Integrated platform for liquid biopsy-based personalized cancer medicine
|
|
- Jasmine Wade
- 5 years ago
- Views:
Transcription
1 Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy
2 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Molecular Analysis & Therapy Selection Molecular Analysis & Therapy Selection 2
3 Cancer is an evolving disease Cellular heterogeneity is the basis for therapy resistance Selection for resistant, aggressive subclones by applied therapies Polzer and Klein, Nat Med 2013
4 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Surgery metastatic disease Information on systemic cancer? 4
5 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Surgery metastatic disease Information on systemic cancer? Liquid Biopsy 5
6 Concept of liquid biopsy Information on systemic cancer in a simple blood test - Circulating tumor cells (CTCs) - Circulating tumor DNA (ctdna) - mirna (and other RNAs) - Extracellular vesicles (e.g. exosomes) Diaz and Bardelli, JCO 2014
7 Analysis of circulating tumor cells 1. Enrichment for CTC 2. Detection of CTC e.g. CellSearch 3. Isolation of single CTC e.g. DepArray TM 4. Whole Genome amplification (WGA) 5. Unbiased molecular analysis Ampli1 TM WGA
8 Molecular heterogeneity in breast cancer Patient MU09 Primary Her2 negative, CTC count 42 (Veridex) CK HER2 CD45 DAPI HER2 qpcr PIK3CA mut T02 T04 T05 T06 T10 T07
9 Molecular heterogeneity in breast cancer Patient MU09 Primary Her2 negative, CTC count 42 (Veridex) CK HER2 CD45 DAPI HER2 qpcr PIK3CA mut T02 T04 T05 T06 T10 T07 wt wt H1047R H1047R H1047R H1047R
10 Liquid biopsy platform at ITEM-R
11 Comprehensive liquid biopsy concept cfdna isolation from plasma Expertise in preanalytical workflows and sample logistics for liquid biopsy studies CTC enrichment from buffy coat
12 Comprehensive liquid biopsy concept Expertise in preanalytical workflows and sample logistics for liquid biopsy studies cfdna isolation from plasma Protocols available for customized strategies (e.g. epitope based/marker-free) CTC enrichment from buffy coat High blood volumes ( ml, leukapheresis Other body fluids (e.g. bone marrow, cerebro-spinal fluid) and organs (e.g. lymph nodes)
13 Molecular analysis of single cells of patients Whole transcriptome amplification (WTA) RNASeq analysis (HiSeq) lncrnaseq analysis (HiSeq) Small RNASeq analysis (MiSeq) Single cell transcriptomics bioinformatics (tailored to WTA technology) Cell lysis Whole genome amplification (WGA) Quality control for patient-derived cells CNV analysis (MiSeq) Whole Genome Sequencing (HiSeq) Whole Exome/Panel Sequencing (HiSeq) Error free single cell Seq (PCTEP ) Single cell genomics bioinformatics (tailored to WGA technology) Automated workflow
14 Preclinical models from liquid biopsy samples in vivo liquid biopsy models for: testing novel therapies tumor cells personalized therapy selection in vitro biomarker/ drug targets understanding metastastic progression
15 High-throughput screening of compounds in patient-derived cell models Cell culture 384-well assay plate Compound administration (nl) Distribution of patient-derived cellular models on assay plates Compound libraries readout (e.g. luminescence) Dispensing of detection reagent on cells incubation (37 o C) MTT, AlamarBlue, protease, ATP
16 ITEM-R - your premium partner for liquid biopsy solutions in a clinical context
17 Poster Z9 Dr. Bernhard Polzer Dr. Kamran Honarnejad Fraunhofer Institute for Toxicology and Experimental Medicine - ITEM Division of Personalized Tumor Therapy, Regensburg Am Biopark Regensburg Germany
Early dissemination in prostate cancer
Early dissemination in prostate cancer Miodrag Guzvic, University of Regensburg, Germany Adjuvant Palliative M0 Initiation Diagnosis Surgery Metastasis Death Intervention window to delay or prevent metastasis
More informationLIQUID BIOPSY
www.idisantiago.es LIQUID BIOPSY Miguel Abal Investigador I3SNS Oncoloxía Médica Traslacional Instituto de Investigación Sanitaria de Santiago (IDIS) Complexo Hospitalario Universitario de Santiago/SERGAS
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationCTC in clinical studies: Latest reports on GI cancers
CTC in clinical studies: Latest reports on GI cancers François-Clément Bidard, MD PhD GI cancers are characterized by Multimodal treatment strategies Treatments are adapted to tumor burden & prognosis
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More information1/23/2017. Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical School
Application of Cytologic Techniques to Circulating Tumor Cell Specimens Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationLa biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro
La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity
More informationDNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationDr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester
Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester dsg6@le.ac.uk CFDNA/CTDNA Circulating-free AS A LIQUID DNA BIOPSY (cfdna) Tumour Biopsy Liquid Biopsy
More informationMolecular profiling of single circulating tumor cells with diagnostic intention
Research Article Molecular profiling of single circulating tumor cells with diagnostic intention Bernhard Polzer 1,, Gianni Medoro 2,, Sophie Pasch 3, Francesca Fontana 2, Laura Zorzino 4, Aurelia Pestka
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationExosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
More informationCirculating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
More informationThe clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
More informationYoungnam Cho. National Cancer Center Biomarker Branch
Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY
More informationSimple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
More informationCTC molecular characterization: Are we ready to move forward with clinical testing?
CTC molecular characterization: Are we ready to move forward with clinical testing? Michail Ignatiadis MD, PhD Jules Bordet Institute, Université Libre de Bruxelles Brussels, Belgium Breast cancer: Diagnostics
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationNext generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationBiopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz
Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create
More informationPros and cons of liquid biopsy: Ready to replace tissue?
Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:
More informationOS related to CTC response (response: 30% decline) 4 weeks 8 weeks 12 weeks
OS related to CTC response (response: 30% decline) 4 weeks 8 weeks 12 weeks 20 CTC characterization (DNA, RNA, proteins) - Therapeutic targets - Resistance mechanisms Detection of therapeutic targets on
More informationPresent and future for clinical applications of extracellular vesicles
Present and future for clinical applications of extracellular vesicles Natasa Zarovni, Exosomics Siena SpA, Italy xxxxxxxxxxxxxxxxxxx Exosomes have come a long way..as for many misunderstood geniuses,
More informationChallenges and unanswered questions for the next decade of circulating tumour cell research in lung cancer
Review Article Challenges and unanswered questions for the next decade of circulating tumour cell research in lung cancer Sumitra Mohan, Francesca Chemi, Ged Brady Clinical and Experimental Pharmacology
More informationIntroduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory
Introduction to liquid biopsies Rachel Butler All Wales Genetics Laboratory What is cell free DNA? Non-Invasive Prenatal Testing (NIPT) Extract DNA Genetic alterations detectable in circulating cell-free
More informationLukas Bubendorf Pathologie. Liquid biopsies
Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA
More informationFUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER
FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER C. NADAL 1-3, T. WINDER 4, A. GERGER 5-6, D. TOUGERON 7-8 SELECTED HIGHLIGHTS 1 Medical Oncology Department, Institut Clínic de Malalties
More informationIncorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical
Incorporating pharmacodynamic, response and patient selection biomarkers Paul Elvin PhD Chief Translational Science Officer Aptus Clinical 22 Oncology drug development Biomarkers key for: Strong hypothesis
More informationService and Collaboration
Summary Section 7 Introduction 68 Exosome and Microvesicle Isolation 69 EV protein quantification, sceening and profiling 69 Nanoparticle Tracking Analysis (NTA) 70 EV Nucleic Acid isolation 70 Nucleic
More informationThe Avatar System TM Yields Biologically Relevant Results
Application Note The Avatar System TM Yields Biologically Relevant Results Liquid biopsies stand to revolutionize the cancer field, enabling early detection and noninvasive monitoring of tumors. In the
More informationImportance of Methodology Certification and Accreditations to Perform Assays. Stan Hamilton, MD Head, Pathology and Laboratory Medicine
Importance of Methodology Certification and Accreditations to Perform Assays Stan Hamilton, MD Head, Pathology and Laboratory Medicine 1 Disclosures No disclosures relevant to this presentation 2 A bad
More informationCirculating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications
Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating
More informationCirculating Tumor Cells (CTC) Technologies
Table of Contents MIR036 I. SCOPE AND METHODOLOGY Scope of the Study Analytics and data presented in this report pertain to several parameters such as - Research Methodology This report is uniquely researched
More informationA Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient Outcomes. March 17-18, 2015 New York, NY
A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient Outcomes March 17-18, 2015 New York, NY A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient
More informationLiquid Biopsy: Implications for Cancer Staging & Therapy
Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate
More informationPatient Stratification and Precision Medicine in Pancreatic Cancer
Patient Stratification and Precision Medicine in Pancreatic Cancer 12èmes Journées November the 24th 2016 Piquemal David Core Business: RNA diagnostics A state of art platform & a 17-year expertise in
More informationWhat do liquid biopsies offer us for breast cancer patients?
What do liquid biopsies offer us for breast cancer patients? Isaac Garcia-Murillas Breast Cancer Now Research Centre, The institute of Cancer Research, London, UK Molecular Analysis of breast cancer Invasive
More informationLiquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director
Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:
More informationCirculating tumor cells/dna/etc for Radiation Oncologists
Circulating tumor cells/dna/etc for Radiation Oncologists Andrew Z. Wang, M.D. Associate Professor Director of Clinical and Translational Research Department of Radiation Oncology Carolina Center for Cancer
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationCirculating Tumor Cells in non- Metastatic Triple Negative Breast Cancer
Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Carolyn Hall, Ph.D. Department of Surgical Oncology The University of Texas MD Anderson Cancer Center Triple Negative Breast Cancer
More informationInformation Guide - August Liquid Biopsies for Cancer Management
Information Guide - August 2017 Liquid Biopsies for Cancer Management INFORMATION GUIDE - AUGUST 2017 Liquid Biopsies for Cancer Management CIRCULATING TUMOR DNA IN BLOOD AS A LIQUID BIOPSY FOR CANCER
More informationProducts for cfdna and mirna isolation. Subhead Circulating Cover nucleic acids from plasma
MACHEREY-NAGEL Products for cfdna and mirna isolation Bioanalysis Subhead Circulating Cover nucleic acids from plasma n Flexible solutions for small and large blood plasma volumes n Highly efficient recovery
More informationSurvey Results Q1. How would you best describe your organization?
Survey Results Q1. How would you best describe your organization? Q2. How high would you rate the priority of Circulating Tumor Cells in you organization? Q3. What do you think is the biggest challenge
More informationNCRI Biomarkers & Imaging CSG Cell-free DNA workshop
NCRI Biomarkers & Imaging CSG Cell-free DNA workshop Workshop Report Christie Education Centre, Manchester 30th January 2014 Sponsored by Workshop summary 86 delegates from a variety of specialities attended
More informationccfdna Webinar Series: The Basics and Beyond
ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,
More informationBlood-based biomarkers in lung cancer: prognosis and treatment decisions
Mini-Review Blood-based biomarkers in lung cancer: prognosis and treatment decisions Meng Xu-Welliver 1, David P. Carbone 2 1 Department of Radiation Oncology, 2 Division of Medical Oncology, Department
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationRound Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL
Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy
More informationESMO SUMMIT MIDDLE EAST 2018
ESMO SUMMIT MIDDLE EAST 2018 14 Years of progress in Prostate Cancer Standards of Care and new targets Name Ronald de Wit 6-7 April 2018, Dubai, UAE CONFLICT OF INTEREST DISCLOSURE Sub-title Sanofi Roche
More informationTargeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L
Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome
More informationUSE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm
More informationClinical Liquid Biopsy Explained: Applications, Techniques and Players
Volume XX, Issue 3 Clinical Liquid Biopsy Explained: Applications, Techniques and Players A minimally invasive diagnostic that can help clinicians detect, diagnose and manage cancer patients has long been
More informationCirculating biomarkers for prediction of treatment response
Cremona, October 5-7, 2013 Circulating biomarkers for prediction of treatment response Maria Grazia Daidone mariagrazia.daidone@istitutotumori.mi.it Department of Experimental Oncology & Molecular Medicine
More informationFast and Easy Isolation of T Cells
Fast and Easy Isolation of T Cells Isolate T Cells In As Little As 25 Minutes Isolate whole T cell populations as well as various T cell subsets with high purity and recovery using the fast and easy T
More informationEXO-DNAc Circulating and EV-associated DNA extraction kit
Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.
More informationCover Letter. Reviewer 1:
Cover Letter Michael Yang, M.D., Ph.D. Managing Editor of Cancer Research Frontiers 1188 Willis Ave, #109, Albertson, NY 11507, USA Phone: +1-917-426-1571 http://cancer-research-frontiers.org/ Dear Dr.
More informationGenomic tests to personalize therapy of metastatic breast cancers. Fabrice ANDRE Gustave Roussy Villejuif, France
Genomic tests to personalize therapy of metastatic breast cancers Fabrice ANDRE Gustave Roussy Villejuif, France Future application of genomics: Understand the biology at the individual scale Patients
More informationLUNG CANCER Searching early biomarkers in blood
LUNG CANCER Searching early biomarkers in blood Eloisa Jantus Lewintre Laboratorio Oncología Molecular- FIHGUV Servicio Oncología Médica, CHGUV Dpto Biotecnología- Universitat Politècnica de València CIBERONC,
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationExtracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
More informationThor Nilsen NeoGeneStar LLC January 22, 2015
Thor Nilsen NeoGeneStar LLC January 22, 2015 NeoGeneStar TM I. Liquid biopsy using circulating cell-free DNA: Cancer diagnostics Prenatal diagnostics Other disease states II. NeoGeneStar TM cell-free DNA
More informationLurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients
Lurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients Massimo Cristofanilli, MD Professor of Medicine Associate Director of Translational Research and Precision Medicine
More informationProspective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening
Prospective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening Results From a Multi-Year 620-Sample Study CRC: SLOW GROWING, PREVENTABLE POLYP TO CANCER CAN TAKE 5 TO 15 YEARS CANCER
More informationQué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo
Qué es la Biopsia Líquida? Células Tumorales Circulantes y Ácidos Nucleicos Circulantes Federico Rojo Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace
More informationLiquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System
Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular
More informationQIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation
QIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation Dr. Anne Arens & Dr. Jens Winter QIAGEN GmbH Title, Location, Date 1 How to prevent false positives with NGS
More informationDetecting Oncogenic Mutations in Whole Blood
WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013
More informationAssaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011
Assaying micrornas in biofluids for detection of drug induced cardiac injury HESI Annual Meeting State of the Science Session June 8, 2011 Karol Thompson, PhD Center for Drug Evaluation & Research US Food
More informationNew molecular targets in lung cancer therapy
New molecular targets in lung cancer therapy Giuseppe Pelosi Pathology Division, Science & Technology Park, IRCCS Multimedica, Milan Milan - Italy Advanced lung cancer (IIIB IV) Subtyping Oncogene addiction
More informationHigh Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods
High Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods 1. Introduction: An overview of CTC isolation methods 2. Challenges for direct comparisons of CTC recovery 3.
More informationProduct Overview CELL-FREE DNA BCT CELL-FREE RNA BCT CELL-FREE DNA URINE PRESERVE CYTO-CHEX BCT STRECK CELL PRESERVATIVE
FIXED ON INTEGRITY Product Overview CELL-FREE DNA BCT A blood collection tube for stabilization of cell-free plasma DNA, CTCs and cellular DNA. The preservative in Cell-Free DNA BCT stabilizes nucleated
More informationQué hemos aprendido hasta hoy? What have we learned so far?
Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;
More informationDiagnostic with alternative sample types (liquid biopsy)
MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology
More informationRD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationThe CellCollector TM technology
The CellCollector TM technology In vivo isolation of circulating tumor cells by the CellCollector TM system Dr. Klaus Lücke (CEO) Unmet medical need in oncology: Access to tumor cells not only at the time
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationEnterprise Interest No
Enterprise Interest No SY-05 Pulmonary Pathology: Options for targeted therapy in lung cancer Liquid biopsy in thoracic oncology Where are we now? Paul Hofman Laboratory of Clinical and Experimental Pathology
More informationDesign considerations for Phase II trials incorporating biomarkers
Design considerations for Phase II trials incorporating biomarkers Sumithra J. Mandrekar Professor of Biostatistics, Mayo Clinic Pre-Meeting Workshop Enhancing the Design and Conduct of Phase II Studies
More informationLUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia
LUNG CANCER pathology & molecular biology Izidor Kern University Clinic Golnik, Slovenia 1 Pathology and epidemiology Small biopsy & cytology SCLC 14% NSCC NOS 4% 70% 60% 50% 63% 62% 61% 62% 59% 54% 51%
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationRole of liquid biopsy in lung cancer 20/10/2017
Role of liquid biopsy in lung cancer 20/10/2017 Overview of Seminar Background Concept of liquid biopsy Different Biological Components of Liquid Biopsy Various samples used in liquid biopsy EGFR mutation
More informationA two-microrna signature in urinary exosomes for diagnosis of prostate cancer
Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationValidation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D
Validation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D Department of Radiation Oncology University of Florida College of Medicine Outline Objective
More informationThe potential for liquid biopsies in the precision medical treatment of breast cancer
Cancer Biol Med 2016. doi: 10.28092/j.issn.2095-3941.2016.0007 REVIEW The potential for liquid biopsies in the precision medical treatment of breast cancer Victoria A. Forte 1,2, Dany K. Barrak 2,3, Mostafa
More informationAssay Location Primer TaqMan probe Reference
Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original
More informationTHE ROLE OF CIRCULATING TUMOUR CELLS (CTCS) IN CANCER MANAGEMENT. Klaus Pantel, MD, PhD Chairman, Institute for Tumour Biology
THE ROLE OF CIRCULATING TUMOUR CELLS (CTCS) IN CANCER MANAGEMENT Klaus Pantel, MD, PhD Chairman, Institute for Tumour Biology AIMS OF RESEARCH ON CTCS & CTDNA Screening & early detection of cancer Estimation
More information7th November, Translational Science: how to move from biology to clinical applications
7th November, 2014 Translational Science: how to move from biology to clinical applications 1 Translational science: How to move from biology to clinical applications Translational cancer genomics and
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationECMC cfdna consensus meeting
ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients
More informationCirculating tumor cells as biomarker for hormonal treatment in breast and prostate cancer. Michal Mego
National Cancer Institute, Slovakia Translational Research Unit Circulating tumor cells as biomarker for hormonal treatment in breast and prostate cancer Michal Mego 2 nd Department of Oncology, Faculty
More informationResearch Benefitting Women with Metastatic Breast Cancer (Adrian Lee, PhD, Director, Women's Cancer Research Center)
A Glimmer of Hope Funding Request Revised 2018 Priorities & Updates on 2017 Funded Projects Magee-Womens Hospital of UPMC and the Women s Cancer Research Center Magee-Womens Hospital of UPMC and the Women
More information