundamental component of the Wnt signaling pathway is highly expressed in neurogenic lines. This multidomain protein has a critical function in the regulation of intracellular β-catenin and antagonizes the Wnt signaling pathway 179. Our lab (Brandon et al., unpublished data) and others 180,161, 181,182 have demonstrated that activation of the Wnt pathway is instructive for neuronal lineage differentiation in normal neural stem cells. Therefore, global analysis of gene expression identifies neural lineage transcripts in neurogenic lines that show a capacity to differentiate in response to Notch signaling blockade, but may suggest other potential differentiation strategies.

78 65 F(GSI Gene p-value(gsi Response F(γSI Gene Title Symbol Response) Response) ) Transcribed locus E RNA binding motif protein 47 RBM E periplakin PPL 3.47E secreted protein, acidic, cysteine-rich (osteonectin) SPARC 3.56E asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltran ALG2 6.88E sterile alpha motif domain containing 9-like SAMD9L 8.65E cytochrome b-561 CYB E sterile alpha motif domain containing 9-like SAMD9L 1.05E cytochrome b-561 CYB E M-phase phosphoprotein 8 MPHOSPH 1.61E NMDA receptor regulated 1-like NARG1L 2.96E NMDA receptor regulated 1-like NARG1L 7.97E glutamate-cysteine ligase, modifier subunit GCLM 3.63E glutamate-cysteine ligase, modifier subunit GCLM 7.21E SRY (sex determining region Y)-box 4 SOX4 7.66E tripartite motif-containing 38 TRIM E SRY (sex determining region Y)-box 4 SOX4 6.79E SRY (sex determining region Y)-box 4 SOX4 1.14E SRY (sex determining region Y)-box 4 SOX4 1.71E achaete-scute complex homolog 1 (Drosophila) ASCL1 3.09E SRY (sex determining region Y)-box 4 SOX4 6.25E achaete-scute complex homolog 1 (Drosophila) ASCL1 1.14E bone morphogenetic protein 7 (osteogenic protein 1) BMP7 3.48E vascular endothelial growth factor A VEGFA 3.50E vascular endothelial growth factor A VEGFA 5.67E adenomatous polyposis coli APC 1.39E glutamate receptor, ionotrophic, AMPA 4 GRIA4 1.83E neural cell adhesion molecule 1 NCAM1 1.96E hairy/enhancer-of-split related with YRPW motif 2 HEY2 2.19E NDRG family member 2 NDRG2 2.38E NDRG family member 2 NDRG2 2.39E glutamate receptor, ionotrophic, AMPA 4 GRIA4 3.68E Notch homolog 1, translocation-associated (Drosophila) NOTCH1 4.20E SRY (sex determining region Y)-box 4 SOX4 4.56E CD44 molecule (Indian blood group) CD E tubulin, beta 3 TUBB3 5.97E adenomatous polyposis coli APC 6.13E homeobox D10 HOXD E tubulin, beta 3 TUBB3 6.32E adenomatous polyposis coli APC 6.61E gamma-aminobutyric acid (GABA) A receptor, alpha 5 GABRA5 6.72E tubulin, beta 2A TUBB2A 6.98E transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) TCF3 8.28E deltex 3 homolog (Drosophila) DTX3 8.30E glutamate receptor, ionotropic, kainate 4 GRIK4 1.10E glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.14E glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.82E solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.40E SRY (sex determining region Y)-box 2 SOX2 2.40E solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.51E solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 3.68E Notch homolog 2 (Drosophila) NOTCH2 2.20E

79 66 Table 2-2 List of top 53 probe sets most significantly elevated in neurogenic NS lines compared to non-neurogenic NS lines. Principal component gene analysis between neurogenic and nonneurogenic cell lines reveals 879 genes that are significantly upregulated in neurogenic lines. Genes are organized in order of significance.

80 Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade induced differentiation. Notch signaling is known to regulate CNS development and neuronal differentiation in concert with other pathways 72. Some of these interactions are postulated to function in a regulatory manner outside of a developmental context. Therefore, inhibiting Notch signaling combined with activation of other developmental pathways in glioblastoma stem cells may induce a synergistic response that may render CSC s more sensitive to differentiation and inhibit selfrenewal. Notch and Wnt have collectively been implicated in the progression of intestinal adenomas 183, colon cancer 184 and may crosstalk directly at several points in the signaling pathway 44,43. Existing reports have suggested LiCl inhibition of GSK3β may inhibit cancer stem cell self-renewal in sphere assays 185. Activation of the wingless pathway by administration of exogenous Wnt ligands or pharmacologic inhibition of negative regulators (Brandon, Dirks et al, unpublished data) has been shown to induce a neuronal lineage phenotype with upregulation of downstream Wnt targets. Therefore, we postulated that blockade of Notch in concert with the activation of Wnt may synergistically inhibit in-vivo growth of glioblastoma stem cells compared to modulation of either pathway alone. We constitutively activated canonical Wnt signaling using 6-bromoindirubin-3'-oxime (BIO) 186, a potent inhibitor of GSK-3β. GSK-3β is a kinase which phosphorylates activated β-catenin in the absence of pathway activation to facilitate recognition by ubiquitin ligases and targeting by the proteosome 51 (Figure 1-3). Using BIO and γsi, we conducted a two-dimensional dose response analysis and assayed GliNS1 for neuronal (β-iiit) or glial (GFAP) differentiation (Fig 2-26). After one week in culture, we observed that γsi induced a dose dependent (0-10μM) bipolar morphology and β-iiit expression with a corresponding decrease of GFAP expression. Similar dose dependent (0-1μM) observations were observed with BIO treatment. Combinations of γsi and BIO induced significant morphologic changes and increased β-iii-tubulin expression beyond levels of individual treatments. 1μM γsi and 1μM BIO had the largest qualitative induction of neuronal morphology and marker expression with a concurrent repression of astrocytic marker expression. Therefore, we utilized these concentrations for further characterization of NS lines. To examine whether synergistic treatment would promote neurogenesis in non-neurogenic lines, we treated G166NS with a combination of γsi and BIO. The individual compounds and

81 68 combination treatment were effective in reducing GFAP protein expression but did not increase expression of neuronal markers upon 1μM BIO and/or 1μM γsi treatment (Figure 2-27). This demonstrates that despite synergistic activation of Wingless and inactivation of Notch, nonneurogenic lines remain resistant to neuronal lineage differentiation.

82 69 Figure 2-23 γsi and BIO synergistically induce neuronal lineage differentiation in GliNS1. GliNS1 was cultured for 7 days with doses of γsi, BIO or a combination of the two compounds. Immunocytochemistry was conducted to visualize protein expression of neuronal and glial marker expression. Scale bar 100μm.

83 70 Figure 2-24 Non-neurogenic line remains neuronal marker negative with Wnt activation and Notch blockade. G166NS cultured for one week with 1μM BIO and/or 1μM GSI downregulate astrocytic markers but do not upregulate neuronal lineage markers. Scale bar 100μm.

84 Neuronal precursors treated with γsi and BIO are less proliferative. Since neuronal lineage marker expression is prevalent in neurogenic lines treated with combinations of γsi and BIO, we hypothesized that using dual pathway modulation to force cancer stem cells into a growth restricted neuronal lineage may be a more viable strategy to treat glioblastomas in patients. We therefore treated GliNS1 with 1μM γsi and/or 1μM BIO for 1-2 weeks and pulsed with BrdU 24hrs immediately prior to analysis to monitor cells progressing through S phase. At one week, 46±21% of all cells in BIO/γSI combination treatment expressed β-iii-tubulin. This was significantly greater than that of individual 1μM GSI (10±5%) and 1μM BIO (22±10%) treatments alone. A low percentage of vehicle treated cells were β-iii-t positive (5±2%), reflecting the low levels of spontaneous differentiation inherent to the assay (Figure 2-28). Continued treatment for two weeks increased neuronal marker expression, growth of bipolar processes and a reduction of numbers of GFAP positive cells (Figure 2-29). 52±25% of all cells expressed neuronal marker expression in combination treatment versus 1μM GSI (7±6%), 1μM BIO (14±2%) and vehicle treatment (2±1%). The effect of the combination treatment is greater than the sum of the individual compounds, suggesting that Notch signaling inhibition, together with activation of Wnt signaling, synergistically promotes neuronal lineage differentiation. The level of BrdU incorporation in cells positive for neuronal markers is much lower than that of marker negative cells. At one week of γsi/bio combination treatment, 63±14% of all β-iiit positive cells are BrdU negative. At 2 weeks of treatment, 86±4% of β-iii-tubulin positive cells are BrdU negative and only 7±2% of total cells were double positive. Thus neuronal precursors expressing neuronal markers have significantly impaired ability to proliferate, which becomes more pronounced with prolonged Notch/Wnt blockade. This supports the notion that cells with committed neuronal character are more limited in proliferative potential. Additionally, we examined expression of glial markers and BrdU incorporation with γsi and/or BIO. At one week, most of the GFAP positive cells are also BrdU positive, suggesting that cells at this stage are proliferating glial precursors. This population of cells is unaffected by 1μM γsi or 1μM BIO but is dramatically reduced to 0±1% when treated with a combination of the two compounds. At two weeks, individual treatments of γsi and BIO effectively reduce the small

85 72 percentage (5±1%) of doubly positive GFAP/BrdU cells found in vehicle treated controls to levels similar to that of combination treatment (Figure 2-29). Thus, combining the two drugs synergistically diminishes the time required to force neuronal lineage differentiation. Taken together we conclude that neuronal lineage differentiation may contribute to a proliferative disadvantage found in neurogenic cell lines. An anti-proliferative effect of Notch/Wnt modulators is observed in neurogenic lines is likely due to a growth restriction imposed by cell type to and not due to non-specific toxicity, the proliferative disadvantage conferred to non-neurogenic cell lines is less well understood. While there is a possibility that the non-neurogenic lines are restricted due to non-specific toxicity, it is more likely that Notch antagonists inhibit the proliferation of the glioblastoma stem cells but cannot also engage them in differentiation as they are hypothesized to have a molecular defect in differentiation.

86 73 Figure 2-25 Cells possessing neuronal characteristics are less proliferative. GliNS1 cultured with 1μM γsi, 1μM BIO or both for 1 or 2 weeks and pulsed with BrdU for 24hrs prior to fixation and immunofluorescence stain. Quantification was conducted by nuclear localization.

87 74 A B Figure 2-26 BrdU positive glial precursors are reduced by combined γsi and BIO treatment. GliNS1 glioblastoma line was cultured with 1μM γsi or 1μM BIO and pulsed with BrdU for 24hrs. A) At one week, most GFAP positive cells are BrdU positive and are eliminated with treated with γsi and BIO. B) GFAP positive cells are reduced after two weeks of treatment.

88 Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth. We demonstrated that Notch and Wnt blockade synergistically induce neuronal lineage differentiation, associated with lineage specific reduction in proliferation, therefore we tested whether these cells have impaired engraftment or proliferation in-vivo. GliNS1 was treated exvivo with vehicle, 1μM γsi, 1μM BIO or a combination of the two drugs for 1 week. We then orthotopically injected viable cells into the brains of NOD/SCID mice. The median survival of mice injected with vehicle treated cells in this experiment was 74 days, consistent with previous. Treatment of cells with 1μM GSI had no difference in survival, as animal survived a median 68 days. Since we previously demonstrated an improvement in host survival when the cells were treated with 10μm γsi, this data illustrates that a threshold concentration is required to abrogate tumorigenicity. 1μM BIO treated GliNS cells engrafted had a median survival to 116 days. In contrast, combination treatment with 1μM BIO and 1μM GSI synergistically and substantially improved median survival to 182 days (P<0.05, Logrank Test), an improvement of over 2-fold compared to vehicle treated cells (Figure 2-30A). While GFAP marker expression is diminished, non-neurogenic lines do not acquire markers of neuronal lineage commitment with synergistic Notch and Wnt modulation (Figure 2-27). Nevertheless, we questioned whether synergistic treatment was sufficient to block in-vivo engraftment and growth a representative glioblastoma cell line from this class of tumors. G166NS vehicle treated cells injected into NOD/SCID mice had a median survival of 97 days. 1μM γsi and 1μM BIO alone treated cells had a median survival of 66.5 and 89 days respectively. Treatment of cells with both compounds and orthotopic injection resulted in a significant (P<0.05, Logrank Test) 1.3-fold increase in median survival to 127 days (Figure 2-30B). Comparison of frank tumors in H&E stained paraffin embedded sections shows large intracranial tumors with brain invasion. Immunostaining of GliNS1-vehicle tumors showed GFAP and β- III-Tubulin positive cells demonstrating at least some spontaneous differentiation in-situ, potentially in response to the endogenous neurogenic and gliogenic factors that exist in the brain milieu. Some GFAP and β-iii-tubulin staining was observed in GliNS1-BIO and GliNS1-γSI cohorts. Interestingly, and importantly, tumors arising from GliNS1-BIO-γSI combination

89 76 treatment possessed large areas of β-iii-tubulin staining suggesting persistent neuronal differentiation after engraftment. We hypothesize that the more synergistic differentiation may have lead to the increased survival of the dual modified cells. In addition, G166NS was also stained for markers of differentiation. Consistent with results observed in-vitro, tumors arising from these cells possessed very little β-iii-tubulin immunoreactivity regardless of ex-vivo Notch or Wnt modulation. Thus, the biases in lineage fates resulting from pathway modulation in-vitro with dual pathway modification are preserved in-vivo in the absence of continued pharmacologic modulation. Dual modification may more firmly lock cells into a differentiated sate that is maintained cell autonomously after engraftment. We have shown that a Notch antagonist and a Wnt agonist synergistically improve survival by delaying tumor growth from both neurogenic and non-neurogenic glioblastoma groups. The synergistic effect of γsi and BIO is greater in neurogenic tumors (2-fold) compared to nonneurogenic tumors (1.3-fold), we hypothesize that this reflects the more limited proliferative potential of glioblastoma cells that are directed into the neural lineage.

90 77 * * Figure 2-27 Notch antagonists and Wnt agonists synergistically improve survival of mice injected with ex-vivo treated cell lines. A) GliNS1 neurogenic line cultured ex-vivo with 1μM γsi and/or 1μM BIO for 1 week. Combination treatment significantly improves survival. Asymptomatic animals were sacrificed after 270 days. p<0.05, Logrank Test. B) γsi and BIO synergistically improve survival with G166NS. P<0.05, Logrank Test.

91 78 Figure 2-28 GliNS1 glioblastoma NS lines treated ex-vivo with γsi, BIO or combination. Treatment of tumor lines ex-vivo increases host survival. Examining the expression of lineage markers by immunofluoresence shows an increase in neuronal marker expression in combined BIO+γSI treated cells. Star marks the site of the frank tumor.

92 79 Figure 2-29 G166NS glioblastoma NS line treated ex-vivo with γsi, BIO or combination. Treatment of tumor lines ex-vivo increases host survival but does not affect gross morphology of tumors. Non-neurogenic lines do not express neuronal lineage markers with γsi and BIO combination treatment. Star marks the site of the frank tumor.

93 Discussion Glioblastomas are a highly malignant and phenotypically diverse class of tumors demonstrating remarkable heterogeneity from patient to patient. Despite a growing appreciation for the complex genomic and molecular variability encapsulating this disease, there have been very few successful clinical treatments. Insight from cancer breakthroughs, such as the use of Imatinib for CML 187, 188 and Trastuzumab in breast cancer 189,190, illustrated that inhibition of the key tumor pathway drivers can significantly improve the outcome of patients. In this study, we antagonized the Notch signaling pathway, inducing neuronal lineage commitment and reducing tumorigenicity of a cancer initiating population. Furthermore, based upon expression of Notch and downstream components, we have identified patterns of gene expression in glioblastoma stem cells that identify subsets of glioblastoma that are more sensitive to neuronal lineage commitment. These findings provide potential valuable insight in identifying novel differentiation strategies for glioblastoma stem cells based on analysis of molecular and pathway specific predictors of differentiation The Notch-Hes Axis as a Therapeutic Target Our lab recently demonstrated that primary patient glioblastoma samples can be expanded in serum free conditions on a laminin coated surface as an adherent monolayer 157, a technique which greatly facilitates molecular characterization and functional analysis. We manipulated the Notch pathway using pharmacologic and genetic strategies with the goal of elucidating the components required to maintain stemness. Our study of downstream Notch targets showed that we could relieve repression of downstream proneural transcription factors using pharmacologic antagonists of γ-secretase. Of the multiple downstream targets, our data show that one of the key factors in regulating lineage fate in CSCs is Hes5 and not Hes1. Hes5 expression is diminished in all lines upon treatment with γsi (5/5), demonstrating an exquisite sensitivity to Notch receptor activity. In contrast, Hes1 is much less responsive with only 60% (3/5) of lines significantly downregulating Hes1 after γsi treatment. Further, Hes5 is more sensitive to ectopic Notch activation with NICD1 expression than Hes1. The current understanding of bhlh factors is not completely understood and remains controversial. Of the multitude of Hes transcription factors, Hes1 and Hes5 have traditionally been viewed as the major downstream targets of Notch in murine and human neural stem cells 74,191. Owing to partial functional redundancy in the

94 81 context of murine cortical development 191, the precise roles for Hes1 and Hes5 has been unclear. The prevailing paradigm has been that the Notch-Hes1 axis is critical in neurosphere self renewal whereas Hes5 is a dispensible component 82,192. In contrast, a seminal study illustrated that ES cells and ES sphere colonies derived from RBP-jK-/- mice fail to express Hes5 transcripts but retain Hes1 expression 73 indicating a Notch independent regulatory mechanism. Furthermore, Notch1-/- and RBP-jK-/- E9.0 murine embryos retain expression of Hes1 and Hes3, but not Hes Taken together, these studies suggest that Hes5, and not Hes1, is directly regulated by Notch. In support of this, there evidence that some canonical Notch targets are regulated independently of the NICD/RBP-jK activation complex. In a study conducted with serum cell lines, hedgehog signaling can directly regulate Hes1 independent of Notch receptor activation in C3H/10T1/2 mesodermal and MNS70 neural cells 129. In the context of murine postnatal retinal progenitor cells, activation of hedgehog signaling is a stronger stimulus than activated Notch for Hes1 expression and occurs independently of RBP-jK 194. This suggests that Hes1 may not be an exclusive Notch target as previously thought. Our study has demonstrated that Hes5 is more sensitive than Hes1 to Notch blockade and over expression. Therefore, in the cancer stem cell, Hes5 appears to be regulated by Notch directly whereas Hes1 may be regulated by alternate pathways and/or Notch. Obviously further deliniation of the relative importance of Hes1 and Hes5 in glioblastoma stem cells requires further functional analysis of these cells with additional gain and loss of function experiments. The persistance of Hes1 expression despite Notch blockade reveals a fascinating possibility into the potential mechanism of glioblastoma disease recurrence. A seminal study reported that Hes1 maintains the reversibility of cellular quiescence in human fibroblasts and rhabdomyosarcoma by blocking the effect of Cyclin Dependent Kinase inhibitor p21 Cip1 and inducing expression of TLE In a developmental context, this protective function would intuitively prevent stem and progenitor cells from undergoing premature quiescence, ensuring that developmental and homeostatic programs are retained. Likewise, maintenance of Hes1 expression in cancers would confer a significant survival advantage. Inducing cellular quiescence and terminal differentiation in cancer is a highly sought after goal for the purposes of treating disease. Our observation that glioblastoma NS lines retain Notch-independent Hes1 expression illustrates how a normal protective mechanism may be co-opted by aberrant cancer programming. Indeed, we have observed that glioblastoma stem cells can be differentiated into less proliferative (potentially

95 82 more quiescent) neuronal cells in-vitro, yet retain the capacity to generate tumors upon in-vivo orthotopic transplantation when isolated from the effects of γsi. This could reflect a state of reversible quiescence or reversible differentiation of glioblastoma stem cells, and could have important implications for guiding anti-notch directed therapies (or differentiation therapy strategies in general) and suggests that maximal therapeutic benefit of these types of therapies may require active maintenance of differentiation signals to the cancer stem cells. Small molecule inhibitors 196 and anti-notch receptor antibodies 197 are just some pharmacologics that are currently being developed and tested. However, it may be crucial to also target the pathways which crosstalk with Hes1 in order to minimize the likelihood of disease recurrence. We have shown that the wingless pathway is a candidate pathway for combinatorial modulation. Recently, Schreck et al., demonstrated that Hes1 negatively regulates hedgehog by directly binding the Gli1 gene in a glioblastoma neurosphere model. Interestingly, blockade of Notch with γsi resulted in a corresponding increase in Gli1 activity as a result of diminished Hes1 expression 198. The result was a compensatory upregulation of Shh activity and was postulated to protect cancer cells from death. From this preliminary study, combining Notch and Shh inhibitors was more effective at reducing cell proliferation than individual inhibitors. Ultimately, simultaneous targeting of multiple signaling pathways implicated in tumorigenesis is likely to be more efficacious in a clinical setting Modulating Canonical and Non-Canonical Elements of the Notch pathway In our study we compared canonical and non-canonical pathway gene expression in glioblastoma stem cell lines, fetal NS lines and cerebral cortex. We discovered that Notch2, Hes1 and Jagged1 expression is relatively increased in normal or tumor stem cells compared to human cortex. Intriguingly, we uncovered patterns of gene expression which may be predictive of the differentiation potential for glioblastoma stem cells. Glioblastomas that acquire neuronal phenotypes in response to Notch blockade have patterns of gene expression similar to human fetal neural stem cell lines. Importantly, this sensitive group of gliomas can be distinguished from insensitive gliomas by high relative expression of Ascl1 and Dll3. Ascl1, a transcription factor whose expression is repressed by the Notch target Hes1/Hes5 199,115, is crucial for reprogramming fibroblasts to functional neurons 200 and is critical in neuronal differentiation and patterning 200. Paradoxically, we have shown that Ascl1 is expressed in some EGF/FGF cultured

96 83 NS lines, conditions which promote self-renewal and inhibit differentiation. Rectifying this apparent contradiction, Castro et al., recently reported that Ascl1 has direct functions in all stages of neurogenesis. In addition to regulating genes associated with Notch signaling, cell fate specification, neuronal differentiation and neurite morphogenesis, Ascl1 was found to control genes regulating cell proliferation 201. The authors show that Ascl1 can bind the promoters of up to 603 genes responsible of reactivating cell cycle. Transfection of dominant negative-ascl1 into neural stem cells resulted in impaired S-phase progression. Interestingly, the authors discovered that the Ascl1 promoter binding sequence (GTGGGAC) very closely matched that of the CBF1/NICD co-activator sequence (GTGGGAA). They proposed a model whereby Ascl1 functions to co-activate cell cycle progression genes when Notch is active, but is displaced by CBF1/co-repressor complex when Notch is inactive. Therefore, in our neurogenic lines, CBF1/NICD and Ascl1 may function together to promote cell cycle progression/self-renewal when Notch is active. Notch blockade therefore promotes the transcription of genes relating to neuronal lineage commitment and maturation. We wondered whether other transcription factors downstream of Notch contributed to the prevalence of neurons and relative paucity of astrocytes upon Notch blockade. In our principal component analysis of neurogenic versus non-neurogenic NS lines, we identified high expression of Sox4 in neurogenic lines relative to human cortex and non-neurogenic lines. There is evidence to support the role of this Sry-related HMG-box gene in neuronal commitment and CNS development. In mouse models of development, over expression of Sox4 under the GFAP promoter supports normal differentiation of neurons, but induces massive cerebellar defects due to the developmental failure of Bergman glia 202. In this mouse model, apoptosis occurred extensively in astrocytes. Expression of Sox4 in neurogenic glioblastoma stem cell lines may conceivably diminish the population of astrocytes when exposed to the neurogenic environment of γsi treatments. Thus, considering the importance of this transcription factor in a developmental context, it may serve an important function in neuronal lineage programming in cancer stem cells, and would likely benefit from further detailed study. In this study, we directly modulated the activity of Notch receptors using pharmacologic inhibitors. While our study was being conducted, other groups have demonstrated that the activity of Notch signaling can be modulated by affecting genes responsible for receptor transcription and post-translational processing. Ying and colleagues demonstrated that the

97 84 retinoic acid induced differentiation of glioblastoma neurospheres was dependant on expression of Krüppel-Like Family 9 (KLF9) transcription factor. KLF9 exerts negative regulatory effect by direct binding to basic transcription element (BTE) sequences found in the Notch1 promoter. Underexpressed in glioblastoma intiating cells, ectopic expression induces differentiation and was sufficient to reduce tumorigenicity in mouse transplant models 203. Identifying novel pharmacologic and genetic mechanisms to perturb Notch signaling will of great importance for efficiently and terminally antagonizing pathway activity in cancer cells Functional Synergism in BTSCs. To determine whether Notch targeted therapies could be effective in patients we conducted a proof of concept study using ex-vivo orthotopic models. Mice transplanted with γsi-induced differentiated neurogenic lines significantly improved survival over transplants with untreated cells. Non-neurogenic tumor lines treated the same way did not demonstrate an improvement in host survival, but we acknowledge that numbers of animals tested and numbers of cell lines tested are small to make the most concrete conclusions. Additionally, we activated the wingless pathway using pharmacologic inhibitors of GSK-3β in conjunction with Notch blockade and induced robust neuronal lineage differentiation in neurogenic lines. This combination improved tumor-free survival of mice transplanted with neurogenic tumor cells. Remarkably, despite the lack of neuronal differentiation, BIO and γsi combination treatment of non-neurogenic glioblastoma lines was also effective in significantly prolonging the survival of mice in orthotopic transplant. It may be possible that BIO and γsi promote the development of a neuronal marker negative tumor transient amplifying cell. In the study conducted by Dieter and colleagues, they demonstrated that colon cancer initiating cells could be subdivided into three fractions: long term tumor initating cells, transient amplifying cells, and delayed contributing cells. Of these fractions, transient amplifying tumor cells were only capable of forming tumors in primary animals. Furthermore, transient amplifying tumor cells were much less likely to metastasize within the murine host 204. In our study, we demonstrated that mice injected with BIO and γsi treated cells had improved survival compared to injections with untreated or single treated cells. However, did not test the serial propagation ability of these tumors. Furthermore, since CNS tumors do not metastasize to distant sites outside the CNS, we are unable to assess the migratory abilities of putative glioblastoma transient amplifying cells in-

98 85 vivo. Ultimately, combination treatment may diminish tumorigenicity of non-neurogenic lines by promoting a transient amplifying cell fate possessing limited self-renewal capabilities. We demonstrated Wnt pathway activation synergizes with Notch inhibition to activate neuronal genes and upregulate markers of lineage commitment. How do our results fit into the currently established mechanisms of crosstalk? Evidence from the literature illustrates both direct and indirect interactions between the two pathways. Indirectly, some elements of the Notch pathway are targets of downstream activated Wnt signaling. For instance, the Jagged1 promoter is a known target of the canonical β-catenin activation complex 205,184. Katoh and Katoh demonstrated that β-catenin can activate Notch signaling by upregulating transcription of Jagged1. Direct protein-protein interactions can occur between Wnt-Notch and may modulate activity of both pathways. Activated β-catenin can bind to the intracellular domain of activated Notch and functions to prolong the half-life of NICD in-vitro 206,43. In murine e14.5 neural stem cell models, β-catenin together with NICD1, participates in the activation of Hes genes to suppress neuronal differentiation 206. Confusingly, studies also demonstrate that negative regulators of Wnt can potentiate Notch signaling. Paradoxically, the kinase responsible for marking β-catenin for degradation, GSK-3β, also has the ability to directly phosphorylate Notch1 207 and Notch2 208, promoting nuclear localization and activation of downstream Hes targets. Our data show that blocking GSK-3β in BTSCs can be a potent differentiating signal and may support a model that GSK-3β is a phosphorylase that potentiates nuclear localization of activated Notch (Figure 2-30). This context suggests that β-catenin is not required to regulate proliferation. Also, induction of differentiation via BIO/γSI synergy may be independent of activated β-catenin protein. To test this hypothesis, experiments confirming the physical interaction between NICD and GSK-3β, and experiments demonstrating the effect of β-catenin over expression in G-NS cells are required. The recipricol activity of these pathways is not without precedent, as this putative model may have implications in memory consolidation in Wistar rats. Conboy and colleagues demonstrated that Notch signaling in the adult rat hippocampus was downregulated 12 hours following a passive avoidance training stimulus consisting of a delinated area of a cage which administered an electric shock 209. If the Notch receptor was activated ectopically in-vivo after the animals completed the training period, the rats failed to condition to the shock stimulus. Interestingly, diminished Notch activity was associated with increased Wnt activity measured by GSK-3β phosphorylation and accumulation of

99 86 activated-β-catenin. The authors hypothesized that in order for proper learned conditioning to occur, downregulation of Notch was required to allow for neuronal differentiation and neurite outgrowth. Thus, while learning and memory are poorly understood processes, the findings in this thesis indicate that physiological mechanisms governing memory may be conserved in glioblastoma stem cells. Ultimately, our data support the hypothesis that the functional synergy observed with BIO and γsi is due to recipricol Notch and Wnt pathway activation. Herein, we have implicated a role for Wnt pathway by identifying upregulation of APC in neurogenic tumors. We showed that activation of Wnt signaling and simultaneous blockade of Notch promotes glioblastoma stem cell differentiation. The Wnt pathway is known to contribute to a number of congenital cancer syndromes, most notably Familial Adenomatous Polyposis (FAP). Inheritance of germline inactivating mutations within the APC gene induces growth of numerous (hundreds to thousands) colorectal tumors manifesting as polyps in the second or third decade of life 210. This condition requires aggressive surgical treatment. FAP can also contribute to a spectrum of CNS tumors. Referred to as Turcot s Syndrome, these patients were found to commonly develop medulloblastoma and, less frequently, glioblastoma. While this clinical condition appears to contradict our findings that Wnt activation may diminish tumor growth, a study that characterized glioblastoma of Turcot s Syndrome revealed atypical molecular features including more defects in mismatch repair and markedly improved outcome compared to classical glioblastoma 211. We did not conduct a full genotype analysis on all the glioblastoma stem cell lines in this study and therefore FAP carrier status is unknown. While tumor response to Wnt activation was variable, all of the lines studied showed diminished proliferation suggesting that Wnt activation was not a proliferative simulus. Whether BIO treatment has the same effect on CNS tumors of FAP origin is yet to be studied. Thus, synergistic inhibition of Notch and activation of Wnt will be a useful strategy in some, but maybe not all brain tumors.

100 87 Figure 2-30 Putative Mechanism of Notch-Wnt Synergy. GSK-3β antagonists combined with γsi induces neuronal lineage differentiation in neurogenic BTSCs. This interaction could putatively occur through a positive feedback mechanism where GSK-3β interacts with the activated domain of Notch.

101 Clinical Implications The identification of the factors which distinguish neurogenic and non-neurogenic tumors in this study may be clinically useful for identifying patients which may respond to therapies directed against the Notch signaling pathway. Philips et al 212, demonstrated that bulk tumors could be grouped into three subclasses: proneural, proliferative and mesenchymal with markers from the Akt and Notch pathway distinguishing Mesenchymal and Proneural groups respectively. The proneural class included gliomas ranging from Grade II to Grade IV and tended to consist of patients younger in age compared to the proliferative and mesenchymal groups (~40 y/o vs ~50 y/o). Verhaak and The Cancer Genome Atlas Research Network 213 uncovered similar findings with respect to glioblastoma subtypes. In their study, molecular genetic classification identified four distinct glasses of glioma: classical, proneural, neural and mesenchymal. Of the proneural class, they identified Notch, Ascl1 and Sox genes being highly expressed compared to other bulk glioma. Our work has demonstrated that cancer stem cells can be prospectively organized based upon a genetic signature and that the two groups possess functional differences in signaling pathway dependency that can be exploited with γsi. Interestingly, Verhaak et al. showed that there were significant differences between clinical subtypes and response to aggressive chemotherapy regimens. Patients with Grade IV glioma can be treated with standard chemotherapy or aggressive chemotherapy. Aggressive strategies comprise of multiple rounds of high dose chemotherapy plus concurrent radiotherapy and have been shown to improve gross patient survival. However, when grouped according to the genetic profile of their glioma, patients with proneural GBMs do not possess any improvement in mortality when compared to traditional chemo/radiotherapy regimens. Therefore, our work may suggest a treatment modality in this subclass of GBMs. γsi s may be a strategy to improve the survival of patients with the proneural class of glioblastoma. Therapeutically, functional synergy could minimize adverse drug reactions. Indeed, γsi at high doses has been documented to induce severe gastric toxicity, the effects of which may be mitigated by some combinations of adjuvant therapy with the corticosteroid dexamethasone 214. Similarly, while BIO has not yet been approved for the use in human patients, Wnt activation through Lithium Chloride (LiCl) is an approved clinical treatment for neurological/psychiatric disorders and thus effectively passes the blood brain barrier and functions in the CNS 215. Lower

102 89 doses of combined drugs which have the same effect as high doses would be effective at minimizing cost, reducing toxic burden, maximizing therapeutic value and ultimately preserving patient compliance. Historically, this differentiation therapy has been successfully applied in the treatment acute promyelocytic leukemia (APL). All-trans retinoic acid (ATRA) administered to patients with APL induced differentiation to mature granulocytes and effected a complete remission in a high percentage of patients 216. There is evidence in-vitro to demonstrate that this approach may be viable in human glioma 217. Furthermore, novel methods of targeting the Notch axis have been or are currently under development. Perhaps like herceptin 218, a developing strategy is the use of antagonistic monoclonal antibodies specific for individual Notch receptors 197,197. Understandably, there is concern that targeting a signaling pathway integral to normal stem cell homeostasis may cause undesirable side effects. Studies in rats have shown that administration of γsi via intracranial osmotic pumps improves the performance of test subjects in water maze challenges 219, perhaps reflecting increases in functional neurogenesis as a result of Notch blockade. However, extrapolation to human subjects should be done with caution as long term memory or cognitive deficit in these laboratory animals have not been explored. Further, NSCs are known to mobilize to sites of brain injury and ischemic damage. It is unknown how plasticity and CNS repair would cope in an environment a depleted of a neural stem cell pool 220. Therefore, uncertainty regarding effects on memory and impaired response to brain ischemia must be considered in a clinical setting. Our findings have clear clinical implications. We have prospectively identified characteristics which predict responsiveness to Notch antagonists. Further development and characterization of the hits revealed in this study may lead to clinical applications where patient glioma samples may be screened for Notch1, Ascl1 or Sox4 expression in advance of prescribing a chemotherapeutic regimen. Information gleaned from patient screens may thus lead to the use of γ-secretase inhibitors and Wnt agonists to induce neuronal lineage differentiation in susceptible glioma.

103 90 Supplemental Figure 1 Growth factor withdrawal of NS lines induces multipotent differentiation.. A) HF240NS human fetal neural stem cells, B) GliNS1 glioblastoma line, C) G144NS glioblastoma line, D) G166NS glioblastoma line, E) G174NS glioblastoma line, F) G179NS glioblastoma line. Two-stage growth factor ithdrawal protocol administered over a period of days. Green channel is GFAP. Red channel is β-iiit. Scale bar 50μm.

104 91 Neurospheres/Well Supplemental Figure 2 Dose response analysis of the γ-secretase inhibitor L-685,458 and DAPT in human fetal neurosphere forming assay. Human fetal 6787 was plated at a clonal density of 2000 cells per well with EGF/FGF and cultured for one week with either vehicle, L-685,458 or DAPT. Neurospheres were scored based on a minimum 50um diameter.

105 92 Supplemental Figure 3 DN-MAML Notch antagonism reduces expression of downstream Notch targets. G144NS, a neurogenic group NS line is responsive to DN-MAML Notch blockade. G174NS, a nonneurogenic NS line is also responsive to DN-MAML Notch blockade. Both lines transiently transfected and assayed for gene expression 3 days post transfection. *P<0.05

106 93 Supplemental Figure 4 Downstream bhlh expression in Glioma NS lines and Human Fetal NS after 6uM γsi treatment. A)HF240NS, B)G166NS, C) G179NS, and D) G174NS treated with 6μM γsi for 10 days have significantly reduced Hes5 expression. Hes1 is not significantly down regulated in A) HF240NS or C)G179NS lines with pharmacologic Notch blockade. * P<0.05

107 94 Supplemental Figure 5 Ascl1 transcripts are differentially expressed between NS lines. Quantitative reverse-transcriptase PCR analysis of Ascl1 transcripts from NS lines cultured in EGF/FGF. GliNS1 and G144NS neurogenic NS lines express higher levels of Ascl1 transcript relative to G166NS and G179NS non-neurogenic lines.

108 95 Materials and Methods Primary Patient Samples. Samples were obtained with approval from ethics committee and appropriate patient consent. Incoming tumor tissue was partitioned for immunohistochemistry, tissue culture and frozen for archival purposes. Tumor tissue for primary neurosphere culture was mechanically dissociated and enzymatically digested with 1.33mg/ml trypsin (Sigma), 0.67mg/ml hyaluronidase (Sigma) and 0.1 mg/ml kynurenic acid (Sigma). The enzyme mix/cell suspension was quenched with 0.7mg/ml ovalbumin and filtered through a 70μm cell strainer to remove debris. Red blood cells were eliminated from culture by 30-45min density centrifugation with Lympholyte Mammal (Cederlane). Resulting cell suspension was plated in appropriate cell culture media or frozen for archival purposes in a 10% DMSO/PBS solution. Primary patient tissue processed form immunohistochemistry was immediately fixed with 4% paraformaldehyde for immunohistochemistry. Tissue frozen for archival purposes was snap frozen using liquid nitrogen and stored in an anonymized database to preserve patient confidentiality Tissue Culture Neurospheres were cultured in serum free conditions with 20ng/ml EGF and 20ng/ml FGF as previously described % of the growth media was exchanged every 3-4 days. Neurospheres were passaged with Accutase (Sigma) when the average diameter of neurospheres exceeded 350μm. Neurosphere limiting dilution assays (LDA) were seeded at an initial density of 20 cells/μl (2000 cells/well) with stepwise 50% dilution down to 0.04 cells/μl (4 cells/well) and monitored for a period of 7-21 days. The percentage of wells without neurospheres was scored and plotted against initial seeding density 221. The 0.37 intercept was scored as the clonogenic frequency to reflect the zero term of the poisson equation and density at which there is an average of only one colony forming cell per well 222. Adherent NS culture 172 was conducted on Primeria (Nunc) tissue culture plasticware coated with 0.01% Poly-L-Ornithine (Sigma) and 10ug/ml Laminin (Sigma). Neurocult media (Stem Cells Technologies) was supplemented with 10ng/μl EGF, 10ng/μl FGF, N2 and B27. Cells were passaged by enzymatic digestion with Accutase.

109 96 Glial and neuronal lineage differentiation was induced by a three week growth factor withdrawal. The media for the first 7 days of differentiation was supplemented with 5ng/ml FGF, N2, B27 and no EGF. Subsequently, the Neurocult media was exchanged with a 1:1 mixture of Neurobasal:Neurocult, B27 and ¼ N2. Compounds were added to the culture as necessary with the appropriate vehicle controls. γsi L- 685,458 (EMD) and 6-bromo-3-[(3E)-1,3-dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3- dihydro-(3z)-2h-indol-2-one (EMD) were added to the culture and monitored for proliferation or morphological changes. Proliferation assays were conducted with Thiazolyl Blue Tetrazolium Bromide (MTT, Sigma). A final concentration of 500μg/ml was added to the tissue culture and monitored for the formation of insoluble purple formazan crystals which were solubilised with 10% SDS/0.1M HCl and quantified using a spectrophotometer at 575nm. Live imaging and tracking of cells conducted using Icucyte Cell Tracking Systems (Essen Biosciences) in standard tissue culture conditions (37ºC) and normoxic environment Vectors and Transfection Notch1 intracellular domain was cloned into the pcdna3.1 Vector from the Val1744 residue to the end of the protein. Dominan-negative Mastermind contruct was a generous gift from Dr. John Aster and is contained within a MigR1 plasmind. Transfections were conducted with Nucleofector Device (Lonza) according to manufacturer s protocols Immunocytochemistry Cells cultured as adherent NS were grown on coated coverslips and fixed with methanol or 4% paraformaldahyde (PFA). Coverslips were permeabilized with 0.1% TritonX100 and blocked with 5% NGS. Antibodies against activated Notch1 (1:250, abcam8925), Nestin (1:1000, Ab5922), GFAP (1:500, DAKO), β-iii-tubulin (1:500, MAB1637) and Sox2 (1:500, MAB2018), GFP (1:250, Roche, Cat ), Hes1 (1:500, A generous gift from Tetsuo Sudo), Hes5 (1:500, AB5708), BrdU (1:250, OBT0030) were used. Appropriate fluorescent-conjugated secondary antibodies were used at a concentration of 1:500 with copious washing with PBS between staining phases. Cells were counterstained with 1:1000 DAPI and mounted with

110 97 fluorescent mounting medium (DAKO). Imaging was conducted with a Leica microscope. Matched exposures were used to compare images between treatments of the same cell line. Manual scoring was conducted on randomly selected fields using ImageJ (V1.42q) to mark cells counted. Cells were scored as positive if staining corresponding to filamentous proteins were localized as discrete fibres in the cytoplasm and negative if fibres were not clearly visible. Cells were scored as positive if staining for corresponding nuclear transcription factors were localized to the nucleus and negative if no staining was visually observed. BrdU incorporation was assayed following a 24hr pulse with 10μM BrdU. Cells were fixed with 4% PFA and denatured with 2M HCl for 20min at room temperature. Following neutralization with 0.1M Sodium Borate ph 8.5, the coverslips were washed with copious amounts of PBS. Cells were permeabilized with 0.2% TritonX100 and blocked with 5% BSA. Staining as above Semi-Quantitative and Real Time PCR mrna from primary patient tumor samples was isolated by Trizol extraction. mrna from cells was isolated according to the protocol using RNeasy (Qiagen), treated with DNase (Qiagen) and quantified using a Nanodrop spectrophotometer. Reverse Transcriptase PCR was conducted using oligo-dt and Reverse Transcriptor (Roche) according to protocol. Real-time qpcr was conducted with a Bio-Rad PTC200 and Chromo4-α unit. Sybr Green mastermix was obtained from Bio-Rad. Primers for Notch1 223 F- GAACCAATACAACCCTCTGC R-AGCTCATCATCTGGGACAGG, Hes1 F- GAAGGCGGACATTCTGGAAA R-GTTCATGCACTCGCTGAAGC, Hes5 224 F- CGCATCAACAGCAGCATAGAG R- TGGAAGTGGTAAAGCAGCTTC, Sox4 F- GTGGTACAGGGGCAGTCAGT R- ACACCATCACGATTCCGATT, Hey1 F- GCTGGTACCCAGTGCTTTTGAG R- TGCAGGATCTCGGCTTTTTCT, Ascl1 F- TCCCCCAACTACTCCAACGAC R-CCCTCCCAAGCGCACTG and B-Actin 225 F- CATCACCATTGGCAATGAGC R- CGATCCACACGGAGTACTTG Flow Cytometry Cells were resuspended in flow cytometery buffer without EDTA and stained with CD133-APC (Mylteni Biotech), CD15-FITC, CD44PE for 30min-1hr at 4 C. Cells were spun down, washed with buffer and counter stained with propidium iodide. Quantitative flow cytometry was

111 98 conducted using the BD FACScalibur or BD FACscan. Cell sorting was conducted with BD FACS Aria Animals Orthotopic injections of cells suspended in PBS were conducted with stereotactic head frames into female NOD/SCID mice. Animals were anesthetized with ketamine/xylazine and supplied with the analgesic Anafen. A hole in the skull is bored with a needle to facilitate injection. The co-ordinates originate at the bregma are 1mm anterior, 1mm right and 2mm deep. Injections of 2-3μl are conducted over the course of 30min: 10min injection, 10min to permit diffusion and 10min withdrawal of the needle. The hole in the skull is subsequently filled with bone wax and the head sutured. Animals were cared for by laboratory animal services, assessed by unbiased laboratory staff when animals demonstrated significant disease progression and were sacrificed when recommended Microarray Data and Analysis RNA hybridization, Affymetrix U133 Plus array and data normalization was conducted by Ian Clarke. Data analysis and statistical analysis was conducted using Partek software, version 6.3 Copyright Complete linkage clustering analysis was conducted with Cluster and Treeview (Version 1.60) 174. Data analysis, t-tests and Logrank tests were performed using GraphPad Prism version 4.00 for Windows, GraphPad Software, San Diego California USA.

112 99 Chapter 3 3 Symmetric Versus Asymmetric Self renewal in Cancer Stem Cells. 3.1 Introduction Self renewal is a property whereby a stem cell undergoes a cell division where at least one of the daughter cells retains properties identical to the parent cell. Generation of two identical progeny in a self-renewal event is termed symmetric self-renewal (expansion) whereas generation of one daughter stem cell and one daughter progenitor or differentiated cell is termed asymmetric self renewal (maintenance). Thus, symmetric expansion is a process critical for rapid generation of cell numbers during development and response to injury or tissue repair. Asymmetric selfrenewal is also a process that is tightly regulated during development and is required for proper developmental patterning. Alternatively, a stem cell is also capable of dividing such that both daughter cells lose stem cell properties (extinction) becoming progenitors or differentiated cells lacking long term self-renewal (Figure 3-1). In cancer, one hypothesis of neoplastic growth is that cancer stem cells arise from normal stem cells where self-renewal has been programmed to symmetric expansion from asymmetric maintenance. Recently, Lathia and colleagues have indeed demonstrated that glioblastoma stem cells are generated primarily through symmetric self-renewal events 226. Therefore, identifying the factors that modulate symmetric versus asymmetric self-renewal is a highly sought goal in cancer prevention and treatment. Much of our understanding of factors that regulate self-renewal originate from studies of Drosophila neuroblasts and external sensory organs, a system which is permissive for characterization due to clear distinctions between stem cells and differentiated cells. In this system, cell fate decisions are determined by the spatial location of cells relative to the epithelia and are dictated by apical and basal polarity of the cell. The polarity is marked by three distinct protein complexes which are asymmetrically segregated into daughter cells. The first complex Discs Large is composed of Scribble (Scrib), discs large (dlg) and lethal giant larvae (lgl). The second complex Bazooka is composed of bazooka (baz), Drosophila atypical protein kinase C (DaPKC) and Drosophila homologue of Partitioning Defective Protein 6 (DmPAR-6). Finally, the Crumbs group is composed of crumbs(crb) and stardust (sdt) 227. These protein complexes

113 100 function to regulate downstream determinants of cell fate. One of these determinants, Numb, is a negative regulator of Notch signaling and a direct target of lgl 228. Numb is hypothesized to regulate Notch signaling by recruiting E3 ubiquitin ligases 229, promoting Notch receptor trafficking 230 and lysosomal degradation 231,175. The absence of Notch signaling in these daughter cells is thought to induce PIIb cell fate which further divides into a Drosophila neuron and sheath cell 232. Interestingly, many of the components of the Drosophila polarity complexes have mammalian counterparts, suggesting similar mechanisms of action in higher organisms. Many components from the Drosophila polarity protein complexes have homologues in mammalian cells, including mouse and human. Among these proteins, Drosophila Numb has been discovered to have at least four homologues in mammals. In the murine central nervous system, the mouse Numb homologue (m-numb) is expressed in neural precursor areas in the developing and postnatal brain 233. Another homologue, Numblike (nbl) was found to have highest expression in postmitotic neurons 234 and functions to antagonize Notch signaling. Further, there is evidence which shows that Notch receptor signaling is absolutely required for murine neural stem cell expansion. Notch1-/-, Presenilin1-/- and RBP-jK-/- neural stem cells are all incapable of forming neurospheres 73. Correspondingly, the opposite effect also holds true as transient activation of Notch receptors in-vivo induces rapid neural stem cell expansion 235. Thus, it is clear that Notch plays an important role in regulating neural stem cell self-renewal. Despite the understanding of Notch mediated self-renewal in Drosophila and murine models, the role of Notch in glioblastoma stem cell self-renewal remains poorly understood. Preliminary reports have demonstrated that persistent γ-secretase inhibition is sufficient to induce apoptosis and reduce tumorigenicity of glioma neurospheres 139 and the data we have presented in Chapter 2 has shown that we can differentiate and prevent CSC engraftment and tumorigenesis. However, the consequences of Notch inhibition on symmetric versus asymmetric cancer stem cell self-renewal remains poorly understood. Is Notch required for symmetric expansion and asymmetric maintenance of CSCs or is it expendable in one of these cell fate choices? Is it feasible to induce extinction in a population of cancer stem cells by targeting Notch? Herein, we will attempt to elucidate the role of Notch in CSC self-renewal.

114 101 Figure 3-1 Self-renewal in stem cells. A stem cell (pink) can undergo three distinct cell fate choices. A) Two daughter cells are identical in symmetric stem cell self-renewal and causes expansion of the stem cell pool. B) One daughter cell and one progenitor/differentiated cell progeny (yellow) are the result of asymmetric stem cell self-renewal and results in stem cell maintenance. C) Stem cell extinction occurs when a stem cell differentiates to two daughter cells with no self-renewal ability.

115 Results Self-renewing BTSCs persist in γsi treated cultures. We have demonstrated that Notch antagonism induces neuronal lineage differentiation of neural stem cells and subsets BTSCs. Interestingly, despite a highly differentiated appearance in-vitro we found that Notch antagonist treated BTSCs were still capable of forming tumors in-vivo, albeit with an increased latency. Since disease recurrence is a common facet of glioblastoma, we hypothesize that a cancer stem cell population may persist in culture despite pharmacological treatment. If true, a culture of neuronally differentiated BTSCs may demonstrate cardinal stem cell properties when exposed to a milieu free of inhibitor. To test this hypothesis, we treated neurogenic NS lines with Notch antagonists and replated the cultures into standard stem-cell conditions to observe repopulating capabilities. NS lines cultured in 10μM γsi/egf/fgf for 3 weeks to induce robust neuronal lineage marker expression were passaged in accordance with standard protocols and replated into proliferative conditions with EGF/FGF without Notch antagonists. MTT proliferation curves of HF240NS closely mirrored those of control cultures and at 3 weeks were restored to 95% of control cultures. Similarly, the growth dynamics of antagonist treated G144NS was also similar to vehicle treated cultures. 3 weeks after replating, this glioblastoma line demonstrated levels of MTT proliferation that were 83% of control cultures. The restoration of cell proliferation in the absence of γsi suggests that the proliferative impairment caused by Notch antagonism is not a permanent effect on all stem cells in the culture and illustrates a remarkable expansion upon inhibitor withdrawal (Figure 3-2). We have shown that proliferation can be rapidly restored in the absence of Notch inhibition. However, the mechanism of proliferation is unclear. Does proliferation occur due to reactivation of self-renewal in a pool of quiescent stem cells or does it occur due to a rapid burst of proliferation from progenitors seeded into a new medium? To ascertain whether cells undergoing transient Notch inhibition cells retain self-renewal, we utilized the limiting dilution assay, allowing us to determine the number of colony forming cells within a population 221,222. G144NS treated for three weeks with γsi was dissociated and plated into LDA without inhibitor. The clonogenic frequency of vehicle treated cells was 15.2±8.4 cells/well whereas the γsi treated cells was 44.9±22.7. While clonogenic frequency is diminished by approximately three-fold, the observation lacks statistical significance. Nevertheless, these experiments demonstrate that

116 103 glioblastoma lines treated with Notch antagonists retain self-renewal ability despite prior expression of differentiated markers in bulk culture, suggesting survival of a clonogenic population in the absence of Notch (Figure 3-3). To investigate whether cells that regain self-renewal and proliferation are bona-fide cells with full stem like properties, we conducted a differentiation assay of cells exposed to γsi and shown to express differentiated markers in culture. GliNS1, a glioblastoma which demonstrates robust neuronal differentiation when cultured with γsi for 3 weeks, was examined for multipotentiality after a recovery period in EGF/FGF. The cells were enzymatically dissociated and plated into EGF/FGF conditions without γsi to examine whether multi-lineage differentiation is biased towards a particular lineage or impaired altogether. Surprisingly, GliNS1 treated with γsi for 3 weeks, replated into EGF/FGF without inhibitor and differentiated according to standard differentiation protocols were capable of both glial and neuronal differentiation (Figure 3-4). Therefore, despite the acquisition of neuronal lineage markers and reduced proliferation in the absence of Notch signals, glioblastoma stem cells are still capable of self renewal, proliferation and multipotentiality when exposed to favorable conditions which promote Notch receptors reactivation.

117 104 Figure 3-2 Glioma Stem Cells and Fetal Neural Stem Cells previously treated with Notch inhibitors proliferate in absence of antagonist. A) HF240NS and B) G144NS neurogenic lines were dissociated and replated into fresh media with EGF/FGF after culture for 3weeks with γsi. Both cell lines reacquire proliferative potential when assayed by MTT. 100 Percentage of wells without spheres 10 Vehicle 10uM GSI 37% intercept Number of Cells per well Figure 3-3 Limiting dilution assay of γsi treated G144NS cells plated into EGF/FGF without inhibitor show retention of self-renewal. G144NS glioblastoma retains clonogenic potential despite treatment with γsi indicating the retention of a self-renewing population in-vitro. Clonogenic frequency of Vehicle ( ) 15.2±8.4 cells/well. γsi treated cells ( ) was 44.9±22.7 cells/well.

118 105 Figure 3-4 Glioma stem cells revert to a multipotent state with removal of γsi. GliNS1 was cultured for 2 weeks in 6μM γsi to induce robust neuronal marker expression. Viable cells determined by trypan blue exclusion were passaged into fresh media with EGF/FGF without γsi and cultured for 3 weeks. A loss of neuronal marker expression and the reacquisition of GFAP expression were noted. These cells were passaged into differentiating conditions for 3 weeks and it was noted that these cells were fully multipotent. Scale bars 100μm.

119 Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment. We have observed that despite appearing to be highly differentiated, cancer stem cells retain multipotentiality and self-renewal in-vitro, and are able to form tumors in-vivo. How is it possible that a cell population with such a dramatic shift in lineage fate can retain such a robust stem-like character? These findings may be explained by the observation that while a large proportion of cells in-vitro are growth restricted and express neuronal markers, a minority are marker negative and remain proliferative (Chapter 2). Therefore, while quiescent, a population of cancer stem cells survives and retains stem like properties despite Notch blockade. One hypothesis is that γsi blocks clonal expansion by shifting symmetric division to asymmetric division, thereby producing quiescent stem cells and differentiated progeny (Figure 3-6C). In this scenario, the outcome of a mitotic event is one neuronal precursor daughter cell that is positive for markers of differentiation, limited in growth potential and susceptible to apoptosis. The other daughter cell retains self-renewal and multipotentiality such that, when it is passaged into permissive conditions, it expands to repopulate the cell line in-vitro and in-vivo. To date, there has been little evidence to support the role of Notch in regulating symmetric/asymmetric self-renewal transition in glioblastoma stem cells. Alternatively, another explanation is that there is stochasticity with regard to the sensitivity of each cell to Notch blockade. With this model, each cell may possess unequal Notch receptor expression and/or dependence. Therefore, for any given cell line, while the EC50 in L-685,458 may be ~4μM for the cell line as a whole, the actual dose required to inhibit proliferation for each cell in culture may range from <1μM to >10μM, and therefore, in the experiments that have been presented, a small but significant population of stem cells will resist differentiation, retain proliferation and repopulate the culture in-vitro and in-vivo (Figure 3-6B). Finally, another model is that cells in culture may evolve resistance to the selective pressure of γsi 236,237,238. This would predict that all cell lines have a small possibility to evolve spontaneous resistance to γsi. Stem cells evolving this resistance would retain self renewal and proliferation despite the presence of a differentiating stimulus. This could theoretically occur via upregulation of noncanonical signaling pathways such as c-jun N-terminal protein kinase (JNK) 239 or hedgehog 129 modulating downstream Notch components.

120 107 Testing our hypothesis necessitated the lineage tracking of cells in-vitro in order to score the relative frequencies of self-renewal events and cell fates. We collaborated with Dr. Eric Jervis & colleagues 240 who developed novel technologies to track cell growth in confined and easily observable microenvironments. This in-vitro system employs a tissue culture surface seeded with inert polymer beads of a defined and customizable diameter. Overlaid is an optically clear coverslip that creates a gap chamber between the glass and culture surface. This gap chamber therefore limits cell growth to a two dimensional plane (Figure 3-5). Growth in a single plane greatly facilitates video cell tracking and is amenable to standard culture conditions and pharmacologic manipulations. Furthermore, this system is permissive for cell to cell interactions and is thus a more faithful representation of a physiologic environment, a distinct advantage over most isolated single cell tracking modalities. Tracking cells allows the creation of lineage trees documenting the growth, divisions and cell fate of the glioblastoma stem cell line GliNS1 cultured with and without Notch inhibitors. We cultured GliNS1 glioblastoma stem cells for 7 days in 5μM GSI while recording cell divisions, apoptotic events and changes in cellular morphology. Cell divisions were classified based on the fate of daughter cells. Symmetric events were classified as cell divisions where the two daughter cells retain compact primitive morphologies and ability to further divide, regardless of subsequent cell fate of second generation cells. Conversely, asymmetric events were defined as divisions where one daughter cell retained mitotic potential, whereas the other daughter underwent apoptosis, acquired neuronal morphology or failed to proliferate (quiescence). Neurons were defined as cells lacking mobility, acquiring neuronal markers and showing elongated neuronal morphology. Symmetrical events where all the daughter cells undergo apoptosis are not considered symmetrical self renewal, but are scored as symmetrical apoptosis. Lineage trees from control GliNS1 were remarkably symmetrical. Of 39 cells tracked over 7 days, there were 147 mitotic events occurred with an average generation time of 40.9±18.2 hours resulting in 188 daughter cell observations. Of these divisions, 127 (86%) were classified as symmetric. While we are currently unable to immunostain for apoptotic markers in this assay system, cells undergoing programmed cell death exhibited distinctive membrane blebbing, lack of motility and an undefined nucleus. Spontaneous apoptosis was an infrequent occurrence with only 14 cells (7.4%) undergoing apoptosis during the observation period. Of these apoptotic

121 108 cells, 3 pairs underwent apoptosis shortly after dividing. In contrast to these findings, γsi treated GliNS1 tracked for the same amount of time was observed to have fewer mitotic events. 90 cells at the start of the observation period underwent a total of 102 mitotitc divisions with an average generation time of 49.7±21.4 hours giving rise to 198 cells. Of these divisions, there was a relative decrease in symmetric events, 57 (56%), and an increased proportion of asymmetric events. 10.8% of cell divisions were asymmetric in vehicle cultured cells versus 30% of divisions in γsi treated cells. Of the asymmetric events recorded in γsi cultures, 60% of these asymmetric events (18/30) were biased towards one daughter cell undergoing apoptosis, 33% (10/30) consisting of one daughter cell acquiring neuronal lineage morphology and finally 6.6% (2/30) having one daughter cell becoming quiescent after dividing. (Table 3-1) (Figure 3-7). Via live cell tracking, we clearly demonstrated that blockade of Notch signaling in GliNS1 changes the outcome of mitotic events. This technique is advantageous since it can provide cell fate information on cells which did not divide. In control cultures, 16/39 cells (41%) did not divide during the 7-day observation period. Of these cells, 10% (4 of 39 seeded cells) acquired neuronal characteristics, 23% (9 of 39 seeded cells) were quiescent and 7.6% (3 of 39 seeded cells) underwent spontaneous apoptosis. In contrast, γsi treated cells were less likely to experience a mitotic event with 55 cells (61% of total) failing to divide during the observed period. 11% of these (11 of 90 seeded cells) adopted a neuronal morphology and 34% (31 of 90 seeded cells) underwent spontaneous apoptosis. Interestingly, this tracking system reveals that while the number of quiescent cells increases with Notch blockade, the proportion of quiescent cells that differentiate into neurons in this time period does not change appreciably (10% neuronal cells in vehicle vs. 12% neuronal cells in γsi). These findings suggest that the majority of neurons observed in culture are daughter cells of a self-renewal event. We have used a novel cell tracking system to elucidate cell fate decisions of GliNS1 in the absence of Notch pathway activation. In the 7 day observation period, we have noted that there are an increased proportion of cells that undergo apoptosis, both before and after mitotic events. We have observed an approximate three fold increase in asymmetric self renewal and a 1.5 fold decrease in symmetric self renewal upon Notch blockade. Taken together, these results demonstrate that expansion of the glioblastoma stem cell population can be blocked with Notch pathway inhibition.

122 109 Vehicle 5μM γsi Starting number of cells Total Cells Tracked at end of observation period Total Divisions -Symmetric Events -Asymmetric Events -Symmetric Apoptosis (86%) 57 (55%) 16 (10%) 30 (29%) 3 (2%) 12 (11%) -Undefined 1 (1%) 3 (3%) Total Quiescent Cells -No Change -Quiescent Neuronal 16 (41%) 55 (61%) 9 (21% of Quiescent) 13 (14% of Quiescent) 4 (10% of Quiescent) 11 (12% of Quiescent) -Quiescent to Apoptosis 3 (8% of Quiescent) 31 ( 34% of Quiescent) Total Apoptosis 14 (7%) 56 (28%) Total Neurons 7 (4%) 22 (11%) Average Generation Time 40.9±18.2 hours 49.7±21.4 hours Table 3-1 Summary observation of cell divisions and apoptotic events from GliNS1 lineage tracking. Cells were tracked over a period of 7 days with vehicle or 5 μm γsi. Total cells are defined as the number of cells tracked at the end of the observation period. Quiescent cells are defined as tracked cells which do not undergo a mitotic division during the observation period. Generation time and percentage asymmetric events are increased upon γsi treatment. Bold number indicate number of observations.

123 110 Figure 3-5 Diagram of monolayer cell culture in a confined 3D microenvironment. A) Standard culture conditions are permissive for cell migration in all 3-dimensions, an aspect which makes cell tracking difficult due to overlap of cells during videographic filming from above. B) A confined microenvironment is created with polymer beads of a defined diameter and a culture slide. This creates a gap under the coverslip which restricts movement of cells in 2-dimensions and greatly facilitates live cell tracking.

124 111 Figure 3-6 Stochastic differentiation or asymmetric self-renewal as a result of Notch antagonism. A) Cancer stem cells cultured in EGF/FGF have unlimited symmetric self-renewal in culture. B) Stochasticity or evolutionary resistance upon Notch antagonism may allow a small population of cancer stem cells to retain symmetric-self renewal. The other cells differentiate following a neuronal lineage and eventually undergo apoptosis or fail to grow after passage. C) Alternatively, asymmetric self-renewal may occur in all cells in culture.

125 112 Figure 3-7 Cell division and lineage tracking of GliNS1 glioblastoma stem cells. Representative lineage trees illustrating GliNS1 cultured in EGF/FGF and tracked over one week. A) Representative lineage tree of 2 cells cultured in vehicle. B) Representative lineage trees of 3 cells cultured in 5μM γsi. =Lost track, =Moved out of frame, X=Apoptosis, =neuronal morphology

126 Discussion Despite differentiation into BrdU negative, β-iiit positive neuronal cells in-vitro, glioblastoma stem cells treated with Notch inhibitors retain a capacity for colony formation in-vitro and brain tumor formation in-vivo. In-vitro, following γsi withdrawal, these cells are proliferative, colony forming and possess multilineage capabilities when exposed to favorable conditions. In-vivo, γsi treated cells formed tumors in orthotopic transplant models, albeit at a longer latency compared to controls. This suggests that a tumorigenic cancer stem cell population can persist despite Notch signalling inhibition, possibly from a shift from symmetric to asymmetric selfrenewal. By tracking cell divisions of single glioblastoma stem cells in a 2-D chamber, we discovered that γsi indeed increased the proportion of cells undergoing asymmetric self-renewal. In the majority of these asymmetric events, one of the daughter cells underwent apoptosis or differentiated while the other remained unchanged. We are also able to observe the fate of cells which do not undergo a cell division. This fraction, which we defined as quiescent, is increased in the population treated with γsi. This is consistent with the observations made in Chapter 2, where we demonstrated reduced proliferation with Notch blockade. Furthermore, the fraction of quiescent cells undergoing apoptosis is elevated. 34% of all quiescent cells eventually die, representing the majority (55%) of all observed apopotic events. Examining the bulk culture, we found that over a quarter of all cells ultimately undergo controlled death. Thus, the decrease in proliferation that we observe with γsi is due to a variety of factors. First, we can see that without Notch signaling, cells are less likely to divide and are more likely to be quiescent. Second, of the cells that do divide, there is a shift towards asymmetric self-renewal and even an increase in double extinction of daughter cells. Finally, cell cycle time is lengthened by almost 9 hours (a factor of 1.2) in treated cells. We questioned the mechanism of cell culture recovery and tumor formation after the removal of Notch inhibitors and devised cell tracking experiments to help us elucidate the origins of recovery. What is remarkable about cancer stem cells treated with Notch inhibitors is that some cells demonstrate extensive self-renewal capability and flexibility to shift between symmetric and asymmetric self-renewal. These observations raise intriguing questions regarding the determinants of self-renewal and the potential of any given cell in culture. For instance, consider the single cell that is tracked on the extreme right of supplemental figure 5. While there is an increase in neuronal lineage differentiation and apoptosis, the lineage tree is punctuated with

127 114 many symmetric events interspersed with asymmetric events. It could be hypothesized that this clone, if exposed to permissive conditions would be highly tumorigenic. Ultimately, the models of cell fate decisions outlined in Figure 3-6 likely represent an oversimplification and these processes require more detailed study. The data presented in this chapter illustrates the complexity in fate choice and demonstrates that self-renewal in the absence of Notch is a composite of all the possibilities outlined prior. The lineage trees provided in this chapter provide functional insight at the single cell level. An intriguing question that arises is how can one cell avoid terminal differentiation without Notch activation? In an elegant study, Sang and colleagues showed that Hes1 expression is capable of protecting serum starved fibroblasts from irreversible senescence and that sustained expression of this bhlh transcription factor was sufficient to maintain reversible quiescence 195. They showed that terminal myogenic differentiation occurred when Hes1 signaling was blocked with dominant-negative Hes1 constructs and γsi. Ultimately, they provided evidence to show that Hes1 binds with and activates Transducing-Like Enhancer of Split 1 (TLE1), which functions as a co-repressor that recruits Histone Deacetylases (HDAC). In Chapter 2, we have shown that Hes1 is less sensitive to γsi blockade than Hes5 and that Hes1 expression persists in many NS lines despite pharmacologic and DN-MAML blockade. Thus we theorize that the persistence of low levels of Hes1 expression in glioblastoma stem cells is an adaptation, which functions as a protective mechanism and allows for cell cycle re-entry and the prevention of irreversible quiescence. Sang et al also showed that Hes1 expression was sufficient to prevent premature senescence as a result of oncogene activation and that rhabdomyosarcomas express high levels of the protein. Considering the effect on preventing senescence, it should be of no surprise that Hes1 plays such an important role in tumorigenesis. Intriguingly however, their observation may suggest that a tumorigenic lesion could begin in a cell population already expressing Hes1. We observed an approximate four-fold increase in apoptotic glioblastoma cells in γsi treated cultures compared to vehicle. Interestingly, evidence in the literature suggests that decision to undergo apoptosis may be directly regulated by Notch. In a study conducted by Lakshmi and colleagues, they provided evidence to show that the activated NICD interacts directly with mitochondrial proteins to suppress the apoptotic cascade 241. In a pathway independent of RBPjK, they showed that activation of NICD by Jagged1 allows it to bind directly to mitochondrial surface proteins and leads to inactivation of the proapoptotic Bcl2-Associated-X-Protein (Bax).

128 115 Intriguingly, beyond canonical mechanisms of receptor activation, the entire canonical downstream axis was found to be dispensable for the antiapoptotic function. Therefore, the increases in cell death observed in cell tracking videos are consistent with the mechanism of Notch mediated proliferation and anti-apoptotic protective effects. Finally, an important alternative hypothesis that we have not ruled out is that cells expressing lineage markers may be capable of de-differentiation : losing lineage marker expression and reacquiring stem cell properties upon reactivation of Notch signaling. To explore this possibility, we would sort γsi treated cells positive for lineage markers and negative for stem cell markers, and see whether this population is capable of expanding in-vitro or forming tumors in-vivo. The process of de-differentiation is a controversial occurance. With the advent of ips technology, it has been proven that some mature cell phenotypes can revert back to a pluri/multipotent cell state with careful manipulation of defined transcription factors 70. However, whether a similar process can occur in differentiated cancer cells has not been proven. The data presented in this thesis have identified one of the molecular switches responsible for regulating symmetric to asymmetric self renewal in glioblastoma stem cells. Ultimately, with knowledge of key molecular mechanisms controlling tumor growth, we have contributed to the understanding of glioblastoma growth and disease recurrence. We are optimistic that the findings presented in this thesis may have implications for the treatment and cure of glioblastoma.

129 116 Supplemental Figure 6 Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cells. First replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γsi. An increase in asymmetric cell divisions, apoptosis and neuronal morphology was noted. =Lost track, =Moved out of frame, X=Apoptosis, neuronal morphology. Horizontal line indicates point of γsi addition.

130 117 Supplemental Figure 7 Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cellse. Second replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γsi. An increase in asymmetric cell divisions, apoptosis and neuronal morphology was noted. =Lost track, =Moved out of frame, X=Apoptosis, neuronal morphology. Horizontal line indicates timepoint of γsi addition.

131 118 Materials and Methods Replating Assay Cells were cultured in EGF/FGF and γsi for a period of 2 week to induce neuronal lineage differentiation. After this period, cells were dissociated with Accutase (Sigma) and viable cells replated into a 96 well plate at a concentration of 2000 cells/well without γsi. Cell proliferation was measured with MTT as previously described (Chapter 2) Limiting Dilution Analysis Cells were cultured according to standard tissue culture protocol in 96 well plates. A starting concentration of 2000 cells per well was plated in the left-most column and two-step dilutions conducted down to a single cell per well. After one week in culture, the percentage of wells without colonies (F 0 ) was plotted against the initial number of cells per well (x). The number of cells required to form one colony in every well is determined by the 0.37 intercept (F 0 =e -x ) which is frequency of clonogenic stem cells in the whole population from the Poisson distribution Differentiation Protocol Cells are cultured on a glass coverslip according to standard culture conditions. Growth factor withdrawal induced differentiation was induced over a period of 3 weeks. In the first week of differentiation, the cell are cultured in Neurocult media with the concentration of FGF reduced to 5 ng/ml, N2 growth supplement and 1xB27 growth supplement. Growth factors are further reduced in the second week of differentiation to a 1:1 mix of Neurocult:Neurobasal media, ¼ N2 and 1xB Lineage Trees Cells were tracked in real-time as previously described 240. Briefly, a cell chamber was created by overlaying a glass cover-slip over a culture surface populated with polymer beads 7μm in diameter. Cells cultured under this 7μm gap were then imaged every 6min using a tissue culture camera. Media exchanges were conducted twice a week and supplemented with the γsi L- 685,458 at a concentration of 5μM or with the equivalent volume of DMSO as a vehicle control.

132 119 Chapter 4 4 Notch1 Receptor Mutations in Brain Tumor Stem Cells 4.1 Introduction The hypothesis that mutations within proto-oncogenes contributed toward neoplastic transformation was first demonstrated in 1976 by seminal work by Stehlein et al 243, where normal chicken cells were found to contain sequences related to the src gene identified in avian sarcoma viruses. Since then, mutations within proto-oncogenes are now understood to be a major mechanism of transformation. Mutations in the Notch proto-oncogene resulting in malfunctioning protein and contributing to neoplastic transformation has been described in hematopoietic neoplasms. Notably, t(7;9)(q34;q34.3) translocations involving the TCR-β gene and Notch1 gene were discovered to have a major role in T-ALL 10. Mechanistically, this translocation results in a fusion protein that deletes the extracellular domain of Notch1 resulting in a constitutively active intracellular domain 244,245. Subsequent studies have determined that point mutations within the heterodimerization domains and intracellular PEST sequences of the Notch1 gene are present in over 50% of all T-ALL patients 117. These mutations function by enhancing NICD cleavage and/or preventing degradation of the activated receptor. Mutations within the heterodimerization (HD) domain result in reduced membrane heterodimer stability and result in ligand-independent γ-secretase processing of the receptor 246. Combined with mutations in the PEST domain, the activated receptor experiences a dramatic increase in half life, leading to precocious activation of downstream Notch targets. Recently, mutations in Notch1 have also been identified in chronic lymphocytic leukemia. With the understanding of the lesion in the Notch pathway, scientists have been able to infer the role of Notch in hematopoietic lineage decisions and have enabled a greater understanding of the cell of origin in these cancers. In addition to this, γsi treatment for Notch mutation based T- ALL is closer to becoming a viable treatment option. Combining γsi treatment and dexamethasone, already in use to treat T-ALL, has led to promising results in-vitro and in-vivo suggesting that γsi may be a viable patient treatment 214. Therefore, identifying Notch mutations in other cancers highly desired. To date, the contribution of Notch receptor mutations in other

133 120 diseases and cancer has been unclear. Some reports have demonstrated that some ependymomas, CNS tumors arising in the ependyma lining the ventricles, harbor mutations in Notch However, other common malignancies fail to demonstrate mutations. No mutations have been discovered in cervical cancers 248. Therefore, the identification of Notch mutations in brain tumors may represent a novel mechanism in the initiation and propagation of this disease and highlight the Notch pathway as a target for drug therapy in CNS malignancies. 4.2 Results Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors. We have utilized primer sequences identical to those used by Weng et al, to profile the heterodimerization and PEST domains of CNS tumors. This region of the receptor was profiled exclusively of our screen as it had been revealed that this region harbored mutations in the majority of Notch1 mutation positive T-ALL samples (43.7%) 117. We examined genomic DNA from archived tumor tissue isolated from 10 medulloblastoma, 38 GBM and 4 ependymoma samples (Table 4-1). Our screen of genomic DNA from 38 GBM tissue samples revealed two tumors (5.2%) that harbored mutations in the HD domain. In both of these tumors there was a heterozygous guanine to an adenine missense mutation at position 4831 of the Notch1 sequence inducing an alanine to a threonine mutation at amino acid position This novel mutation has not been previously reported in the literature as a contributor to T-ALL, nor is it a reported single nucleotide polymorphism (SNP). No other mutations were found in other tumor types.

134 121 Figure 4-1 5% of glioblastomas harbour mutations in the Notch1 receptor. A) Heterozygous mutations were identified at position 4813 in the genomic sequence. B) The mutation corresponds to amino acid position 1612 which corresponds to a highly conserved region of the heterodimerization domain. C) This missense mutation mutates the first nucleotide of an alanine codon resulting in a threonine codon.

135 Discussion In this study we have found two heterozygous mutations located in the HD domain in 3.8% (2/52) of tumors. The absence of pervasive activating Notch1 mutations highlights an interesting paradigm in tumor initiation and growth. Studies conducted in the past have indicated that ectopic NICD is sufficient to transform immortalized cell lines 244,249 and is required to maintain the phenotype of Ras-transformed cell lines 250. Therefore, one could expect any mutation that extends the half-life or supports the precocious activation of the NICD would be common in many tumors that feature activated Notch. While the presence of Notch mutations is not widespread, there may be an explanation to the lower than expected observed frequency of mutations. Cancer growth can be dependent on both a tumor derived and/or an exogenous vascular niche 251 to provide nutritional support, metabolic waste management and oxygen requirements. Perhaps there is an evolutionary pressure to avoid constitutive Notch activation which would otherwise limit or deny the repertoire of supporting cell fates. Indeed, the subventricular zone niche is composed of transient amplifying cells which are the progeny of the bona-fide Type-B stem cell 252. The generation of these supporting cells would depend on the ability of the stem cell to downregulate Notch signaling in daughter cells, a function that would most certainly be impaired if Notch signaling is constituitively active. The ability of a neural stem cell or cancer stem cell to cell autonomously generate a supporting niche is a significant evolutionary advantage, and thus mutations which select against this ability may be unfavorable in malignancies driven by cancer stem cells. This requirement for de-novo niche generation may also explain the prevalence of Notch mutations in some hematopoietic cancers versus solid cancers. Cancer stem cells in some hematopoietic malignancies are capable of usurping normal bone marrow niches and disrupting the behavior of normal hematopoietic progenitor cells 253. Thus, leukemic stem cells are not pressured to retain the full repertoire of diverse cell fates required to generate a supporting environment. This hypothesis is consistent with our previous findings as we have demonstrated that not all of the cells in our relatively homogenous NS cultures possess nuclear localization of activated Notch, suggesting the differential regulation of Notch activation within cells in the tumor. Whether these Notch negative cells have a supporting function in NS lines is yet to be determined. Taken together, our data demonstrate that a fraction of brain tumors harbor Notch1 mutations. However, we do not rule out the possibility that alternative mechanisms of aberrant Notch signaling supports brain tumor initiation and growth.

136 123 Activating Notch mutations are commonly found in T-ALL and now known to be a significant contributor to the mechanism of leukemia initiation. Paradoxically, a recent discovery has also implicated inactivating Notch mutations in the perpetuation of chronic myelomonocytic leukemia (CMML). What was discovered was that mutations within Nicastrin, APH1, MAML1 or Notch2 functioned to disrupt downstream Hes1 signaling and lead to leukemia generation in 5/42 patients 254. Thus, this study demonstrates that Notch signals exist in a fine balance in hematopoietic development. Excess signaling can push hematopoietic stem cells to the T- lymphocyte cell fate and T-ALL, whereas insufficient signaling can promote granulocyte/monocyte progenitors leading to CMML. In our study, we have demonstrated that 5% of glioma (38 malignant glioma and 4 ependymoma) harbour activating Notch mutations. Considering the model of Notch in leukemia, we would expect to discover mutations in glioma since Notch activation plays a role in glial development. In contrast, Notch normally suppresses neuronal cell fate. In our study, none of the 10 medulloblastoma samples were found to have Notch mutations. Since Notch is responsible for glial specification, future studies in our lab will focus on the identification of mutations in neuronal tumors. Identification of inactivating Notch mutations in receptors or γ-secretase components in medulloblastoma would be an insightful discovery and would help explain the mechanism of neuronal tumor development.

137 124 Domain Tumor Type HD PEST GBM1 A1612T None GBM2 A1612T None GBM3 None None GBM4 None None GBM5 None None GBM6 None None GBM7 None None GBM8 None None GBM9 None None GBM10 None None GBM11 None None GBM12 None None GBM13 None N/A GBM14 None N/A GBM15 None N/A GBM16 None N/A GBM17 None N/A GBM18 None N/A GBM19 None N/A GBM20 None N/A GBM21 None N/A GBM22 None N/A GBM23 None N/A GBM24 None N/A GBM25 None N/A GBM26 None N/A GBM27 None N/A GBM28 None N/A GBM29 None N/A GBM30 None N/A GBM31 None N/A GBM32 None N/A Domain Tumor Type HD PEST Medullo1 None None Medullo2 None None Medullo3 None None Medullo4 None None Medullo5 None None Medullo6 None None Medullo7 None None Medullo8 None None Medullo9 None None Medullo10 None None Medullo11 N/A None Medullo12 N/A None Medullo13 N/A None Medullo14 N/A None Medullo15 N/A None Medullo16 N/A None Medullo17 N/A None Medullo18 N/A None Ependymoma1 None N/A Ependymoma2 None N/A Ependymoma3 None N/A Ependymoma4 None N/A Table 4-1 Summary table of brain tumors profiled for mutations in Notch1. Genomic DNA from three subtypes of brain cancer was profiled for mutations in the HD and PEST regions of Notch1.

138 Materials and Methods Genomic DNA extraction Patient samples were obtained with proper ethics approval and informed consent. Tissue was immediately snap frozen in liquid nitrogen for archival purposes. Genomic DNA from primary tumor tissue was isolated by Trizol (Sigma) extraction according to protocols Nested Polymerase Chain Reaction Notch1 HDN1 and PEST amplicons were amplified using nested PCR. Primers used were the same primers utilized as Weng et al 117. First HD amplicon primer: F1 5 AGCCCCCTGTACGACCAGTA R1 5 CTTGCGCAGCTCCTCCTC F2 5 GACCAGTACTGCAAGGACCA R2 5 TCCTCGCGGGCCGTAGTAG Sequencing Nested PCR products were cleaned with Qiagen PCR cleanup kit. DNA sample was sequenced by The Centre for Applied Genomics (TCAG). Trace sequences were viewed with Finch TV and Chromas. Sequence alignments conducted with BioEdit.

139 126 Chapter 5 General Discussion 5.1. Targeting Notch in Brain Cancers Cancer Stem Cells are Controversial Since the identification of a tumorigenic population in breast 95 and brain 97,107,98 malignancies there has been an explosion of international effort to identify similar populations in all forms of solid and hematopoietic cancers. The effort of dozens of independent laboratories has identified putative human solid cancer stem cell origins in prostate 96, colon 99,100, pancreas 101,255, mesenchyme 102, skin 103,104, ovaries 105, head & neck 106 and lung 56 cancers. These studies, including the work presented in this thesis, have relied on mouse models of xenotransplantation to study cells capable of tumor propogation. With technical and ethical limitions in mind, there is ongoing debate regarding the universality, applicability and clinical relevance of the cancer stem cell hypothesis. These questions are invoked by a study of B-Cell lymphoma. Utilizing an Eµ-myc pre-b/b, Eμ-N-Ras and PU.1-/- AML mouse models, it appeared that tumor formation did not correlate with number of cells injected or surface marker expression 256. Another argument is that identification of cancer stem cells using muring transplant models identifies cells capable of growing within genetically modified animal strains. Xenograft hosts are been bred to lack immune response and the compatibility of human cells with a murine microenvironment arguably differs from syngeneic models. Indeed, a study of skin cancers revealed that individual unsorted melanoma cells possessed efficient tumor forming capabilities in transplant assays whereas other studies identified subpopulations of melanoma intiating cells identified by ABCB5 or CD271 in an NSG mouse strain 104,103, Quintana and colleagues showed that the efficiency of tumor formation was irrespective of marker expression and importantly, could be increased with the use of a highly immunocompromised NOD/SCID interleukin-2 receptor gamma chain null (Il2rg(-/-)) mouse model 257,258. Notwithstanding the future development of more sophisticated assays, the cancer stem cell hypothesis may not be universally applicable to all malignancies. Within the central nervous system, mouse models of various brain cancers support the cancer stem cell and hierarchical organization of these tumors 130,259,260. Recently, Eppert and colleagues characterized gene expression profiles of AML leukemic stem cells (LSCs) and found that they shared a transcriptional profile similar to HSCs. Importantly, LSCs were validated to be tumorigenic with NOD/SCID xenograft models and

140 127 expression of a stemness profile correlated directly with a poor clinical outcome in the original patient 261. Data presented in this thesis demonstrate patterns of gene expression in glioblastoma stem cells that cluster closely with human fetal neural stem cells. Whether the similarities in expression profiles found in glioblastoma stem cells and neural stem cells possess similar prognostic value is a question being addressed by our laboratory. Recent studies indicate that stemness genes such as CD-133 and Nestin, are associated with a poor outcome in patients with glioma 262,263,264. Using this knowledge in clinical decision making warrants careful validation since the prognostic value of stem cell markers remains controversial 265. Taken together, a hierarchical cancer stem cell organization may not exist in all tumors but evidence exists to support such a hierarchy in blood and brain. These studies underscore the importance of technical validation and healthy skeptiscm when the ultimate goal is attempting to minimize the human cost of cancer Cancer Stem Cells as a Therapeutic Target Glioblastoma is the most common brain tumor in adults with very poor survivability. While a great deal of progress has been made in understanding the molecular genetics and determinants of this disease many of the therapeutic strategies in use are only marginally effective 212,147,213,144. Understanding the cellular origins and molecular vulnerabilities of this disease will be paramount for the development of successful patient treatments. Mizutani and colleagues demonstrated that Notch signaling is not an absolute indicator of murine neural stem cells 266. Activated Notch was assayed in murine telencephalic ventricular zone cells with an EGFP reporter construct and thus stratifies Notch activity upon expression of EGFP hi versus EGFP lo. Based upon the high and low levels of Notch activity, they were able to distinguish populations of neural stem cells (NSCs) and intermediate neural precursors (INPs) respectively. While both populations utlitized Notch receptor signaling, only neural stem cells signaling through CBF-1 were capable of long term self-renewal. INPs, in contrast, signalled independently of CBF-1 and, while proliferative, possessed limited self-renewal. Further downstream of the pathway, it was discovered that NSCs were enriched predominantly in Hes5, whereas INPs expressed higher relative Ascl1. Upon differentiation, EGFP hi NSCs generated multipotent cells with a strong bias towards GFAP positive astrocytes whereas EGFP lo cells overwhelmingly generated β-iii-tubulin positive neurons. There are several parallels between

141 128 the study conducted by Mizutani et al., and the work presented in this thesis. The class of NS lines that we termed neurogenic express high expression of Ascl1 relative to non-neurogenic lines. While none of the NS lines demonstrate an exclusive bias towards neuronal lineage differentiation upon growth factor withdrawal differentiation (Supplementary Figure-5), Ascl1 expressing cell cultures acquire more neuronal lineage markers upon active Notch blockade. Arguably, the spontaneous neuronal lineage differentiation observed by Mizutani in INPs in their differentiation assays could be due to spontaneous loss of Notch signaling. Since FGF2 is known to feed back on Notch signals and suppress neurons, growth factor withdrawal further pushes INPs along their neurogenic lineage 267. That neurogenic lines such as GliNS1, do not undergo overwhelming or exclusive neuronal differentiation upon growth factor withdrawal may reflect an astrogliogenic role for the Notch axis in a differentiating environment and/or functional lateral inhibition. Therefore using the framework delineated by normal neural developmental, non-neurogenic lines are most closely analogous to Notch hi NSCs and neurogenic lines are more analogous to Notch lo INPs. What is the significance of these parallels? Evidence suggests that the stemness role of Notch in tissue stem and/or progenitor cells is preserved. In hematopoietic stem cells (HSC), the EGFP hi and EGFP lo/neg possess equal colonly forming ability in-vitro. However, the EGFP hi cells were more likely to form colonies containing multiple hematopoietic lineages whereas the EGFP lo/neg cells formed more unipotent colonies 268. Considering these close parallels, using what known to modulate normal tissue stem cells to cancer stem cells may be more applicable than previously thought Notch and the Cancer Niche Cancer stem cells and neural stem cells have been shown to possess many common biochemical features. Recent focus on the tumor microenvironment has raised the possibility of indirectly killing cancer stem cells by affecting the physical environment in which it resides. Normal neural stem cells are found in structured microenvironments capable of supporting metabolic needs and providing a physical environment that facilitates controlled self-renewal. In normal adult brain, neural stem cells within the subventricular and hippocampal regions reside within a perivascular niche 269,252,270. Importantly, niche endothelial cells support neural stem cell selfrenewal and neurogenesis by activating Notch signaling in stem cells directly 82,29,271 and through secreted factors 272. Many parallels between normal and cancer stem cells can be drawn and indeed, growing evidence suggests that cancer stem cells also reside within a specialized

142 129 vascular niche 251. Endothelial activation of Notch receptors occurs in the tumor microenvironment and proof of concept experiments have shown that targeting endothelial cells within the tumor are effective in limiting activation of Hes proteins 140. Angiogenesis, the process of new blood vessel growth from an existing vascular network, is a requisite process for supplying the metabolic demands of a solid tumor growth. An attractive therapeutic target, blockade of the chemokine Vascular Endothelial Growth Factor (VEGF) is the basis for treatment with monoclonal antibody Bevacizumab. Recently, the process of retinal angiogenesis was found to be regulated by Dll4-Notch1. High Notch activity in response to local VEGF restricted tip cell growth and promoted stalk phenotypes, ultimately leading to budding 273. Further, Notch components are targets of downstream VEGFR-3 signaling in stalk cells as knockdown of the receptor phenotypically recapitulates tip cell hyperplasia and disorganized vessel growth associated with Notch antagonists 274. This mechanism of sprouting is persevered in tumors and indeed, blockade of Dll4 is sufficient to inhibit tumor growth. Paradoxically, Notch inhibition induces vascular hyperplasia albeit forming disorganized vasculature that is postulated to lack appropriate functionality as a nutrient delivery system 275. Intriguingly, these studies raise the question of whether the disorganized vascular niche would be capable of supporting self-renewal of cancer stem cells in close proximity. At the time of this writing, it is unclear whether self-renewal of neural and/or glioma stem cells are preferentially regulated by either tip cells or stalk cells. Whether vascular metaplasia can be co-opted to induce a favorable clinical outcome deserves investigation. Interestingly, there is recent evidence to demonstrate that glioma may make direct cell contributions to their own vascular niche in a mechanism utilizing Notch signaling. Ricci-Vitiani and colleagues demonstrated that the tumor vasculature contained CD31 + /CD144 + endothelial cells with the same chromosomal alterations as the tumor cells themselves, suggesting a tumor cell origin 276. Wang and colleagues demonstrated similar findings and interestingly found that differentiation of glioma stem cells into CD144 + endothelial cells was dependent upon active Notch signaling. Blockade of Notch with DAPT prevented the endothelial differentiation of CD133 + /CD144 - tumor cells but not CD105 + endothelial cells lacking tumor origin 277. The Notch signaling pathway may also preside over non-vascular elements of the stem cell niche. Extracellular matrix proteins (ECM) are often over expressed in tumors possess many

143 130 diverse functions such as formation of tumor architecture, protection from host immune surveillance, activation of cell surface ECM binding proteins and providing physical pathways for migration and dissemination 278. Within the spectrum of glioma and breast malignancies, expression of an ECM protein Tenascin-C is correlated with aggressiveness and is associated poor patient prognosis 279,280. Interestingly, TNC was recently discovered to be a direct target of activated Notch. Sivasankaran and colleagues demonstrated that the Tenascin-C promoter possesses RBP-jK binding sequence. Further, they demonstrated that Notch2 actively promotes transcription and protein production resulting in enhanced cell migration 281. While their study examined the effects of Notch blockade in serum derived glioma lines, their work provides compelling evidence that shows a multifaceted role for Notch in tumorigenesis that extends far beyond what is currently understood Insight from Neurodegenerative Disease Treatment The discovery of a rare subpopulation of tumorigenic cancer stem cells identifies an obvious therapeutic target. We have proven that some patient derived cancer stem cells possess a robust clonogenic frequency along with migratory abilities, thus it is not surprising that this disease frequently recurs at locations proximal to the original tumor 144. Identifying ways to target this rare cell population will be critical to improve survival of GBM patients beyond the current average of 14.6 months 143. In Chapter 2, as a proof of concept we have demonstrated that γsi is an effective Notch antagonist that induces lineage commitment in some CSCs. γ-secretase is not a novel therapeutic target and lessons from other fields of research could be adapted to target cancer. One strategy is to utilize the pharmacologic compounds developed for the treatment of Alzheimer s disease (AD). AD is a neurodegenerative disorder characterized by buildup of amyloid-β-protein senile plaques in the brain. The key step in pathology of this disease is γ- secretase cleavage of amyloid precursor protein (APP) 282 which subsequently forms insoluble protein aggregates which accumulate in the CNS. Existing therapies and research in AD have identified γ-secretase specific compounds which are well tolerated and effectively cross the blood brain barrier. One of these drugs is γsi LY (Semagacestat). This compound has successfully passed phase II clinical trials with well tolerated side effects and is currently in large scale phase III clinical trials 283. While many AD drugs are designed for APP specificity, there is evidence from clinical trials to demonstrate that these drugs have a Notch inhibitory effect. One such manifestation in LY trials was the reversible lightening of hair color in some

144 131 subjects. Interestingly, analogous effects were observed in several murine studies of the Notch pathway. The survival of melanoblasts and melanocyte stem cells, cell populations responsible for regulating hair pigmentation, is regulated in a Hes1 dependent mechanism. Abolishing Notch signaling by topical γsi treatment or melanoblast specific Hes1 knockouts induced apoptosis in these cell types which manifests as graying hair colour 284,285. Taken together, these human side effects in Alzheimer s treatments are indicative of Notch antagonism suggesting that existing drugs in advanced clinical trials could potentially be used to specifically block Notch in brain cancers. These clinical studies are even more significant due to progress in side effect management. Systemic Notch blockade at high doses have significant gastrointestinal effects due to the differentiation of goblet cells in the intestinal crypt niche 286,287. Recent studies have demonstrated that these effects can be mitigated by combination therapy with corticosteroids such as dexamethasone 214. Alternatively, targeting redundant Notch receptors with inhibitory antibodies 197 has been shown to circumvent intestinal goblet cell metaplasia. Thus, targeting Notch in glioma stem cells through existing Alzheimer s treatments may be a viable therapeutic strategy Therapeutic Specificity With the growing popularity of the CSC hypothesis, there is a strong emphasis on the development of therapies which distinguish CSCs from normal SCs to spare normal tissues and cells from the toxic effects of chemotherapy. As of yet, very few feasible targets for CSC specific therapy have been discovered. Underscoring this challenge, our microarray data show that CSC s from some glioma subgroups closely resemble normal neural stem cells and therefore distinguishing cancer from normal stem cells may be difficult based on gene expression. Thus our data and others highlight some of the fundamental controversies with CSC research: is it possible to specifically target CSCs with Notch signaling? If not, what are the ramifications of Notch blockade in the CNS? Few translational studies exist that can help answer these questions and therefore we must extrapolate animal studies to predict human effects. Blockade of Notch signaling in adult murine models induces neuronal commitment and depletion of the selfrenewing population over the long term 288. Interestingly, neuronal lineage induction appears to be functional as rats treated with γsi demonstrated enhanced contextual and spatial memory 219. The role of Notch signaling in memory formation is still poorly understood, however it appears as though canonical Notch/Hes downstream signaling is critical for memory formation in mouse

145 132 models 289,209. It is unknown whether the burst of neurogenesis followed by a deficiency in long term neural birth would be a perceptible effect in human patients. Under the extreme scenario, a global deficit in neurogenesis could recapitulate the dramatic effects observed in the patient H.M. This patient had a resection of the medial temporal lobe to alleviate severe epileptic seizures. In what is known to be a major contribution to the field of neuroscience, a side effect of this operation resulted in severe anterograde amnesia due to the complete removal of the hippocampus 290, a structure which harbors neural stem cells 67 and is critical for the formation of new declarative memories. In designing cancer treatments that aim to differentiate BTSCs, we must be cognizant of the chance that normal neural stem cells may be affected. Thus, the development of anterograde memory defects may be a sign of early neural stem cell depletion. Since there is a documented age related depletion of normal neural stem cells, these side effects may be more pronounced in older individuals and therefore this strategy may be contraindicated in patients determined to be at risk for memory defects 291. Although, considering the poor survival of patients with primary glioma, this trade-off may an acceptable compromise Forcing lineage choice as a treatment for cancer The identification of cancer stem cells with multi-lineage potential raises the prospect of forcing differentiation to a growth restricted cell type as cancer therapy. This approach has been used with great effect in ATRA therapy for PML but the mechanisms of steering lineage commitment is poorly understood in solid malignancies. Since ATRA therapy does not exert a therapeutic effect in other forms of leukemia 292, it clearly illustrates a need for understanding mechanisms regulating differentiation in each type of cancer. In a study examining the effect of Notch blockade in a Neu (N202) mouse model of breast cancer, it was found that pharmacologic Notch blockade was effective in reducing the tumorigenicity of the cancer initiating cells. When compared to vehicle controls these cells were found to express CK14 and/or α-sma, myoepithelial lineage markers 293. Indeed, in a clinical setting, absence of CK14 can be associated with ductal carcinoma and expression of α-sma is often associated with benign papilloma 294. We have demonstrated that we can induce robust neuronal lineage differentiation in a subset of glioblastoma stem cell lines upon Notch blockade. However, if we can steer differentiation to one of the three cell fates in the brain (neuron, astrocyte, oligodendrocytes), which cell fate would be most limited in proliferative potential and thus the most useful in cancer treatment? Gross and colleagues demonstrated that astrocytes can be induced through

146 133 stimulation of the bone morphogenic protein (BMP) signaling pathway 295,296. Interestingly, despite the expression of glial markers, cell counts of NSCs after BMP treatment revealed a small, but significant increase in the number of cells compared to controls suggesting some proliferative capacity in BMP induced astrocytes. Their study supports other observations that show proliferation of glial cells in-vitro 297. Cells positive for other glial markers like A2B5 298 and S100β 299,300 all retain some degree of proliferative ability suggesting that glial lineage may be an undesirable fate for cancer stem cells. In contrast, our data and others support the finding that neuronal precursors are less proliferative. Differentiation of E14.5 neurospheres with BDNF results in cells that fail to incorporate BrdU showing that neuronal lineage is more restricted than other subtypes found in the CNS 297. Determining a linage that is most growth restricted is an endeavour deserving careful and cautious interpretation. For instance, medulloblastomas are malignant tumors manifesting in the cerebellum of primarily paediatric patients. These tumors possess a primitive phenotype and proliferate rapidly, yet express neuronal signature. Expression of neuron specific markers such as NeuN, synaptophysin and MAP-2 is common upon gross pathological evaluation of these primitive tumors 301,302. However, functional differentiation is still possible in this class of brain tumors. For instance, mir-34a which negatively regulates Notch through Dll1 downregulation induces neurite outgrowth and diminishes tumorigenicity in a Patched1 +/- P53 -/- model of medulloblastoma 303. Treatment directly with γsi is known to induce functional neuronal differentiation in these cancers 304. Indeed, mouse models of medulloblastoma have illustrated a hierarchical organization of these tumors. Less differentiated cell populations expressing CD15 give rise to the marker positive cells lower in the tumor hierarchy and are commonly seen in immunohistochemical staining 130. In the context of neuronal differentiation, these studies underscore the importance of probing for functional differentiation and highlight the fact that neuronal marker expression is insufficient as a determinant of differentiation. Therefore, neuronal differentiation of glial brain tumors may be the most desirable outcome in cancer therapy Glioblastoma prevention Considering the severity of malignant glioma, what are the known risk factors associated with glioma and what are the countermeasures that can be employed in the prevention of this disease? γ-secretase is a known target for several different pharmacological compounds. One large class of compounds are non-steroidal anti-inflammatory drugs (NSAIDs). Ubiquitous NSAIDs such

147 134 as ibuprofen and flurbiprofen rapidly pass through the blood brain barrier 305 and are known to inhibit γsi function by allosteric inhibition 306. Therefore, is it possible that long term use of these drugs may suppress aberrant Notch signals and prevent/delay brain cancer development? An epidemiological study by Sivak-sears et al., showed that there was a significant inverse association of long term NSAID use and GBM incidence. Glioblastoma patients were less likely than control individuals to have consumed more than 600 doses of NSAIDs over a 10 year period 307. Furthermore, patients who regularly consumed NSAIDs such as acetylsalicylic acid (Aspirin) which does not have the capacity to block APP processing by γ-secretase 308 did not demonstrate as significant a preventative trend in cancers outside of the gastrointestinal tract 309. Surprisingly, there are few studies examining the role of NSAIDs on Notch signaling and none investigating the effect of NSAIDs and other Cox-2 inhibitors in cancer stem cells. One recent study has shown that ibuprofen is effective at blocking Notch activation in serum cultured lines derived from adenocarcinoma of the colon 310. Thus, the use of relatively safe and ubiquitous NSAIDs is a preventative treatment that should be considered in patients with a familial risk of cancer Origins and mechanisms of brain tumors A neural stem cell as the cancer stem cell Brain cancers have for generations been thought to arise solely due to transforming events occurring in glial cells in the CNS 311. This method of thinking was due, in part, to the poor understanding of normal brain plasticity and the dogma that the brain was solely a post-mitotic organ 312,313. There is now a wealth of knowledge to support the existence of self-renewing populations of neural stem cells residing in multiple regions of the mammalian brain 67,60,314. Considering the capacity for self-renewal and ability to proliferate rapidly in response to injury 315,316,317, a reasonable hypothesis is that gliomas are most likely originate from transformed neural stem cells and not from post mitotic neurons or astrocytes. Indirect evidence to support this hypothesis exists from insightful experiments conducted by Hopewell and Wright in the 1960 s. To induce glioma in rat models the researchers implanted a carcinogenic pellet in various regions of the brain. Placement of the transforming agent adjacent to the subventricular zone dramatically increased the frequency of cancer compared to other regions 318. A more recent study has shown that conditional inactivation of tumor suppressors p53, nf1 and Pten in

148 135 Nestin positive stem and/orprogenitor cells of the murine brain were sufficient to induce malignant astrocytomas 319. Additional evidence stems from studies where lentiviral vectors were employed to transduce cells with h-ras and Akt in various regions of the mouse brain. Consistent with previous experiments where Ras and Akt expression in Nestin and not GFAP positive cells induced cancer 320, tumors were only observed when injection of virus occurred in the proliferative regions: the subventricular zone and hippocampus 321. Ultimately, while a growing body of evidence points to neural stem cells as a cell of origin in CNS tumors, this may not be the rule in all forms of cancer. Recent reports suggest that peripheral nerve sheath tumors arising in the peripheral nervous system have a more differentiated cell of origin 322,323 and thus these problems must be solved through careful and thorough characterization. Delinating the cell of origin for tumors is significant beyond simple scientific curiosity. Understanding how and when genetic lesions accululate in a succeptible cell population could be important in the prevention and management of disease. From an anatomic standpoint, understanding where cancers are most likely to originate can greatly aid in screening and prevention of advanced malignancies. From a biochemical standpoint, many cell signaling dependancies are preserved in the pathological population, and thus understanding lesions arising in the cell of origin provides new rationales for directed treatment. Indeed, in the context of this thesis, comparison to human fetal stem cells was crucial to identify exploitable vulnerabilities in the cancer initiating cell Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells Stem cells undergo a tightly regulated process where they generate additional stem cells or differentiate into progeny progenitor cells with a more committed phenotype. A mitotic event where both of the above cell types are generated is asymmetric self-renewal which occurs with regularity in most postnatal stem cells and is a requisite event in tissue homeostasis. Stem cells also possess capacity for clonal expansion, a symmetrical self renewal event generating two identical cells which is an important process during developmental patterning 324 or injury response 325. If the cell of origin is a stem cell, is it possible that a lesion in this cell type would favor symmetric cancer stem cell expansion over asymmetric self-renewal? Cicalese and colleagues demonstrated that mammary stem cells predominantly undergo asymmetric self renewal, generating a predictable cluster of five cells over three cell generations. They

149 136 documented a cytoplasmic fluorescent label retaining stem cell dividing once to maintain its number, and rapidly dividing progenitors dividing twice to generate four daughters. Interestingly, Erbb2 transformed mammary stem cells generated a cluster of eight cells with equal label retention over the same period of time, reflecting three-generations of symmetric division 326. In the studies we have conducted, human fetal cells expand symmetrically, likely representing the highly proliferative developmental state from which they were derived and the inherent bias towards clonal expansion that is due to the NS culture system. The hypothesis that normal human neural stem cells become transformed and shift from asymmetric to symmetric self renewal is a theory that is difficult to address owing to the technical challenges and lack of donor samples. In our study we are able to demonstrate that inducing asymmetric self-renewal can decrease tumorigenesis in xenograft models. Using pharmacologic inhibitors of Notch we demonstrated that we are able to induce asymmetric self renewal events in glioma cell lines programmed to symmetrically self-renew. Our data has important implications for patient treatment strategies and mechanisms of disease recurrence. Other studies using glioma stem cells show that γ-secretase blockade results in an proliferative deficit primarily due to an increase in apoptosis 139. To building upon prior works, in addition to apoptosis, we have proven that the proliferative deficit is due to neuronal lineage commitment of a daughter progenitor cell from an asymmetrically self-renewing cancer stem cell. We are able to resolve these functional differences in our in-vivo orthotopic strategy and replating experiments. Fan and colleagues conducted in-vivo experiments with persistent administration of γsi soaked polymer beads, an approach that may be subject to variations in dosage in-situ in addition to the potential for very high proximal concentrations of γsi that may induce non-specific toxicity. Our ex-vivo approach has the advantage of revealing remission status, a common occurrence in individuals with high grade glioma Cancer as a caricature of development Cancer has previously been described as a mockery of normal tissue development, often containing multiple histological characteristics of the different cell types derived from the originating embryonic germ layer. Therefore, is it possible that a brain tumor can recapitulate a specific stage in development? Lee and colleagues observed that glioma stem cells derived from patient GBM were sensitive to BMP treatment and express lineage markers in response to BMPR activation. Interestingly, they also observed that some patient CSCs increased proliferation and

150 137 failed to differentiate in response to BMPs. They postulated that this was due to mimicry of the primitive E11 murine stage of development which is insensitive to BMP signals whereas the majority of BMP responsive lines were BMPR1B positive and recapitulated the later stages of embryonic neural stem cells 327. Our study and others 212, have characterized a proneural expression profile amongst a subset of glioma. We have demonstrated that this subset, characterized by high Dll3 and Ascl1 expression, acquires neuronal lineage markers upon Notch blockade. Are there cell types in the normal developing mouse forebrain with similar patterns of expression? At E12.5 in murine development, neural stem cells highly express neurogenin1/2 and Mash1 to promote a neurogenic program and induce neuronal differentiation. E14.5 cortical precursors, in contrast are programmed for glial differentiation to support growth and development existing neurons. Thus, these glial programmed cells are refractory to ectopic expression of Mash In our observations, neurogenic glioblastoma lines genetically resemble the early E12.5 stage in development whereas non-neurogenic lines appear to recapitulate the glial stages of development commonly seen at E14.5 and later. Indeed, we have shown that glial phenotypes persist in this class of NS lines even when Ascl1 expression is rescued by Notch/Hes blockade, suggesting insensitivity to the neurogenic effects of Ascl1. Additionally, Hirabayashi and colleagues showed that E11.5 early neural progenitors are responsive to stabilized β-catenin and undergo neurogenesis, an effect that diminishes in late culture neurospheres and the more mature embryonic forebrain SCs. Electroporation of Wnt3A in the E13.5 cortex also promotes ectopic neuronal growth resulting in cortical dysplasia and neuronal heterotopia. Correspondingly, electroporation of Dkk1 at E13.5 or E15.5 reduces the prevalence of Ctip2 and Cux1 positive neurons respectively 329. Further, NSCs derived from E17.5 embryos are not responsive to Wnt pathway activation 330. Indeed, this hypothesis is supported by our synergistic experiments with Wnt agonists. We showed that activation of the Wnt signaling pathway by blockade of GSK-3β effectively synergizes with Notch antagonists in neurogenic lines but not non-neurogenic lines. Taken together, human glioblastoma stem cells can be functionally classified into groups that recapitulate normal stages of CNS development (Figure 5-1). Identifying the patterns of gene expression which label CSCs as resembling early or late neural precursors may allow us to predict to the responsiveness of glioblastoma to certain pathway agonists/antagonists and lead to the development of tailored patient therapies.

151 138 Figure 4-2 NS lines recapitulate stages of embryonic neocortical development. Glioma and human fetal neural stem cell lines demonstrate features of gene expression and neurogenic response to signaling pathway activation that resemble stages of murine development. Based upon the lineage marker in response to Notch antagonists and Wnt agonists, NS lines can be putatively stratified into groups resembling early neurogenic stem cells (E10-E14) or late-stage astrogenic (E14-P0) stem cells.