Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

Size: px
Start display at page:

Download "Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)"

Transcription

1 Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils

2 Hematopoiesis and the Microenvironment (Figure by Winslow & Kibiuk; Stem Cells: Scientific Progress and Future Research Directions, 2001)

3 Definition of the adult hematopoietic stem cell Adult = 4 weeks old (mouse); 2 4 years (human) Reside in the bone marrow; can be mobilized to enter the periphery Multipotent: Can differentiate into any hematopoietic lineage Able to self-renew: Long-term vs. short-term Only cell capable of long-term hematopoietic reconstitution (Makes bone marrow transplant possible) Quiescent: Majority (75-80% in G0 at any one time)

4 Rossi, et al., Cell Stem Cell, 2012 Tests of HSC Function

5 Immunophenotyping of HSCs Lineage depletion (negative selection) - Based on findings that cells that gave rise to B-cell colonies in vitro were B220-negative (B220 = B-cell specific antigen) Prospective isolation - Use of antigens expressed on the surface of putative HSCs - Detection using multiparameter flow cytometry

6 Immunophenotyping of HSCs Whole Bone Marrow Lin- Cells Side Scatter 5.0% c-kit 0.18% Lineage Markers Sca-1 CD34 Lin-, Sca-1+, c-kit+ CD150+, CD48- CD % CD % Forward Scatter CD48

7 Testing HSC Function through BMT Lethal Irradiation Test Cells + Competitor/ Radioprotective Cells Analyze blood every 4 weeks Analyze marrow at 16 weeks Evidence of HSC requires multi-lineage engraftment at > 16 weeks At earlier time points, myeloid cells (short life-span) surrogate of HSCs Test and Donor (preferably competitor too) must be distinguishable e.g. CD45 markers, GFP Differences in engraftment must be attributable to test variable

8 In Vivo Lifespan of Purified Hematopoietic Populations Long Term (LT)-HSC (> 4 months) Short Term (ST)-HSC ( 2 3 months) Multipotent Progenitors (MPP) ( 6 8 weeks) Lymphoid Progenitors Myeloid Progenitors ( 6 8 weeks) ( 1 2 weeks)

9 Testing HSC Self-Renewal through Serial BMT Primary Recipient Secondary Recipient Tertiary Recipient Bone Marrow Cells HSC HSC MP Repopulating Potential Decreases After Each Transplant Serial Transplant Mimics HSC Aging

10 HSC Quiescence Lin-, Sca-1+, c-kit+ CD150+, CD48- Ki-67 ST-HSC 22.6% 5.12% CD % CD34- LT-HSC 22.1% 0.42% Ki % Hoescht Dye

11 Proliferation of Hematopoietic Stem and Progenitors Long Term HSC Short Term HSC Multipotent Progenitor Committed Progenitor

12 HSC Quiescence 1) Positive Regulation (Examples) - Stem cell factor (ligand for c-kit) - Thrombopoietin - SDF-1α (necessary for HSC homing and retention) - Wnt Ligands (e.g. Wnt5a) - Hypoxic profile (high Hif-1α, low O 2 tension) - Pdk2/4 (maintains quiescence through anaerobic glycolysis) - Cell Cycle Regulators (Cdkn1a) - Transcription Factors (e.g., Gfi1, Mll, Pten, Fbxw7, Pbx1) 2) Negative Regulation (Examples) - Bone marrow injury (molecular data unclear) - Mobilization of stem cells to the periphery - Reactive oxygen species (increased oxidative stress) - Bacterial infection via interferon alpha/gamma Link between quiescence and function ( exhaustion ) is frequently observed but is not absolute; context is critical

13 HSC Quiescence 1) Quiescent: Majority (75-80% in G0 at any one time) 2) Adult quiescent HSCs are superior to cycling HSCs in repopulating hematopoiesis 3) Conserves long-term HSC function (replicative senescence) 4) Dormant HSCs can be activated and then resume dormancy 5) Stress vs. homeostasis is likely a critical variable

14 4) Dormant HSCs can be activated and then resume dormancy (Wilson, et al., Cell, 2008) Label Retaining Assay Cell Division Inversely Associated with Label Intensity 5-Fluorouracil: Induces HSC Proliferation BrdU: Thymidine Analogue Incorporates Into DNA BrdU+ Cells at day 0 post-chase BrdU+ Cells at 70 days post-chase

15 Does Activation During Stress Differ than Homeostasis? (Qiu, et al., Stem Cell Rep, 2014) Label Retaining Assay TetON-GFP

16 Does Activation During Stress Differ than Homeostasis? (Qiu, et al., Stem Cell Rep, 2014)

17 The HSC Microenvironment Specialized microenvironment that supports HSC function Schofield R, Blood Cells, Hypothesized the presence of a stem cell niche in the marrow 1. Defined anatomical site 2. Allows for maintenance of stem cell 3. Prevents differentiation 4. Niche space is limited 5. Occupation of niche by differentiated cell causes reversion to stem cell phenotype

18 Anatomy of the HSC Niche HSCs preferentially reside in the trabecular bone area Evidence suggests HSCs reside at or near the endosteal surface (Distinct perivascular niche?) Endosteum is comprised of multiple cell lineages (osteoblast, vascular, MSCs) Niche regulates HSC function by: 1) Cell-cell contact 2) Release of soluble factors Reya and Clevers, 2005

19 Reciprocal Transplantation Assay W (White, W = c-kit severe receptor anemia) Sl Sl (Steel, = stem severe cell factor anemia) Wild-type mice Donor Host No effect on anemia Rescued anemia Rescued anemia No effect on anemia

20 HSC Fate: Stochastic or Instructive? As age increases, the percentage of myeloid cells of the total bone marrow also increases

21 Pre-Determination of HSC Fate Hundreds of mice transplanted with single purified HSC (Dykstra, et al, Cell Stem Cell, 2007) Blue = α, myeloid biased Magenta = β, balanced Green/Yellow = γ + δ, lymphoid biased

22 Pre-Determination of HSC Fate Secondary Transplants Blue = α, engrafted, durable self-renewal Magenta = β, engrafted, durable self-renewal Green/Yellow = γ + δ, did not engraft, no self-renewal Differentiation programs can be stable, but there is significant conversion between programs

23 Pre-Determination of HSC Fate Side-Population: Dye Efflux Property of HSCs Challen, et al., Cell Stem Cell, 2010

24 Hierarchy of Pre-Determined HSCs vwf-egfp Transgenic Mice Sanjuan-Pla, et al., Nature, 2013

25 Hierarchy of Pre-Determined HSCs vwf-gfp+ HSCs can repopulate GFP+/GFP- HSCs but GFP- HSCs can not repopulate GFP+ HSCs Platelet/Myeloid biased HSCs are more apical than lymphoid biased HSCs

26 Hematopoietic Hierarchy: An Evolving Model Quiescent HSC Mechanisms Controlling Dormancy/Self-Renewal Critical for Leukemia Mitotic HSC (Platelet/Myeloid Biased) Mitotic HSC (Lymphoid Biased) Mediate Reconstitution During BMT Megakaryocyte/ Myeloid Progenitors Lymphoid Progenitors

Haematopoietic stem cells

Haematopoietic stem cells Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An

More information

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)

More information

Chronic variable stress activates hematopoietic stem cells

Chronic variable stress activates hematopoietic stem cells SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur

More information

Getting to the root of Cancer

Getting to the root of Cancer Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview

More information

ANAT3231: lectures overview

ANAT3231: lectures overview ANAT3231: lectures overview Stem Cell Biology Stem Cell Technology Resources: http://php.med.unsw.edu.au/cell biology/ Essential Cell Biology 3 rd edition Alberts Dr Annemiek Beverdam School of Medical

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages

More information

ANAT3231: lectures overview

ANAT3231: lectures overview ANAT3231: lectures overview Stem Cell Biology Stem Cell Technology Resources: http://php.med.unsw.edu.au/cell biology/ Essential Cell Biology 3 rd edition Alberts Dr Annemiek Beverdam School of Medical

More information

THE HYPOXIC HEMATOPOIETIC STEM CELL NICHE Consequences of Hypoxiainduced Transcription on Stem Cell Fate

THE HYPOXIC HEMATOPOIETIC STEM CELL NICHE Consequences of Hypoxiainduced Transcription on Stem Cell Fate THE HYPOXIC HEMATOPOIETIC STEM CELL NICHE Consequences of Hypoxiainduced Transcription on Stem Cell Fate Rehn, Matilda Published: 2011-01-01 Link to publication Citation for published version (APA): Rehn,

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells

Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.

More information

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell

Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell Abstract Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell niche is a microenvironment of cells that maintain stem cell functionality, and one example is the

More information

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15 Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen

More information

The Role of Rac Signaling in The Perivascular Niche

The Role of Rac Signaling in The Perivascular Niche The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell

More information

DISCLOSURE. I have the following financial relationships:

DISCLOSURE. I have the following financial relationships: DISCLOSURE I have the following financial relationships: Consultant for: Fate Therapeutics, GlaxoSmithKline, Bone Therapeutics, G1 Therapeutics Contracted Research for: GlaxoSmithKline Royalties from:

More information

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

New Insights into the Regulation of Hematopoietic Stem Cell Self-Renewal

New Insights into the Regulation of Hematopoietic Stem Cell Self-Renewal New Insights into the Regulation of Hematopoietic Stem Cell Self-Renewal By Morgan Jones A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cellular

More information

Molecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D.

Molecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D. Molecular Characterization of Leukemia Stem Cell Development Scott A. Armstrong MD, Ph.D. Normal and Leukemic Hierarchies NORMAL HSC (SRC) Myeloid progenitor LTC-IC CFU AML LSC (SL-IC) Leukemic LTC-IC

More information

HSC Niche Biology and HSC Expansion Ex Vivo

HSC Niche Biology and HSC Expansion Ex Vivo Feature Review HSC Niche Biology and HSC Expansion Ex Vivo Sachin Kumar 1, * and Hartmut Geiger 1,2,3, * Hematopoietic stem cell (HSC) transplantation can restore a new functional hematopoietic system

More information

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figure 1. Successful excision of genes from WBM lysates and Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was

More information

The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells

The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Research article The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Sungho Kook, 1 Joonseok Cho, 1 Sean Bong Lee, 2 and Byeong-Chel Lee 1 1 University of Pittsburgh

More information

The Role of the Embryonic Microenvironment in Hematopoietic Cell Development

The Role of the Embryonic Microenvironment in Hematopoietic Cell Development The Role of the Embryonic Microenvironment in Hematopoietic Cell Development The Role of the Embryonic Microenvironment in Hematopoietic Cell Development De rol van de embryonale micro-omgeving op de

More information

Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr )

Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr ) Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr 130259) The main goal of this project focuses on establishing

More information

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

Clonal Diversity of Blood-forming Stem Cells: Now What?

Clonal Diversity of Blood-forming Stem Cells: Now What? Clonal Diversity of Blood-forming Stem Cells: Now What? February 12, 2014 Leukemia: Microscope, utopsy, Rabbits and Cell Theory Early data and interpretation theories of a newly recognized cancer ( 170

More information

TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis

TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis AD Award Number: W81XWH-05-1-0608 TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis PRINCIPAL INVESTIGATOR: Craig T. Jordan, Ph.D. CONTRACTING ORGANIZATION:

More information

SUPPLEMENTARY INFORMATION doi: /nature12026

SUPPLEMENTARY INFORMATION doi: /nature12026 doi:1.138/nature1226 a 4 35 3 MCSF level (pg/ml) 25 2 15 1 5 1h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect

More information

Stress-induced haematopoietic stem cell proliferation: new roles for p38α and purine metabolism

Stress-induced haematopoietic stem cell proliferation: new roles for p38α and purine metabolism Editorial Stress-induced haematopoietic stem cell proliferation: new roles for p38α and purine metabolism Victoria A. McGuire 1, J. Simon C. Arthur 2 1 Photobiology Unit, Ninewells Hospital and Medical

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS a Division of Stem Cell Therapy, b Stem Cell Bank, Center for Stem Cell Biology and Regenerative Medicine, f Laboratory of Molecular Pathogenesis, Center for Experimental Medicine

More information

Normal & Leukaemic haematopoiesis. Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore

Normal & Leukaemic haematopoiesis. Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore Normal & Leukaemic haematopoiesis 2010 Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore Use of Immunophenotyping today Lineage assignment Differentiation of

More information

Ash1l controls quiescence and self-renewal potential in hematopoietic stem cells

Ash1l controls quiescence and self-renewal potential in hematopoietic stem cells The Journal of Clinical Investigation Research article Ash1l controls quiescence and self-renewal potential in hematopoietic stem cells Morgan Jones, 1,2,3 Jennifer Chase, 1,2 Michelle Brinkmeier, 4 Jing

More information

Hematopoiesis/Hematopoiesis Physiology

Hematopoiesis/Hematopoiesis Physiology Hematopoiesis/Hematopoiesis Physiology Definitions Hematopoiesis is the process of continuous generation of mature blood cells in the bone marrow (Figure 1). Blood cells represent different kinds of mature

More information

Targeting Tetramer-Forming GABPb Isoforms Impairs Self-Renewal of Hematopoietic and Leukemic Stem Cells

Targeting Tetramer-Forming GABPb Isoforms Impairs Self-Renewal of Hematopoietic and Leukemic Stem Cells Article Targeting Tetramer-Forming GABPb Isoforms Impairs Self-Renewal of Hematopoietic and Leukemic Stem Cells Shuyang Yu, 1 Xuefang Jing, 1,4 John D. Colgan, 2,3 Dong-Mei Zhao, 1,2 and Hai-Hui Xue 1,3,

More information

Blood 101 Introduction Blood and Marrow & Overview of Bone Marrow Failure Diseases. Dr. M. Sabloff October 16 th 2010

Blood 101 Introduction Blood and Marrow & Overview of Bone Marrow Failure Diseases. Dr. M. Sabloff October 16 th 2010 Blood 101 Introduction Blood and Marrow & Overview of Bone Marrow Failure Diseases Dr. M. Sabloff October 16 th 2010 Normal Marrow knee joint white is articular cartilage Adjacent to this is the red marrow

More information

Functional ramifications for the loss of P-selectin expression on hematopoietic and leukemic stem cells

Functional ramifications for the loss of P-selectin expression on hematopoietic and leukemic stem cells University of Massachusetts Medical School escholarship@umms GSBS Student Publications Graduate School of Biomedical Sciences 2011-09-23 Functional ramifications for the loss of P-selectin expression on

More information

Impaired DNA replication within progenitor cell pools promotes leukemogenesis

Impaired DNA replication within progenitor cell pools promotes leukemogenesis Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

The DARC-CD82 axis discloses bone marrow macrophages as guardians of long-term hematopoietic stem cells quiescence

The DARC-CD82 axis discloses bone marrow macrophages as guardians of long-term hematopoietic stem cells quiescence Commentary Page 1 of 5 The DARC-CD82 axis discloses bone marrow macrophages as guardians of long-term hematopoietic stem cells quiescence Alejandro Pérez-Fernández, Ángel Hernández-Hernández Department

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Muscle Stem Cells in Regeneration

Muscle Stem Cells in Regeneration Muscle Stem Cells in Regeneration Dr. F Jeffrey Dilworth BIM6028/SMC6052 Lecture (February 11, 2016) Duchenne Muscular Dystrophy is an X-linked genetic disorder that affects 1 in 3500 males Wells et al,

More information

Identification of a Stroma-Mediated Wnt/b-Catenin Signal Promoting Self-Renewal of Hematopoietic Stem Cells in the Stem Cell Niche

Identification of a Stroma-Mediated Wnt/b-Catenin Signal Promoting Self-Renewal of Hematopoietic Stem Cells in the Stem Cell Niche THE STEM CELL NICHE Identification of a Stroma-Mediated Wnt/b-Catenin Signal Promoting Self-Renewal of Hematopoietic Stem Cells in the Stem Cell Niche JIN-A KIM, a YOUNG-JU KANG, a GYEONGSIN PARK, a MYUNGSHIN

More information

Supplementary Materials Extracting a Cellular Hierarchy from High-dimensional Cytometry Data with SPADE

Supplementary Materials Extracting a Cellular Hierarchy from High-dimensional Cytometry Data with SPADE Supplementary Materials Extracting a Cellular Hierarchy from High-dimensional Cytometry Data with SPADE Peng Qiu1,4, Erin F. Simonds2, Sean C. Bendall2, Kenneth D. Gibbs Jr.2, Robert V. Bruggner2, Michael

More information

T cell manipulation of the graft: Yes

T cell manipulation of the graft: Yes T cell manipulation of the graft: Yes J.H. Frederik Falkenburg Department of Hematology L M U C Allogeneic Hematopoietic Stem Cell Transplantation (SCT) for non-malignant disorders: no need for anti-tumor

More information

Cell signalling pathways in the HSC niche. Dr. Abdullah Aljedai

Cell signalling pathways in the HSC niche. Dr. Abdullah Aljedai Cell signalling pathways in the HSC niche Dr. Abdullah Aljedai 31-10-2009 Learning objectives & resources 1- To introduce the concept of cell signaling process in the haemopoietic system. 2- To outline

More information

Necdin modulates leukemia-initiating cell quiescence and chemotherapy response

Necdin modulates leukemia-initiating cell quiescence and chemotherapy response /, 2017, Vol. 8, (No.50), pp: 87607-87622 Necdin modulates leukemia-initiating cell quiescence and chemotherapy response Chonghua Yao 1,*, Michihiro Kobayashi 2,*, Sisi Chen 3, Sarah C. Nabinger 2, Rui

More information

Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte-macrophage colonystimulating factor (G-CSF).

Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte-macrophage colonystimulating factor (G-CSF). Hematopoietic Growth Factors Colony Stimulating Factors. Erythropoietin (Epoetin alfa). Granulocyte colony-stimulating factor(g-csf). Granulocyte-macrophage colonystimulating factor (G-CSF). Interleukin-11

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Wnt5a Regulates Hematopoietic Stem Cell Proliferation and Repopulation Through the Ryk Receptor BENJAMIN J. POVINELLI, a MICHAEL J. NEMETH b,c Key Words. Hematopoietic Stem Cells

More information

September 20, Submitted electronically to: Cc: To Whom It May Concern:

September 20, Submitted electronically to: Cc: To Whom It May Concern: History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).

More information

THE EFFECTS OF EXERCISE ON HEMATOPOIESIS

THE EFFECTS OF EXERCISE ON HEMATOPOIESIS THE EFFECTS OF EXERCISE ON HEMATOPOIESIS THE EFFECTS OF EXERCISE ON HEMATOPOIESIS AND THE DEVELOPMENT OF THE HEMATOPOIETIC STEM CELL NICHE BY JEFFREY M. BAKER, H.BSc, MSc A Thesis Submitted to the School

More information

Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED

Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We

More information

T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015

T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015 T Cell Development Xuefang Cao, MD, PhD November 3, 2015 Thymocytes in the cortex of the thymus Early thymocytes development Positive and negative selection Lineage commitment Exit from the thymus and

More information

UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT

UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT Mitchell E. Horwitz, MD Duke University Medical Center Duke Cancer Institute

More information

Transfer protocol of human HSC into NOG mice

Transfer protocol of human HSC into NOG mice Transfer protocol of human HSC into NOG mice Mice: Adult NOG mice are aged 8-12 weeks. Newborn mice are 1 2 days old. 8-12 week old NOG mice irradiated with 2.5 Gy Intravenous transfer of 1-0.5 x 10 5

More information

SEVENTH EDITION CHAPTER

SEVENTH EDITION CHAPTER Judy Owen Jenni Punt Sharon Stranford Kuby Immunology SEVENTH EDITION CHAPTER 16 Tolerance, Autoimmunity, and Transplantation Copyright 2013 by W. H. Freeman and Company Immune tolerance: history * Some

More information

required for AML growth

required for AML growth PhD degree in Molecular Medicine Curriculum in Molecular Oncology European School of Molecular Medicine (SEMM) University of Milan and University of Naples Federico II Faculty of Medicine (MED/4) in vivo

More information

Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model

Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Yubin Kang 1, Benny J. Chen 2, Divino DeOliveira 2, Jeffrey Mito 2, Nelson

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Production of the Formed Elements (Chapter 11) *

Production of the Formed Elements (Chapter 11) * OpenStax-CNX module: m62120 1 Production of the Formed Elements (Chapter 11) * Ildar Yakhin Based on Production of the Formed Elements by OpenStax This work is produced by OpenStax-CNX and licensed under

More information

Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity

Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity Research article Related Commentary, page 22 Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity Amie S. Corbin, 1,2 Anupriya Agarwal, 1 Marc Loriaux,

More information

One Day BMT Course by Thai Society of Hematology. Management of Graft Failure and Relapsed Diseases

One Day BMT Course by Thai Society of Hematology. Management of Graft Failure and Relapsed Diseases One Day BMT Course by Thai Society of Hematology Management of Graft Failure and Relapsed Diseases Piya Rujkijyanont, MD Division of Hematology-Oncology Department of Pediatrics Phramongkutklao Hospital

More information

Myeloproliferative Disorders - D Savage - 9 Jan 2002

Myeloproliferative Disorders - D Savage - 9 Jan 2002 Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,

More information

Haematopoietic stem cell (HSC) niches are present in diverse tissues

Haematopoietic stem cell (HSC) niches are present in diverse tissues REVIEW doi:10.1038/nature12984 The bone marrow niche for haematopoietic stem cells Sean J. Morrison 1 & David T. Scadden 2 Niches are local tissue microenvironments that maintain and regulate stem cells.

More information

Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells

Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells Ischemic Stroke Activates Hematopoietic Bone Marrow Stem Cells Gabriel Courties*, Fanny Herisson*, Hendrik B. Sager, Timo Heidt, Yuxiang Ye, Ying Wei, Yuan Sun, Nicolas Severe, Partha Dutta, Jennifer Scharff,

More information

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, M irector, Hemotherapy and Stem Cell Processing Facility Bone Marrow Can Cure: Leukemia Lymphoma Multiple Myeloma Genetic iseases:

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS IGF-1-Mediated Osteoblastic Niche Expansion Enhances Long-Term Hematopoietic Stem Cell Engraftment After Murine Bone Marrow Transplantation ANNA CASELLI, a,b TIMOTHY S. OLSON,

More information

MicroRNA-223 regulates granulopoiesis but is not required for HSC maintenance in mice

MicroRNA-223 regulates granulopoiesis but is not required for HSC maintenance in mice Washington University School of Medicine Digital Commons@Becker Open Access Publications 2015 MicroRNA-223 regulates granulopoiesis but is not required for HSC maintenance in mice Maria C. Trissal Washington

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

Duchez P, Chevaleyre J, Dazey B, Vlaski M, Ivanovic Z.

Duchez P, Chevaleyre J, Dazey B, Vlaski M, Ivanovic Z. EX-VIVO EXPANSION OF CORD BLOOD HEMATOPOIETIC STEM AND PROGENITOR CELLS FOR TRANSPLANTATION USING AN ANTIOXYDANT-SUPPLIED MEDIUM AND A CYTOKINE COCKTAIL INDUCING HYPOXIC-LIKE CELLULAR RESPONSE Duchez P,

More information

Imtiyaz et al., Fig. S1

Imtiyaz et al., Fig. S1 . Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are

More information

TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression

TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,

More information

Hosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information)

Hosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information) TaqMan assay Gene TRIM28 GATA-1 Applied Biosystems TaqMan assay Mm00495594_m1 Mm01352636_m1 SYBR Green assay Gene Forward primer Reverse primer Reference adult α-globin CCCGGTGCCTTGTCTGCT GTGAAATCGGCAGGGTGG

More information

CANCER STEM CELLS. CD150 2 Side Population Defines Leukemia Stem Cells in a BALB/c Mouse Model of CML and Is Depleted by Genetic Loss of SIRT1

CANCER STEM CELLS. CD150 2 Side Population Defines Leukemia Stem Cells in a BALB/c Mouse Model of CML and Is Depleted by Genetic Loss of SIRT1 CANCER STEM CELLS CD150 2 Side Population Defines Leukemia Stem Cells in a BALB/c Mouse Model of CML and Is Depleted by Genetic Loss of SIRT1 ZHIQIANG WANG, a CHING-CHENG CHEN, b WENYONG CHEN a Key Words.

More information

TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse. REPORT DATE: September 2014

TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse. REPORT DATE: September 2014 AWARD NUMBER: W81XWH-13-1-0245 TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse PRINCIPAL INVESTIGATOR: Stephanie Halene CONTRACTING ORGANIZATION: Yale

More information

Hemopoietic Precursors in Human Bone Marrow Transplantation

Hemopoietic Precursors in Human Bone Marrow Transplantation International Journal of Cell Cloning 4: 11-18 Suppl 1 (1986) Hemopoietic Precursors in Human Bone Marrow Transplantation H.A. Messner Ontario Cancer Institute, University of Toronto, Toronto, Ontario,

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

Spleens of myelofibrosis patients contain malignant hematopoietic stem cells

Spleens of myelofibrosis patients contain malignant hematopoietic stem cells Research article Spleens of myelofibrosis patients contain malignant hematopoietic stem cells Xiaoli Wang, 1 Sonam Prakash, 2 Min Lu, 1 Joseph Tripodi, 1 Fei Ye, 1 Vesna Najfeld, 1 Yan Li, 1 Myron Schwartz,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-13-1-0057 TITLE: Role of TIRAP in Myelodysplastic Syndromes PRINCIPAL INVESTIGATOR: Linda Ya-ting Chang CONTRACTING ORGANIZATION: British Columbia Cancer Agency Branch Vancouver,

More information

EHA an overview. Christine Chomienne EHA President.

EHA an overview. Christine Chomienne EHA President. EHA an overview Christine Chomienne EHA President www.ehaweb.org EHA activities Career development Calls are open now EHA Learning Center Annual congress EHA promotes excellence in research, education

More information

Modulation de la différenciation lymphocytaire T par thérapie cellulaire et génique dans le thymus. Valérie Zimmermann

Modulation de la différenciation lymphocytaire T par thérapie cellulaire et génique dans le thymus. Valérie Zimmermann Modulation de la différenciation lymphocytaire T par thérapie cellulaire et génique dans le thymus Valérie Zimmermann Thymopoiesis Bone Marrow 2-28 days Thymus Periphery Hematopoietic progenitor Hematopoietic

More information

Characterization of human myeloid progenitors and their differentiation

Characterization of human myeloid progenitors and their differentiation Characterization of human myeloid progenitors and their differentiation Edvardsson, Louise 2006 Link to publication Citation for published version (APA): Edvardsson, L. (2006). Characterization of human

More information

Deficiency of Lipid Phosphatase SHIP Enables Long-Term Reconstitution of Hematopoietic InductiveBoneMarrowMicroenvironment

Deficiency of Lipid Phosphatase SHIP Enables Long-Term Reconstitution of Hematopoietic InductiveBoneMarrowMicroenvironment Article Deficiency of Lipid Phosphatase SHIP Enables Long-Term Reconstitution of Hematopoietic InductiveBoneMarrowMicroenvironment Olin D. Liang, 1,2,3 Jiayun Lu, 1,2,3 César Nombela-Arrieta, 1,2,3 Jia

More information

Ablation of Fbxw7 Eliminates Leukemia-Initiating Cells by Preventing Quiescence

Ablation of Fbxw7 Eliminates Leukemia-Initiating Cells by Preventing Quiescence Article Ablation of Fbxw7 Eliminates Leukemia-Initiating Cells by Preventing Quiescence Shoichiro Takeishi, 1,2 Akinobu Matsumoto, 1,2 Ichiro Onoyama, 1,2 Kazuhito Naka, 3 Atsushi Hirao, 2,3 and Keiichi

More information

Suppression of Cytochrome P450 Reductase Enhances Long-Term Hematopoietic Stem Cell Repopulation Efficiency in Mice

Suppression of Cytochrome P450 Reductase Enhances Long-Term Hematopoietic Stem Cell Repopulation Efficiency in Mice Suppression of Cytochrome P450 Reductase Enhances Long-Term Hematopoietic Stem Cell Repopulation Efficiency in Mice Yan Zhang 1,2., Fang Dong 1,2., Na Zhang 1,2, Hui Cheng 1,2, Yakun Pang 1,2, Xiaomin

More information

Chronic Myeloid Leukemia Outlook: The Future of CML Therapy

Chronic Myeloid Leukemia Outlook: The Future of CML Therapy Chronic Myeloid Leukemia Outlook: The Future of CML Therapy Neil Shah, MD PhD Edward S. AgenoDistinguished Professor in Hematology/Oncology UCSF School of Medicine San Francisco, California Progression

More information

Bone Cell Precursors and the Pathophysiology of Bone Loss

Bone Cell Precursors and the Pathophysiology of Bone Loss Bone Cell Precursors and the Pathophysiology of Bone Loss HARRY C. BLAIR, a AND JILL L. CARRINGTON b a Departments of Pathology and Cell Biology, University of Pittsburgh, and Pittsburgh VA Medical Center,

More information

Oncolytic Virotherapy: Targeting Cancer Stem Cells

Oncolytic Virotherapy: Targeting Cancer Stem Cells Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:

More information

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017 Lymphoid architecture & Leukocyte recirculation Thursday Jan 26th, 2017 Topics The life of immune cells Where are they born? Where are they educated? Where do they function? How do they get there? The

More information

Review Article Availability of Haematopoietic Niches for Transplanted Stem Cells

Review Article Availability of Haematopoietic Niches for Transplanted Stem Cells Review Article Availability of Haematopoietic Niches for Transplanted Stem Cells (mouse / haematopoiesis / haematopoietic stem cell / progenitors / niche / bone marrow transplantation / irradiation / cytostatics

More information

Hematopoietic stem cells. Presentation outline: Embryonic und adult tissue stem cells. Hematopoietic stem cells

Hematopoietic stem cells. Presentation outline: Embryonic und adult tissue stem cells. Hematopoietic stem cells 10 0 101 102 103 104 SCA1-Height R Hematopoietic stem Totipotent Stem Cell Zygote Embryonic und adult tissue stem Pluripotent Stem Cell Embryonic Stem (ES) Cells T-CELL LYMPHOID STEM CELL B-CELL PLASMA

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

The Hierarchical Organization of Normal and Malignant Hematopoiesis

The Hierarchical Organization of Normal and Malignant Hematopoiesis The Hierarchical Organization of Normal and Malignant Hematopoiesis NORMAL Hematopoie2c Stem Cell (HSC) Leukemia Stem Cells (LSC) MPP MLP CMP Leukemic Progenitors MEP GMP B/NK ETP Leukemic Blasts Erythrocytes

More information