OncoKids SM Pediatric Cancer Panel
|
|
- Morgan Mosley
- 5 years ago
- Views:
Transcription
1 Detection of mutations and gene fusions in pediatric hematologic malignancies and solid tumors with the OncoKids SM next generation sequencing based assay Jaclyn Biegel, Timothy Triche, D. Gigi Ostrow, Jonathan Buckley, Tracy Busse, Xiaowu Gai, Jianling Ji, Alexander Judkins, Dennis Maglinte, Gordana Raca, and Matthew Hiemenz
2 OncoKids SM Pediatric Cancer Panel Diagnostic mutations or gene fusions that will help determine prognosis and guide therapy Monitor disease remission and recurrence Distinguish relapse or metastasis from second tumor Identify novel therapeutics based on molecular features
3 OncoKids SM Pediatric Cancer Panel Primer-based target enrichment (Ampliseq) Interrogate DNA and RNA isolated from fresh, frozen, and FFPE tissue Small input (20 ng DNA and RNA) Sequencing on the Ion Torrent S5XL (2 hours) Analysis with Ion Reporter and custom tool for indels 3 day turn-around time
4 OncoKids SM was Designed Specifically for Use in Pediatric Cancers
5 OncoKids SM Validation 237 unique tumor samples (fresh bone marrow, frozen tumor, FFPE, isolated cdna, DNA) DNA component of the assay 102 single or multiple nucleotide variants (MNVs) 49 indels 9 gene amplification RNA component of the assay 51 fusions in 50 leukemia RNA samples (gene rearrangements detected by karyotype, FISH, array, RT-PCR, or NGS) 41 solid tumor RNA samples with fusions
6 OncoKids SM is Sensitive and Specific Single Nucleotide Variant: C to T InDel: 24 base deletion SMARCB1 c.118c>t, p.arg40* SMARCB1 c.20_43delgcaagaccttcgggcagaagcccginst (p.ser7ilefs*56)
7 Detection of DNA Amplifications is Highly Specific MYCN
8 Accuracy (DNA) 101 of 102 SNVs and MNVs were detected (99%) Low level germline mosaic (<5%) in RB1 was not detected 44 of 49 indels were detected (90%) ASXL1 c.1934dupg in an 8 G homopolymer track in 4 cases was not detected ASXL2 c.2090dupg in a 5 G homopolymer track in one case was not detected 9 of 9 amplification events detected as high copy number gains
9 A diverse range of fusions in leukemia samples were detected ATF7IP-JAK2 ETV6-NTRK3 P2RY8-CRLF2 RCSD1-ABL2 BCR-ABL1 ETV6-RUNX1 PAG1-ABL2 SSBP2-JAK2 BCR-JAK2 FIP1L1-PDGFRA PAK5-JAK2 STIL-TAL1 CRLF2-P2RY8 FOXP1-ABL1 PML-RARA TERF2-JAK2 EBF1-PDGFRB MLL Rearrangement RANBP2-ABL1 ZC3HAV1-ABL2 ETV6-ABL1 NUP214-ABL1 RBM15-MKL1 ZEB2-PDGFRB ETV6-JAK2 NUP98-NSD1 RCSD1-ABL1 ZMIZ1-ABL1
10 Representative solid tumor fusions CCDC6-RET Cllorf95-RELA EML4-ALK ETV6-NTRK3 EWSR1 Rearrangement FUS-CREB3L2 GOPC-ROS1 KIAA1549-BRAF NPM1-ALK PAX3-FOXO1 SS18-SSX1 Lung adenocarcinoma Ependymoma Lung adenocarcinoma Congenital mesoblastic nephroma Ewing sarcoma Fibromyxoid sarcoma High grade glioma Pilocytic astrocytoma Anaplastic large cell lymphoma Alveolar rhabdomyosarcoma Synovial sarcoma
11 Case example: pediatric patient with high grade glioma 4 y/o girl presented with 6 months of increasing left-sided weakness resulting in falls and ataxia MRI demonstrated a large right, intraventricular mass Pathology showed glioblastoma, small cell variant Most recent yrs showed no evidence of recurrent tumor
12 Single interstitial deletion with breakpoints in ROS1 and GOPC(FIG) ROS1 GOPC (FIG)
13 OncoKids SM Showed a GOPC-ROS1 Fusion in 283,317 Reads GOPC ROS1
14 GOPC-ROS1 Fusion Positive Glioblastoma May Respond to Crizotinib..GAT AAG GAA CTG GCA GGA AGT ACT CTT CCA ACC CAA GAG....Asp Lys Glu Leu Ala Gly Ser Thr Leu Pro Thr Gln Glu. Cancer Growth Metastasis. 2015; 8:51-60.
15 Accuracy (RNA) 47 of 51 fusions in the leukemia samples were detected ETV6 exon 5-RUNX1 exon 2 missed in 4 cases (primers not in the original design) 47 of 47 detected (100%) 33 of 41 fusions were detected in the solid tumor samples 4 brain tumors with KIAA1549-BRAF fusions, 2 tumors with CIC-DUX4 fusions primers not included in the assay so not detected 2 poor quality samples with predicted EWSR1 fusions were false negatives 33 of 35 (94%)
16 Performance and reporting criteria DNA Average read depth 5,000 X Average read length 120 bp 98% coverage at 250X Report SNVs at >5% allele frequency Report indels (<20 bp) at >10% allele frequency Report amplification at >8 copies RNA Evaluate expression of targeted and non-targeted fusions compared with 4 internal control genes Optimum read length 115 bp Read count for fusions varies from ,000 All novel fusions are confirmed by RT-PCR
17 Clinical test launched June 20, samples analyzed to date 11 cases with Tier 1 variants of strong clinical significance Metastatic solid pseudopapillary carcinoma with B-catenin mutation Angiomatoid fibrous histiocytoma with EWSR1-ATF1 fusion Diffuse midline glioma with H3F3A, ATRX, KRAS, PIK3CA and PPM1D mutations Sertoli leydig cell ovarian tumor with DICER1 mutation
18 Acknowledgements Jon Sherlock, Susan Ewald, John Bishop, Scott Myrand, Nick Khazanov, Jeff Smith, Janice Au Young, Chaitali Parikh, Jingwei Ni, Seth Sadis, Vinay Mittal and Dinesh Cyanam from Thermo Fisher Scientific. Cindy Fong, Jennifer Han and Sherry Yen for technical assistance. Moiz Bootwalla and Alex Ryutov for bioinformatics support. Clinical collaborators from University of Chicago, COG Biopathology Center, UCLA, University of Pennsylvania, Denver Children s Hospital, Children s Healthcare of Atlanta, Lucille Packard Hospital, OmniSeq, and ARUP who provided samples for analysis.
A Pediatric Cancer Research Gene Panel. Timothy J.Triche, M.D., Ph.D.
A Pediatric Cancer Research Gene Panel Timothy J.Triche, M.D., Ph.D. Outline Panel Content Technical aspects of the Panel Performance Verification Research Case Study Conclusions A Research Gene Panel
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationMolecular pathology in soft tissue tumors. Sylvia Höller Pathologie
Molecular pathology in soft tissue tumors Sylvia Höller Pathologie When do we perform molecular testing? Morphology and IHC are not clearly fitting with an entity some translocations are entity specific
More informationCLINICAL UTILITY OF INTEGRATED GENOMIC PROFILING IN PEDIATRIC LEUKEMIA
CLINICAL UTILITY OF INTEGRATED GENOMIC PROFILING IN PEDIATRIC LEUKEMIA FUMIN LIN, Ph.D. LINF1@EMAIL.CHOP.EDU CANCER GENOMIC DIAGNOSTIC LABORATORY DIVISION OF GENOMIC DIAGNOSTICS 1 PEDIATRIC LEUKEMIA Common
More informationMolecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
More informationAugust 17, Dear Valued Client:
August 7, 08 Re: CMS Announces 6-Month Period of Enforcement Discretion for Laboratory Date of Service Exception Policy Under the Medicare Clinical Laboratory Fee Schedule (the 4 Day Rule ) Dear Valued
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationPh-like (BCR/ABL1-like): un apporoccio baato sul target molecolare
Ph-like (BCR/ABL1-like): un apporoccio baato sul target molecolare Sabina Chiaretti, MD PhD LE SFIDE DELLA MEDICINA DI PRECISIONE IN EMATOLOGIA Bologna 28 Giugno, 2018 Topics: BCR/ABL1-like and other subgroups
More informationMolecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.
Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine
More informationNext Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
More informationTEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days
TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationDisclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction
Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques
More informationCurrent and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationFusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas
Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Igor Astsaturov Philip Ellis Jeff Swensen Zoran Gatalica David Arguello Sandeep Reddy Wafik El-Deiry Disclaimers Dr. Igor
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationOncology Cytogenetics Diagnostic Service - User Guide 2014
Oncology Cytogenetics Diagnostic Service - User Guide 2014 Contact details Address: Cytogenetics Department 5 th Floor Tower Wing Guy s Hospital Great Maze Pond London SE1 9RT General enquiries 0207 188
More informationCase 1. Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX
Case 1 Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX Disclosure of Relevant Financial Relationships The USCAP requires that anyone in a position to influence or control the content of all CME
More informationMET skipping mutation, EGFR
New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM
More informationKlinisch belang van chromosomale translocatie detectie in sarcomen
Translocations in sarcomas Klinisch belang van chromosomale translocatie detectie in sarcomen Judith V.M.G. Bovée, M.D., Ph.D. Department of Pathology Leiden University Medical Center RNA binding DNA binding
More informationOncomine Focus assay panel and Oncomine Knowledgebase Reporter.
Oncomine Focus assay panel and Oncomine Knowledgebase Reporter. How it can help to identify relevant alteration and early phase trials. Dr Isabelle SOUBEYRAN Dr Emmanuel KHALIFA Molecular Pathology Unit
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationBCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos Ph like ALL BCR ABL1 like acute lymphoblastic leukemia (ALL)
More information5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff
5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late
More informationDisclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction
Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationAddressing the challenges of genomic characterization of hematologic malignancies using microarrays
Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University
More informationCutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement
Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationPersonalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients
Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs
More informationMatthew Smolkin, MD HCLD Medical Director Molecular Pathology Diagnostic Laboratory
Molecular Profiling Matthew Smolkin, MD HCLD Medical Director Molecular Pathology Diagnostic Laboratory Objectives Defining molecular profiling Technologies Why do we profile tumors? Current testing &
More informationThe new Leeds Solid Tumour Molecular Oncology Diagnostics Service. Paul Roberts, Genetics, Leeds
The new Leeds Solid Tumour Molecular Oncology Diagnostics Service Paul Roberts, Genetics, Leeds Molecular Oncology services pre-2013 DNA lab Germline cancer Cytogenetics lab FISH, cell culture, molecular
More informationFrequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
More informationOverview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology
Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology
More informationNon-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing
Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical
More informationYour single-source laboratory solution. FISH Probe Library
Your single-source laboratory solution. FISH Probe Library Alphabetical List by Probe with Clinical Indication Probe Clinical Indication 1p36 (TP73)/19q13 (GLTSCR) 1q21 (CKS1B) 5q (CSF1R/RPS14) 7q (MDFIC)
More informationMEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17
MEDICAL POLICY SUBJECT: MOLECULAR PANEL TESTING OF PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including
More informationPatricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope
Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures
More informationNext generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationHeme fusion assay. Valentina Nardi, MD Assistant pathologist Massachusetts General Hospital Assistant Professor Harvard Medical School
Heme fusion assay Valentina Nardi, MD Assistant pathologist Massachusetts General Hospital Assistant Professor Harvard Medical School No personal disclosures/conflicts of interest Kinase fusions in solid
More informationThe Center for PERSONALIZED DIAGNOSTICS
The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationTargeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematopathology and Oncology Diagnostic Services (HODS) Addenbrookes Hospital Hills Road Cambridge CB2 0QQ Contact: Brian Warner Tel: +44
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationSchool of Pathology and Laboratory Medicine: Current and New Research Interests
School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationJennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA
Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationWHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities
WHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities Robert W. McKenna, M.D. 1/2009 WHO Classification of Myeloid Neoplasms (4th Edition)--2008 Incorporates new information that
More informationPrior Authorization Required: Additional Information:
Genetic Testing for Somatic Tumor Markers MP9486 Covered Service: Prior Authorization Required: Additional Information: Yes when meets criteria below No A first-degree relative is defined as an individual
More informationNGS Gateway Lab Services
TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house
More informationBlastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )
Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH2017-0314) Habibe Kurt, Joseph D. Khoury, Carlos E. Bueso-Ramos, Jeffrey L. Jorgensen, Guilin Tang, L. Jeffrey Medeiros, and
More informationIntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationKarl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
More informationDiagnostic application of SNParrays to brain cancers
Diagnostic application of SNParrays to brain cancers Adriana Olar 4/17/2018 No disclosures 55 yo M, focal motor seizure T2 T1-post C DIAGNOSIS BRAIN, LEFT FRONTAL LOBE, BIOPSY: - DIFFUSE GLIOMA, OLIGODENDROGLIAL
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationClinical Validation of Cytocell Pathology Probes
Clinical Validation of Cytocell Pathology Probes Shivanand Richardson Specialized Technician Molecular Pathology Department of Pathology, University Medical Center Utrecht The Netherlands 5th annual Cytocell
More informationAcute leukemia and myelodysplastic syndromes
11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid
More informationPredictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities
Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationReporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia
More informationMEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers
POLICY: PG0067 ORIGINAL EFFECTIVE: 07/30/02 LAST REVIEW: 01/25/18 MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers GUIDELINES This policy does not certify benefits or authorization of benefits,
More informationFinancial disclosures
Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchc Geisel School of
More informationFinancial disclosures
An update on immunohistochemical markers in mesenchymal neoplasms By Konstantinos Linos MD, FCAP, FASDP Assistant Professor of Pathology Geisel School of Medicine at Dartmouth Dartmouth-Hitchcock Medical
More informationClinical Grade Genomic Profiling: The Time Has Come
Clinical Grade Genomic Profiling: The Time Has Come Gary Palmer, MD, JD, MBA, MPH Senior Vice President, Medical Affairs Foundation Medicine, Inc. Oct. 22, 2013 1 Why We Are Here A Shared Vision At Foundation
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationNext generation histopathological diagnosis for precision medicine in solid cancers
Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L.
Companion Meeting of the International Society of Bone and Soft Tissue Pathology The Evolving Concept of Mesenchymal Tumors ALK FUSION-POSITIVE MESENCHYMAL TUMORS Jason L. Hornick, MD, PhD March 13, 2016
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationNGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
More informationPAX5-JAK2 fusion in acute lymphoblastic leukaemia. Dr Andrew Baldi Royal Children s Hospital 24 February 2017 Melbourne
PAX5-JAK2 fusion in acute lymphoblastic leukaemia Dr Andrew Baldi Royal Children s Hospital 24 February 2017 Melbourne Case 12-year-old girl Diagnosed with BCP ALL in November 2015 Presenting WCC 35x10
More informationNature Medicine: doi: /nm.4439
Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants
More informationRisk Stratification in Childhood Leukemia
Risk Stratification in Childhood Leukemia Why is risk stratification important? Toxicities Deepa Bhojwani, MD May 11, 2018 To determine intensity of therapy - When to intensify therapy - When to de-intensify
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationNGS IN ONCOLOGY: FDA S PERSPECTIVE
NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for
More informationDetecting Oncogenic Mutations in Whole Blood
WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationCURRENTLY ENROLLING ONCOLOGY TREATMENT STUDIES (as of )
Leukemia AALL0932 closed after Induction CURRENTLY ENROLLING ONCOLOGY TREATMENT STUDIES (as of 10.10.2017) Treatment of Patients with Newly Diagnosed Standard Risk B-Lymphoblastic Leukemia (B-ALL) or Localized
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More informationAPPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE
AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST
More informationComprehensive Analyses of Circulating Cell- Free Tumor DNA
Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations
More informationDR. MULLIGHAN HAS NOTHING TO DISCLOSE
Advances in the genetics of B-progenitor acute lymphoblastic leukemia Charles Mullighan Member, Department of Pathology St Jude Children s Research Hospital Society for Hematopathology Companion Meeting
More information