Integrated platform for liquid biopsy-based personalized cancer medicine

Size: px
Start display at page:

Download "Integrated platform for liquid biopsy-based personalized cancer medicine"

Transcription

1 Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy

2 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Molecular Analysis & Therapy Selection Molecular Analysis & Therapy Selection 2

3 Cancer is an evolving disease Cellular heterogeneity is the basis for therapy resistance Selection for resistant, aggressive subclones by applied therapies Polzer and Klein, Nat Med 2013

4 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Surgery metastatic disease Information on systemic cancer? 4

5 Personalized cancer therapy Primary tumor single tumor cells Micrometastasis Metastasis Surgery metastatic disease Information on systemic cancer? Liquid Biopsy 5

6 Concept of liquid biopsy Information on systemic cancer in a simple blood test - Circulating tumor cells (CTCs) - Circulating tumor DNA (ctdna) - mirna (and other RNAs) - Extracellular vesicles (e.g. exosomes) Diaz and Bardelli, JCO 2014

7 Analysis of circulating tumor cells 1. Enrichment for CTC 2. Detection of CTC e.g. CellSearch 3. Isolation of single CTC e.g. DepArray TM 4. Whole Genome amplification (WGA) 5. Unbiased molecular analysis Ampli1 TM WGA

8 Molecular heterogeneity in breast cancer Patient MU09 Primary Her2 negative, CTC count 42 (Veridex) CK HER2 CD45 DAPI HER2 qpcr PIK3CA mut T02 T04 T05 T06 T10 T07

9 Molecular heterogeneity in breast cancer Patient MU09 Primary Her2 negative, CTC count 42 (Veridex) CK HER2 CD45 DAPI HER2 qpcr PIK3CA mut T02 T04 T05 T06 T10 T07 wt wt H1047R H1047R H1047R H1047R

10 Liquid biopsy platform at ITEM-R

11 Comprehensive liquid biopsy concept cfdna isolation from plasma Expertise in preanalytical workflows and sample logistics for liquid biopsy studies CTC enrichment from buffy coat

12 Comprehensive liquid biopsy concept Expertise in preanalytical workflows and sample logistics for liquid biopsy studies cfdna isolation from plasma Protocols available for customized strategies (e.g. epitope based/marker-free) CTC enrichment from buffy coat High blood volumes ( ml, leukapheresis Other body fluids (e.g. bone marrow, cerebro-spinal fluid) and organs (e.g. lymph nodes)

13 Molecular analysis of single cells of patients Whole transcriptome amplification (WTA) RNASeq analysis (HiSeq) lncrnaseq analysis (HiSeq) Small RNASeq analysis (MiSeq) Single cell transcriptomics bioinformatics (tailored to WTA technology) Cell lysis Whole genome amplification (WGA) Quality control for patient-derived cells CNV analysis (MiSeq) Whole Genome Sequencing (HiSeq) Whole Exome/Panel Sequencing (HiSeq) Error free single cell Seq (PCTEP ) Single cell genomics bioinformatics (tailored to WGA technology) Automated workflow

14 Preclinical models from liquid biopsy samples in vivo liquid biopsy models for: testing novel therapies tumor cells personalized therapy selection in vitro biomarker/ drug targets understanding metastastic progression

15 High-throughput screening of compounds in patient-derived cell models Cell culture 384-well assay plate Compound administration (nl) Distribution of patient-derived cellular models on assay plates Compound libraries readout (e.g. luminescence) Dispensing of detection reagent on cells incubation (37 o C) MTT, AlamarBlue, protease, ATP

16 ITEM-R - your premium partner for liquid biopsy solutions in a clinical context

17 Poster Z9 Dr. Bernhard Polzer Dr. Kamran Honarnejad Fraunhofer Institute for Toxicology and Experimental Medicine - ITEM Division of Personalized Tumor Therapy, Regensburg Am Biopark Regensburg Germany

Early dissemination in prostate cancer

Early dissemination in prostate cancer Early dissemination in prostate cancer Miodrag Guzvic, University of Regensburg, Germany Adjuvant Palliative M0 Initiation Diagnosis Surgery Metastasis Death Intervention window to delay or prevent metastasis

More information

LIQUID BIOPSY

LIQUID BIOPSY www.idisantiago.es LIQUID BIOPSY Miguel Abal Investigador I3SNS Oncoloxía Médica Traslacional Instituto de Investigación Sanitaria de Santiago (IDIS) Complexo Hospitalario Universitario de Santiago/SERGAS

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information

CTC in clinical studies: Latest reports on GI cancers

CTC in clinical studies: Latest reports on GI cancers CTC in clinical studies: Latest reports on GI cancers François-Clément Bidard, MD PhD GI cancers are characterized by Multimodal treatment strategies Treatments are adapted to tumor burden & prognosis

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

1/23/2017. Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical School

1/23/2017. Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical School Application of Cytologic Techniques to Circulating Tumor Cell Specimens Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity

More information

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester

Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester dsg6@le.ac.uk CFDNA/CTDNA Circulating-free AS A LIQUID DNA BIOPSY (cfdna) Tumour Biopsy Liquid Biopsy

More information

Molecular profiling of single circulating tumor cells with diagnostic intention

Molecular profiling of single circulating tumor cells with diagnostic intention Research Article Molecular profiling of single circulating tumor cells with diagnostic intention Bernhard Polzer 1,, Gianni Medoro 2,, Sophie Pasch 3, Francesca Fontana 2, Laura Zorzino 4, Aurelia Pestka

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Exosome DNA Extraction Kits

Exosome DNA Extraction Kits Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:

More information

Circulating Tumor DNA in GIST and its Implications on Treatment

Circulating Tumor DNA in GIST and its Implications on Treatment Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

Youngnam Cho. National Cancer Center Biomarker Branch

Youngnam Cho. National Cancer Center Biomarker Branch Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

CTC molecular characterization: Are we ready to move forward with clinical testing?

CTC molecular characterization: Are we ready to move forward with clinical testing? CTC molecular characterization: Are we ready to move forward with clinical testing? Michail Ignatiadis MD, PhD Jules Bordet Institute, Université Libre de Bruxelles Brussels, Belgium Breast cancer: Diagnostics

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

Next generation diagnostics Bringing high-throughput sequencing into clinical application

Next generation diagnostics Bringing high-throughput sequencing into clinical application Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no

More information

Liquid biopsy in lung cancer: The EGFR paradigm

Liquid biopsy in lung cancer: The EGFR paradigm Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships

More information

Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz

Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create

More information

Pros and cons of liquid biopsy: Ready to replace tissue?

Pros and cons of liquid biopsy: Ready to replace tissue? Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:

More information

OS related to CTC response (response: 30% decline) 4 weeks 8 weeks 12 weeks

OS related to CTC response (response: 30% decline) 4 weeks 8 weeks 12 weeks OS related to CTC response (response: 30% decline) 4 weeks 8 weeks 12 weeks 20 CTC characterization (DNA, RNA, proteins) - Therapeutic targets - Resistance mechanisms Detection of therapeutic targets on

More information

Present and future for clinical applications of extracellular vesicles

Present and future for clinical applications of extracellular vesicles Present and future for clinical applications of extracellular vesicles Natasa Zarovni, Exosomics Siena SpA, Italy xxxxxxxxxxxxxxxxxxx Exosomes have come a long way..as for many misunderstood geniuses,

More information

Challenges and unanswered questions for the next decade of circulating tumour cell research in lung cancer

Challenges and unanswered questions for the next decade of circulating tumour cell research in lung cancer Review Article Challenges and unanswered questions for the next decade of circulating tumour cell research in lung cancer Sumitra Mohan, Francesca Chemi, Ged Brady Clinical and Experimental Pharmacology

More information

Introduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory

Introduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory Introduction to liquid biopsies Rachel Butler All Wales Genetics Laboratory What is cell free DNA? Non-Invasive Prenatal Testing (NIPT) Extract DNA Genetic alterations detectable in circulating cell-free

More information

Lukas Bubendorf Pathologie. Liquid biopsies

Lukas Bubendorf Pathologie. Liquid biopsies Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA

More information

FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER

FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER C. NADAL 1-3, T. WINDER 4, A. GERGER 5-6, D. TOUGERON 7-8 SELECTED HIGHLIGHTS 1 Medical Oncology Department, Institut Clínic de Malalties

More information

Incorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical

Incorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical Incorporating pharmacodynamic, response and patient selection biomarkers Paul Elvin PhD Chief Translational Science Officer Aptus Clinical 22 Oncology drug development Biomarkers key for: Strong hypothesis

More information

Service and Collaboration

Service and Collaboration Summary Section 7 Introduction 68 Exosome and Microvesicle Isolation 69 EV protein quantification, sceening and profiling 69 Nanoparticle Tracking Analysis (NTA) 70 EV Nucleic Acid isolation 70 Nucleic

More information

The Avatar System TM Yields Biologically Relevant Results

The Avatar System TM Yields Biologically Relevant Results Application Note The Avatar System TM Yields Biologically Relevant Results Liquid biopsies stand to revolutionize the cancer field, enabling early detection and noninvasive monitoring of tumors. In the

More information

Importance of Methodology Certification and Accreditations to Perform Assays. Stan Hamilton, MD Head, Pathology and Laboratory Medicine

Importance of Methodology Certification and Accreditations to Perform Assays. Stan Hamilton, MD Head, Pathology and Laboratory Medicine Importance of Methodology Certification and Accreditations to Perform Assays Stan Hamilton, MD Head, Pathology and Laboratory Medicine 1 Disclosures No disclosures relevant to this presentation 2 A bad

More information

Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications

Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating

More information

Circulating Tumor Cells (CTC) Technologies

Circulating Tumor Cells (CTC) Technologies Table of Contents MIR036 I. SCOPE AND METHODOLOGY Scope of the Study Analytics and data presented in this report pertain to several parameters such as - Research Methodology This report is uniquely researched

More information

A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient Outcomes. March 17-18, 2015 New York, NY

A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient Outcomes. March 17-18, 2015 New York, NY A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient Outcomes March 17-18, 2015 New York, NY A Day in the Life of a Breast Cancer Doctor: Integrating Omics to Optimize Patient

More information

Liquid Biopsy: Implications for Cancer Staging & Therapy

Liquid Biopsy: Implications for Cancer Staging & Therapy Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate

More information

Patient Stratification and Precision Medicine in Pancreatic Cancer

Patient Stratification and Precision Medicine in Pancreatic Cancer Patient Stratification and Precision Medicine in Pancreatic Cancer 12èmes Journées November the 24th 2016 Piquemal David Core Business: RNA diagnostics A state of art platform & a 17-year expertise in

More information

What do liquid biopsies offer us for breast cancer patients?

What do liquid biopsies offer us for breast cancer patients? What do liquid biopsies offer us for breast cancer patients? Isaac Garcia-Murillas Breast Cancer Now Research Centre, The institute of Cancer Research, London, UK Molecular Analysis of breast cancer Invasive

More information

Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director

Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:

More information

Circulating tumor cells/dna/etc for Radiation Oncologists

Circulating tumor cells/dna/etc for Radiation Oncologists Circulating tumor cells/dna/etc for Radiation Oncologists Andrew Z. Wang, M.D. Associate Professor Director of Clinical and Translational Research Department of Radiation Oncology Carolina Center for Cancer

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer

Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Carolyn Hall, Ph.D. Department of Surgical Oncology The University of Texas MD Anderson Cancer Center Triple Negative Breast Cancer

More information

Information Guide - August Liquid Biopsies for Cancer Management

Information Guide - August Liquid Biopsies for Cancer Management Information Guide - August 2017 Liquid Biopsies for Cancer Management INFORMATION GUIDE - AUGUST 2017 Liquid Biopsies for Cancer Management CIRCULATING TUMOR DNA IN BLOOD AS A LIQUID BIOPSY FOR CANCER

More information

Products for cfdna and mirna isolation. Subhead Circulating Cover nucleic acids from plasma

Products for cfdna and mirna isolation. Subhead Circulating Cover nucleic acids from plasma MACHEREY-NAGEL Products for cfdna and mirna isolation Bioanalysis Subhead Circulating Cover nucleic acids from plasma n Flexible solutions for small and large blood plasma volumes n Highly efficient recovery

More information

Survey Results Q1. How would you best describe your organization?

Survey Results Q1. How would you best describe your organization? Survey Results Q1. How would you best describe your organization? Q2. How high would you rate the priority of Circulating Tumor Cells in you organization? Q3. What do you think is the biggest challenge

More information

NCRI Biomarkers & Imaging CSG Cell-free DNA workshop

NCRI Biomarkers & Imaging CSG Cell-free DNA workshop NCRI Biomarkers & Imaging CSG Cell-free DNA workshop Workshop Report Christie Education Centre, Manchester 30th January 2014 Sponsored by Workshop summary 86 delegates from a variety of specialities attended

More information

ccfdna Webinar Series: The Basics and Beyond

ccfdna Webinar Series: The Basics and Beyond ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,

More information

Blood-based biomarkers in lung cancer: prognosis and treatment decisions

Blood-based biomarkers in lung cancer: prognosis and treatment decisions Mini-Review Blood-based biomarkers in lung cancer: prognosis and treatment decisions Meng Xu-Welliver 1, David P. Carbone 2 1 Department of Radiation Oncology, 2 Division of Medical Oncology, Department

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy

More information

ESMO SUMMIT MIDDLE EAST 2018

ESMO SUMMIT MIDDLE EAST 2018 ESMO SUMMIT MIDDLE EAST 2018 14 Years of progress in Prostate Cancer Standards of Care and new targets Name Ronald de Wit 6-7 April 2018, Dubai, UAE CONFLICT OF INTEREST DISCLOSURE Sub-title Sanofi Roche

More information

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome

More information

USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida

USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm

More information

Clinical Liquid Biopsy Explained: Applications, Techniques and Players

Clinical Liquid Biopsy Explained: Applications, Techniques and Players Volume XX, Issue 3 Clinical Liquid Biopsy Explained: Applications, Techniques and Players A minimally invasive diagnostic that can help clinicians detect, diagnose and manage cancer patients has long been

More information

Circulating biomarkers for prediction of treatment response

Circulating biomarkers for prediction of treatment response Cremona, October 5-7, 2013 Circulating biomarkers for prediction of treatment response Maria Grazia Daidone mariagrazia.daidone@istitutotumori.mi.it Department of Experimental Oncology & Molecular Medicine

More information

Fast and Easy Isolation of T Cells

Fast and Easy Isolation of T Cells Fast and Easy Isolation of T Cells Isolate T Cells In As Little As 25 Minutes Isolate whole T cell populations as well as various T cell subsets with high purity and recovery using the fast and easy T

More information

EXO-DNAc Circulating and EV-associated DNA extraction kit

EXO-DNAc Circulating and EV-associated DNA extraction kit Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

Cover Letter. Reviewer 1:

Cover Letter. Reviewer 1: Cover Letter Michael Yang, M.D., Ph.D. Managing Editor of Cancer Research Frontiers 1188 Willis Ave, #109, Albertson, NY 11507, USA Phone: +1-917-426-1571 http://cancer-research-frontiers.org/ Dear Dr.

More information

Genomic tests to personalize therapy of metastatic breast cancers. Fabrice ANDRE Gustave Roussy Villejuif, France

Genomic tests to personalize therapy of metastatic breast cancers. Fabrice ANDRE Gustave Roussy Villejuif, France Genomic tests to personalize therapy of metastatic breast cancers Fabrice ANDRE Gustave Roussy Villejuif, France Future application of genomics: Understand the biology at the individual scale Patients

More information

LUNG CANCER Searching early biomarkers in blood

LUNG CANCER Searching early biomarkers in blood LUNG CANCER Searching early biomarkers in blood Eloisa Jantus Lewintre Laboratorio Oncología Molecular- FIHGUV Servicio Oncología Médica, CHGUV Dpto Biotecnología- Universitat Politècnica de València CIBERONC,

More information

New technologies reaching the clinic

New technologies reaching the clinic New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...

More information

Extracellular Vesicle RNA isolation Kits

Extracellular Vesicle RNA isolation Kits Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can

More information

Thor Nilsen NeoGeneStar LLC January 22, 2015

Thor Nilsen NeoGeneStar LLC January 22, 2015 Thor Nilsen NeoGeneStar LLC January 22, 2015 NeoGeneStar TM I. Liquid biopsy using circulating cell-free DNA: Cancer diagnostics Prenatal diagnostics Other disease states II. NeoGeneStar TM cell-free DNA

More information

Lurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients

Lurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients Lurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients Massimo Cristofanilli, MD Professor of Medicine Associate Director of Translational Research and Precision Medicine

More information

Prospective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening

Prospective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening Prospective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening Results From a Multi-Year 620-Sample Study CRC: SLOW GROWING, PREVENTABLE POLYP TO CANCER CAN TAKE 5 TO 15 YEARS CANCER

More information

Qué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo

Qué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo Qué es la Biopsia Líquida? Células Tumorales Circulantes y Ácidos Nucleicos Circulantes Federico Rojo Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace

More information

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular

More information

QIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation

QIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation QIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation Dr. Anne Arens & Dr. Jens Winter QIAGEN GmbH Title, Location, Date 1 How to prevent false positives with NGS

More information

Detecting Oncogenic Mutations in Whole Blood

Detecting Oncogenic Mutations in Whole Blood WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013

More information

Assaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011

Assaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011 Assaying micrornas in biofluids for detection of drug induced cardiac injury HESI Annual Meeting State of the Science Session June 8, 2011 Karol Thompson, PhD Center for Drug Evaluation & Research US Food

More information

New molecular targets in lung cancer therapy

New molecular targets in lung cancer therapy New molecular targets in lung cancer therapy Giuseppe Pelosi Pathology Division, Science & Technology Park, IRCCS Multimedica, Milan Milan - Italy Advanced lung cancer (IIIB IV) Subtyping Oncogene addiction

More information

High Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods

High Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods High Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods 1. Introduction: An overview of CTC isolation methods 2. Challenges for direct comparisons of CTC recovery 3.

More information

Product Overview CELL-FREE DNA BCT CELL-FREE RNA BCT CELL-FREE DNA URINE PRESERVE CYTO-CHEX BCT STRECK CELL PRESERVATIVE

Product Overview CELL-FREE DNA BCT CELL-FREE RNA BCT CELL-FREE DNA URINE PRESERVE CYTO-CHEX BCT STRECK CELL PRESERVATIVE FIXED ON INTEGRITY Product Overview CELL-FREE DNA BCT A blood collection tube for stabilization of cell-free plasma DNA, CTCs and cellular DNA. The preservative in Cell-Free DNA BCT stabilizes nucleated

More information

Qué hemos aprendido hasta hoy? What have we learned so far?

Qué hemos aprendido hasta hoy? What have we learned so far? Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;

More information

Diagnostic with alternative sample types (liquid biopsy)

Diagnostic with alternative sample types (liquid biopsy) MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology

More information

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

The CellCollector TM technology

The CellCollector TM technology The CellCollector TM technology In vivo isolation of circulating tumor cells by the CellCollector TM system Dr. Klaus Lücke (CEO) Unmet medical need in oncology: Access to tumor cells not only at the time

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

Enterprise Interest No

Enterprise Interest No Enterprise Interest No SY-05 Pulmonary Pathology: Options for targeted therapy in lung cancer Liquid biopsy in thoracic oncology Where are we now? Paul Hofman Laboratory of Clinical and Experimental Pathology

More information

Design considerations for Phase II trials incorporating biomarkers

Design considerations for Phase II trials incorporating biomarkers Design considerations for Phase II trials incorporating biomarkers Sumithra J. Mandrekar Professor of Biostatistics, Mayo Clinic Pre-Meeting Workshop Enhancing the Design and Conduct of Phase II Studies

More information

LUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia

LUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia LUNG CANCER pathology & molecular biology Izidor Kern University Clinic Golnik, Slovenia 1 Pathology and epidemiology Small biopsy & cytology SCLC 14% NSCC NOS 4% 70% 60% 50% 63% 62% 61% 62% 59% 54% 51%

More information

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

Role of liquid biopsy in lung cancer 20/10/2017

Role of liquid biopsy in lung cancer 20/10/2017 Role of liquid biopsy in lung cancer 20/10/2017 Overview of Seminar Background Concept of liquid biopsy Different Biological Components of Liquid Biopsy Various samples used in liquid biopsy EGFR mutation

More information

A two-microrna signature in urinary exosomes for diagnosis of prostate cancer

A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

Validation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D

Validation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D Validation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D Department of Radiation Oncology University of Florida College of Medicine Outline Objective

More information

The potential for liquid biopsies in the precision medical treatment of breast cancer

The potential for liquid biopsies in the precision medical treatment of breast cancer Cancer Biol Med 2016. doi: 10.28092/j.issn.2095-3941.2016.0007 REVIEW The potential for liquid biopsies in the precision medical treatment of breast cancer Victoria A. Forte 1,2, Dany K. Barrak 2,3, Mostafa

More information

Assay Location Primer TaqMan probe Reference

Assay Location Primer TaqMan probe Reference Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original

More information

THE ROLE OF CIRCULATING TUMOUR CELLS (CTCS) IN CANCER MANAGEMENT. Klaus Pantel, MD, PhD Chairman, Institute for Tumour Biology

THE ROLE OF CIRCULATING TUMOUR CELLS (CTCS) IN CANCER MANAGEMENT. Klaus Pantel, MD, PhD Chairman, Institute for Tumour Biology THE ROLE OF CIRCULATING TUMOUR CELLS (CTCS) IN CANCER MANAGEMENT Klaus Pantel, MD, PhD Chairman, Institute for Tumour Biology AIMS OF RESEARCH ON CTCS & CTDNA Screening & early detection of cancer Estimation

More information

7th November, Translational Science: how to move from biology to clinical applications

7th November, Translational Science: how to move from biology to clinical applications 7th November, 2014 Translational Science: how to move from biology to clinical applications 1 Translational science: How to move from biology to clinical applications Translational cancer genomics and

More information

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown

More information

ECMC cfdna consensus meeting

ECMC cfdna consensus meeting ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients

More information

Circulating tumor cells as biomarker for hormonal treatment in breast and prostate cancer. Michal Mego

Circulating tumor cells as biomarker for hormonal treatment in breast and prostate cancer. Michal Mego National Cancer Institute, Slovakia Translational Research Unit Circulating tumor cells as biomarker for hormonal treatment in breast and prostate cancer Michal Mego 2 nd Department of Oncology, Faculty

More information

Research Benefitting Women with Metastatic Breast Cancer (Adrian Lee, PhD, Director, Women's Cancer Research Center)

Research Benefitting Women with Metastatic Breast Cancer (Adrian Lee, PhD, Director, Women's Cancer Research Center) A Glimmer of Hope Funding Request Revised 2018 Priorities & Updates on 2017 Funded Projects Magee-Womens Hospital of UPMC and the Women s Cancer Research Center Magee-Womens Hospital of UPMC and the Women

More information