OncoKids SM Pediatric Cancer Panel

Size: px
Start display at page:

Download "OncoKids SM Pediatric Cancer Panel"

Transcription

1 Detection of mutations and gene fusions in pediatric hematologic malignancies and solid tumors with the OncoKids SM next generation sequencing based assay Jaclyn Biegel, Timothy Triche, D. Gigi Ostrow, Jonathan Buckley, Tracy Busse, Xiaowu Gai, Jianling Ji, Alexander Judkins, Dennis Maglinte, Gordana Raca, and Matthew Hiemenz

2 OncoKids SM Pediatric Cancer Panel Diagnostic mutations or gene fusions that will help determine prognosis and guide therapy Monitor disease remission and recurrence Distinguish relapse or metastasis from second tumor Identify novel therapeutics based on molecular features

3 OncoKids SM Pediatric Cancer Panel Primer-based target enrichment (Ampliseq) Interrogate DNA and RNA isolated from fresh, frozen, and FFPE tissue Small input (20 ng DNA and RNA) Sequencing on the Ion Torrent S5XL (2 hours) Analysis with Ion Reporter and custom tool for indels 3 day turn-around time

4 OncoKids SM was Designed Specifically for Use in Pediatric Cancers

5 OncoKids SM Validation 237 unique tumor samples (fresh bone marrow, frozen tumor, FFPE, isolated cdna, DNA) DNA component of the assay 102 single or multiple nucleotide variants (MNVs) 49 indels 9 gene amplification RNA component of the assay 51 fusions in 50 leukemia RNA samples (gene rearrangements detected by karyotype, FISH, array, RT-PCR, or NGS) 41 solid tumor RNA samples with fusions

6 OncoKids SM is Sensitive and Specific Single Nucleotide Variant: C to T InDel: 24 base deletion SMARCB1 c.118c>t, p.arg40* SMARCB1 c.20_43delgcaagaccttcgggcagaagcccginst (p.ser7ilefs*56)

7 Detection of DNA Amplifications is Highly Specific MYCN

8 Accuracy (DNA) 101 of 102 SNVs and MNVs were detected (99%) Low level germline mosaic (<5%) in RB1 was not detected 44 of 49 indels were detected (90%) ASXL1 c.1934dupg in an 8 G homopolymer track in 4 cases was not detected ASXL2 c.2090dupg in a 5 G homopolymer track in one case was not detected 9 of 9 amplification events detected as high copy number gains

9 A diverse range of fusions in leukemia samples were detected ATF7IP-JAK2 ETV6-NTRK3 P2RY8-CRLF2 RCSD1-ABL2 BCR-ABL1 ETV6-RUNX1 PAG1-ABL2 SSBP2-JAK2 BCR-JAK2 FIP1L1-PDGFRA PAK5-JAK2 STIL-TAL1 CRLF2-P2RY8 FOXP1-ABL1 PML-RARA TERF2-JAK2 EBF1-PDGFRB MLL Rearrangement RANBP2-ABL1 ZC3HAV1-ABL2 ETV6-ABL1 NUP214-ABL1 RBM15-MKL1 ZEB2-PDGFRB ETV6-JAK2 NUP98-NSD1 RCSD1-ABL1 ZMIZ1-ABL1

10 Representative solid tumor fusions CCDC6-RET Cllorf95-RELA EML4-ALK ETV6-NTRK3 EWSR1 Rearrangement FUS-CREB3L2 GOPC-ROS1 KIAA1549-BRAF NPM1-ALK PAX3-FOXO1 SS18-SSX1 Lung adenocarcinoma Ependymoma Lung adenocarcinoma Congenital mesoblastic nephroma Ewing sarcoma Fibromyxoid sarcoma High grade glioma Pilocytic astrocytoma Anaplastic large cell lymphoma Alveolar rhabdomyosarcoma Synovial sarcoma

11 Case example: pediatric patient with high grade glioma 4 y/o girl presented with 6 months of increasing left-sided weakness resulting in falls and ataxia MRI demonstrated a large right, intraventricular mass Pathology showed glioblastoma, small cell variant Most recent yrs showed no evidence of recurrent tumor

12 Single interstitial deletion with breakpoints in ROS1 and GOPC(FIG) ROS1 GOPC (FIG)

13 OncoKids SM Showed a GOPC-ROS1 Fusion in 283,317 Reads GOPC ROS1

14 GOPC-ROS1 Fusion Positive Glioblastoma May Respond to Crizotinib..GAT AAG GAA CTG GCA GGA AGT ACT CTT CCA ACC CAA GAG....Asp Lys Glu Leu Ala Gly Ser Thr Leu Pro Thr Gln Glu. Cancer Growth Metastasis. 2015; 8:51-60.

15 Accuracy (RNA) 47 of 51 fusions in the leukemia samples were detected ETV6 exon 5-RUNX1 exon 2 missed in 4 cases (primers not in the original design) 47 of 47 detected (100%) 33 of 41 fusions were detected in the solid tumor samples 4 brain tumors with KIAA1549-BRAF fusions, 2 tumors with CIC-DUX4 fusions primers not included in the assay so not detected 2 poor quality samples with predicted EWSR1 fusions were false negatives 33 of 35 (94%)

16 Performance and reporting criteria DNA Average read depth 5,000 X Average read length 120 bp 98% coverage at 250X Report SNVs at >5% allele frequency Report indels (<20 bp) at >10% allele frequency Report amplification at >8 copies RNA Evaluate expression of targeted and non-targeted fusions compared with 4 internal control genes Optimum read length 115 bp Read count for fusions varies from ,000 All novel fusions are confirmed by RT-PCR

17 Clinical test launched June 20, samples analyzed to date 11 cases with Tier 1 variants of strong clinical significance Metastatic solid pseudopapillary carcinoma with B-catenin mutation Angiomatoid fibrous histiocytoma with EWSR1-ATF1 fusion Diffuse midline glioma with H3F3A, ATRX, KRAS, PIK3CA and PPM1D mutations Sertoli leydig cell ovarian tumor with DICER1 mutation

18 Acknowledgements Jon Sherlock, Susan Ewald, John Bishop, Scott Myrand, Nick Khazanov, Jeff Smith, Janice Au Young, Chaitali Parikh, Jingwei Ni, Seth Sadis, Vinay Mittal and Dinesh Cyanam from Thermo Fisher Scientific. Cindy Fong, Jennifer Han and Sherry Yen for technical assistance. Moiz Bootwalla and Alex Ryutov for bioinformatics support. Clinical collaborators from University of Chicago, COG Biopathology Center, UCLA, University of Pennsylvania, Denver Children s Hospital, Children s Healthcare of Atlanta, Lucille Packard Hospital, OmniSeq, and ARUP who provided samples for analysis.

A Pediatric Cancer Research Gene Panel. Timothy J.Triche, M.D., Ph.D.

A Pediatric Cancer Research Gene Panel. Timothy J.Triche, M.D., Ph.D. A Pediatric Cancer Research Gene Panel Timothy J.Triche, M.D., Ph.D. Outline Panel Content Technical aspects of the Panel Performance Verification Research Case Study Conclusions A Research Gene Panel

More information

Out-Patient Billing CPT Codes

Out-Patient Billing CPT Codes Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB

More information

Molecular pathology in soft tissue tumors. Sylvia Höller Pathologie

Molecular pathology in soft tissue tumors. Sylvia Höller Pathologie Molecular pathology in soft tissue tumors Sylvia Höller Pathologie When do we perform molecular testing? Morphology and IHC are not clearly fitting with an entity some translocations are entity specific

More information

CLINICAL UTILITY OF INTEGRATED GENOMIC PROFILING IN PEDIATRIC LEUKEMIA

CLINICAL UTILITY OF INTEGRATED GENOMIC PROFILING IN PEDIATRIC LEUKEMIA CLINICAL UTILITY OF INTEGRATED GENOMIC PROFILING IN PEDIATRIC LEUKEMIA FUMIN LIN, Ph.D. LINF1@EMAIL.CHOP.EDU CANCER GENOMIC DIAGNOSTIC LABORATORY DIVISION OF GENOMIC DIAGNOSTICS 1 PEDIATRIC LEUKEMIA Common

More information

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for

More information

August 17, Dear Valued Client:

August 17, Dear Valued Client: August 7, 08 Re: CMS Announces 6-Month Period of Enforcement Discretion for Laboratory Date of Service Exception Policy Under the Medicare Clinical Laboratory Fee Schedule (the 4 Day Rule ) Dear Valued

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE

More information

Ph-like (BCR/ABL1-like): un apporoccio baato sul target molecolare

Ph-like (BCR/ABL1-like): un apporoccio baato sul target molecolare Ph-like (BCR/ABL1-like): un apporoccio baato sul target molecolare Sabina Chiaretti, MD PhD LE SFIDE DELLA MEDICINA DI PRECISIONE IN EMATOLOGIA Bologna 28 Giugno, 2018 Topics: BCR/ABL1-like and other subgroups

More information

Molecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.

Molecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy. Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

TEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days

TEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome

More information

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

SureSelect Cancer All-In-One Custom and Catalog NGS Assays SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis

More information

Disclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction

Disclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques

More information

Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian

Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What

More information

Please Silence Your Cell Phones. Thank You

Please Silence Your Cell Phones. Thank You Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure

More information

Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas

Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Igor Astsaturov Philip Ellis Jeff Swensen Zoran Gatalica David Arguello Sandeep Reddy Wafik El-Deiry Disclaimers Dr. Igor

More information

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor

More information

Molecular Diagnosis. Nucleic acid based testing in Oncology

Molecular Diagnosis. Nucleic acid based testing in Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,

More information

Oncology Cytogenetics Diagnostic Service - User Guide 2014

Oncology Cytogenetics Diagnostic Service - User Guide 2014 Oncology Cytogenetics Diagnostic Service - User Guide 2014 Contact details Address: Cytogenetics Department 5 th Floor Tower Wing Guy s Hospital Great Maze Pond London SE1 9RT General enquiries 0207 188

More information

Case 1. Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX

Case 1. Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX Case 1 Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX Disclosure of Relevant Financial Relationships The USCAP requires that anyone in a position to influence or control the content of all CME

More information

MET skipping mutation, EGFR

MET skipping mutation, EGFR New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM

More information

Klinisch belang van chromosomale translocatie detectie in sarcomen

Klinisch belang van chromosomale translocatie detectie in sarcomen Translocations in sarcomas Klinisch belang van chromosomale translocatie detectie in sarcomen Judith V.M.G. Bovée, M.D., Ph.D. Department of Pathology Leiden University Medical Center RNA binding DNA binding

More information

Oncomine Focus assay panel and Oncomine Knowledgebase Reporter.

Oncomine Focus assay panel and Oncomine Knowledgebase Reporter. Oncomine Focus assay panel and Oncomine Knowledgebase Reporter. How it can help to identify relevant alteration and early phase trials. Dr Isabelle SOUBEYRAN Dr Emmanuel KHALIFA Molecular Pathology Unit

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013 Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie

More information

BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos

BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos Ph like ALL BCR ABL1 like acute lymphoblastic leukemia (ALL)

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

Disclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction

Disclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information

Application of Whole Genome Microarrays in Cancer: You should be doing this test!!

Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical

More information

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University

More information

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center

More information

Genomic analysis of childhood High grade glial (HGG) brain tumors

Genomic analysis of childhood High grade glial (HGG) brain tumors Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain

More information

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs

More information

Matthew Smolkin, MD HCLD Medical Director Molecular Pathology Diagnostic Laboratory

Matthew Smolkin, MD HCLD Medical Director Molecular Pathology Diagnostic Laboratory Molecular Profiling Matthew Smolkin, MD HCLD Medical Director Molecular Pathology Diagnostic Laboratory Objectives Defining molecular profiling Technologies Why do we profile tumors? Current testing &

More information

The new Leeds Solid Tumour Molecular Oncology Diagnostics Service. Paul Roberts, Genetics, Leeds

The new Leeds Solid Tumour Molecular Oncology Diagnostics Service. Paul Roberts, Genetics, Leeds The new Leeds Solid Tumour Molecular Oncology Diagnostics Service Paul Roberts, Genetics, Leeds Molecular Oncology services pre-2013 DNA lab Germline cancer Cytogenetics lab FISH, cell culture, molecular

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

Overview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology

Overview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology

More information

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical

More information

Your single-source laboratory solution. FISH Probe Library

Your single-source laboratory solution. FISH Probe Library Your single-source laboratory solution. FISH Probe Library Alphabetical List by Probe with Clinical Indication Probe Clinical Indication 1p36 (TP73)/19q13 (GLTSCR) 1q21 (CKS1B) 5q (CSF1R/RPS14) 7q (MDFIC)

More information

MEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17

MEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17 MEDICAL POLICY SUBJECT: MOLECULAR PANEL TESTING OF PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including

More information

Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope

Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures

More information

Next generation diagnostics Bringing high-throughput sequencing into clinical application

Next generation diagnostics Bringing high-throughput sequencing into clinical application Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Heme fusion assay. Valentina Nardi, MD Assistant pathologist Massachusetts General Hospital Assistant Professor Harvard Medical School

Heme fusion assay. Valentina Nardi, MD Assistant pathologist Massachusetts General Hospital Assistant Professor Harvard Medical School Heme fusion assay Valentina Nardi, MD Assistant pathologist Massachusetts General Hospital Assistant Professor Harvard Medical School No personal disclosures/conflicts of interest Kinase fusions in solid

More information

The Center for PERSONALIZED DIAGNOSTICS

The Center for PERSONALIZED DIAGNOSTICS The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018 Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematopathology and Oncology Diagnostic Services (HODS) Addenbrookes Hospital Hills Road Cambridge CB2 0QQ Contact: Brian Warner Tel: +44

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%) Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999

More information

School of Pathology and Laboratory Medicine: Current and New Research Interests

School of Pathology and Laboratory Medicine: Current and New Research Interests School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA

Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

WHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities

WHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities WHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities Robert W. McKenna, M.D. 1/2009 WHO Classification of Myeloid Neoplasms (4th Edition)--2008 Incorporates new information that

More information

Prior Authorization Required: Additional Information:

Prior Authorization Required: Additional Information: Genetic Testing for Somatic Tumor Markers MP9486 Covered Service: Prior Authorization Required: Additional Information: Yes when meets criteria below No A first-degree relative is defined as an individual

More information

NGS Gateway Lab Services

NGS Gateway Lab Services TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house

More information

Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )

Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH ) Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH2017-0314) Habibe Kurt, Joseph D. Khoury, Carlos E. Bueso-Ramos, Jeffrey L. Jorgensen, Guilin Tang, L. Jeffrey Medeiros, and

More information

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz

Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz

More information

Diagnostic application of SNParrays to brain cancers

Diagnostic application of SNParrays to brain cancers Diagnostic application of SNParrays to brain cancers Adriana Olar 4/17/2018 No disclosures 55 yo M, focal motor seizure T2 T1-post C DIAGNOSIS BRAIN, LEFT FRONTAL LOBE, BIOPSY: - DIFFUSE GLIOMA, OLIGODENDROGLIAL

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

Clinical Validation of Cytocell Pathology Probes

Clinical Validation of Cytocell Pathology Probes Clinical Validation of Cytocell Pathology Probes Shivanand Richardson Specialized Technician Molecular Pathology Department of Pathology, University Medical Center Utrecht The Netherlands 5th annual Cytocell

More information

Acute leukemia and myelodysplastic syndromes

Acute leukemia and myelodysplastic syndromes 11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid

More information

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota

Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia

More information

MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers

MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers POLICY: PG0067 ORIGINAL EFFECTIVE: 07/30/02 LAST REVIEW: 01/25/18 MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers GUIDELINES This policy does not certify benefits or authorization of benefits,

More information

Financial disclosures

Financial disclosures Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchc Geisel School of

More information

Financial disclosures

Financial disclosures An update on immunohistochemical markers in mesenchymal neoplasms By Konstantinos Linos MD, FCAP, FASDP Assistant Professor of Pathology Geisel School of Medicine at Dartmouth Dartmouth-Hitchcock Medical

More information

Clinical Grade Genomic Profiling: The Time Has Come

Clinical Grade Genomic Profiling: The Time Has Come Clinical Grade Genomic Profiling: The Time Has Come Gary Palmer, MD, JD, MBA, MPH Senior Vice President, Medical Affairs Foundation Medicine, Inc. Oct. 22, 2013 1 Why We Are Here A Shared Vision At Foundation

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

ACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L.

ACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L. Companion Meeting of the International Society of Bone and Soft Tissue Pathology The Evolving Concept of Mesenchymal Tumors ALK FUSION-POSITIVE MESENCHYMAL TUMORS Jason L. Hornick, MD, PhD March 13, 2016

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

NGS ONCOPANELS: FDA S PERSPECTIVE

NGS ONCOPANELS: FDA S PERSPECTIVE NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration

More information

PAX5-JAK2 fusion in acute lymphoblastic leukaemia. Dr Andrew Baldi Royal Children s Hospital 24 February 2017 Melbourne

PAX5-JAK2 fusion in acute lymphoblastic leukaemia. Dr Andrew Baldi Royal Children s Hospital 24 February 2017 Melbourne PAX5-JAK2 fusion in acute lymphoblastic leukaemia Dr Andrew Baldi Royal Children s Hospital 24 February 2017 Melbourne Case 12-year-old girl Diagnosed with BCP ALL in November 2015 Presenting WCC 35x10

More information

Nature Medicine: doi: /nm.4439

Nature Medicine: doi: /nm.4439 Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants

More information

Risk Stratification in Childhood Leukemia

Risk Stratification in Childhood Leukemia Risk Stratification in Childhood Leukemia Why is risk stratification important? Toxicities Deepa Bhojwani, MD May 11, 2018 To determine intensity of therapy - When to intensify therapy - When to de-intensify

More information

oncogenes-and- tumour-suppressor-genes)

oncogenes-and- tumour-suppressor-genes) Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging

More information

NGS IN ONCOLOGY: FDA S PERSPECTIVE

NGS IN ONCOLOGY: FDA S PERSPECTIVE NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for

More information

Detecting Oncogenic Mutations in Whole Blood

Detecting Oncogenic Mutations in Whole Blood WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013

More information

Personalized Medicine: Lung Biopsy and Tumor

Personalized Medicine: Lung Biopsy and Tumor Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the

More information

CURRENTLY ENROLLING ONCOLOGY TREATMENT STUDIES (as of )

CURRENTLY ENROLLING ONCOLOGY TREATMENT STUDIES (as of ) Leukemia AALL0932 closed after Induction CURRENTLY ENROLLING ONCOLOGY TREATMENT STUDIES (as of 10.10.2017) Treatment of Patients with Newly Diagnosed Standard Risk B-Lymphoblastic Leukemia (B-ALL) or Localized

More information

Next generation sequencing analysis - A UK perspective. Nicholas Lea

Next generation sequencing analysis - A UK perspective. Nicholas Lea Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population

More information

APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE

APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST

More information

Comprehensive Analyses of Circulating Cell- Free Tumor DNA

Comprehensive Analyses of Circulating Cell- Free Tumor DNA Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations

More information

DR. MULLIGHAN HAS NOTHING TO DISCLOSE

DR. MULLIGHAN HAS NOTHING TO DISCLOSE Advances in the genetics of B-progenitor acute lymphoblastic leukemia Charles Mullighan Member, Department of Pathology St Jude Children s Research Hospital Society for Hematopathology Companion Meeting

More information