Piscirickettsia salmonis workshop. Campbell River

Transcription

1 Piscirickettsia salmonis workshop Campbell River

2 Snapshot of Cermaq 142 thousand tons gwe sold in thousand tons gwe estimated for 2014 Revenue (2013) NOK 5.2bn EBIT (2013) NOK 495m Norway Cermaq head office Canada Chile Employees: % owned by Mitsubishi Corporation Cermaq + Mitsubishi Corporation = #2 global salmon farmer Page 2

3 R&D within Cermaq at a glance R&D Manager at HQ Cermaq Group Central R&D Fish Health Research Group and lab in Bergen Norway Arctic Salmon Research Centre Finnmark, Norway About 20 project leaders whereof ca 10 with scientific background (Norway, Chile and Canada). Dedicated resources in each of the operation companies Two research centers with specialized operators started in 2015 Actively involved in joint public-private R&D with public funding (FHF, RCN, CORFO, Tax-refund) Turnover in R&D projects (2015) - NOK 61 mill of which 2/3 from Cermaq - 1/3 of the projects have public co-funding Page 3 Cermaq Chile R&D farm in Colaco Los Lagos, Chile

4 SRS R&D program SRS is currently the largest economic and environmental sustainability challenge in Chilean aquaculture, and for Cermaq as a group. This disease produces severe clinical manifestations causing high mortalities and is the major cause of antibiotic use in Chilean aquaculture Cermaq Chile initiated in 2011 the R&D project STOP SRS Early in 2015 this activity was strengthened by developing a SRS R&D program with overall objective to develop new knowledge and tools to combat SRS. Consisting of 12 specific projects with start-up in 2015 and Targeting to aid: - Vaccine development - Production / Area management - Treatment efficacy and optimization Page 4

5 Todays talk Characterization of Piscirickettsia salmonis from Chilean and Canadian salmonids P. Salmonis challenge experiment and treatment with Florfenicol Survival of two P. salmonis isolates in a active and sterile FW and SW microcosm Page 5

6 Page 6

7 Background Three species affected - Atlantic salmon, Rainbow trout and Coho salmon Differences in clinical signs and severity in Chile - Time - Species Difference in treatment efficacy Exists in Canada and Europe but causes more severe disease in Chile Most research and vaccine development done on the type strain isolate Page 7

8 Objective The main objective was to characterize genotypically and phenotypically various Piscirickettsia spp. isolates from Chile and Canada and compare them to the type-strain - This was done to obtain information about possible presence of heterogeneous clades that may explain the variable vaccine effect and the variable clinical expressions observed in the field Page 8

9 Materials and Methods P. salmonis isolates ( ) Puerto Montt 18 Chilean (including LF-89) 3,4 6 1 o Atlantic salmon (12) o Rainbow trout (4) o Coho salmon (LF-89) o Region X (17) o Region XI (1) o Mortalities from 1.9 to 21.4 % o Subacute acute and chronic clinic conditions o Microbiological samples from lesions, kidney, liver, spleen, brain 12, 14, 16, Chiloé Island , Two Canadian (same outbreak) o Atlantic salmon o British Columbia, Campbell River o Mortalities < 0.03 % o Chronic clinic condition o Microbiological samples from kidney Page 9

10 Isolates Isolate code Country County (Region) Sampling date Mortality (%) Host Sample tissue Clinical condition LF-89 Chile Puerto Montt (X) 1989 na Coho salmon kidney na Ch2-As-I Chile Chiloé Sur (X) ,8 Atlantic salmon k-l-sp-b acute Ch3-Rt-L Chile Calbuco (X) ,7 Rainbow trout lession sub-acute Ch4-Rt-L Chile Calbuco (X) ,7 Rainbow trout lession sub-acute Ch5-As-I Chile Chiloé Centro (X) ,1 Atlantic salmon k-l-b sub-acute Ch6-Rt-L Chile Calbuco (X) ,2 Rainbow trout lession sub-acute Ch7-As-L Chile Aysén (XI) na na Atlantic salmon muscle chronic Ch8-Rt-K Chile Chiloé Centro (X) ,9 Rainbow trout kidney sub-acute Ch9-As-na Chile Chiloé Centro (X) ,4 Atlantic salmon na sub-acute Ch10-As-I Chile Chiloé Sur (X) ,5 Atlantic salmon k-l-sp-b acute Ch11-As-I Chile Chiloé Centro (X) ,2 Atlantic salmon k-l-b sub-acute Ch12-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-l-b acute Ch13-As-I Chile Chiloé Centro (X) ,6 Atlantic salmon k-l-sp-b chronic Ch14-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-sp acute Ch15-As-I Chile Chiloé Centro (X) ,4 Atlantic salmon k-l-b-sp sub-acute Ch16-As-I Chile Chiloé Centro (X) June ,8 Atlantic salmon k-l-b acute Ch17-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-l-b acute Ch18-As-I Chile Chiloé Centro (X) ,6 Atlantic salmon k-l-b-sp chronic Ca19-As-I Canada British Columbia < 0,03 Atlantic salmon kidney chronic Ca20-As-I Canada British Columbia < 0,03 Atlantic salmon kidney chronic Page 10

11 Methods - Genotypic study Target gene Primer Direction Sequence (5-3 ) Reference 16s rdna Eug B27F Fwd AGAGTTTGATCMTGGCTCAG [28] Eug A1518R Rev AAGGAGGTGATCCANCCRCA [28] ITS SRS-ITS/F Fwd GTACACACCGCCCGTCACAC Present study SRS-ITS/R Rev CCTCACGGTACTAGTTCACTATCGG Present study dnak SRS-dnaK/F2 Fwd CCGTGTCGTGTGGCGCTAAAA Present study SRS-dnaK/R2 Rev TTGAGATTGAGCCTGCTCCGC Present study SRS-dnaK3/F1 Fwd CCGCGTGTGATTGAGAGTGC Present study SRS-dnaK3/R1 Rev CGTCATCACCCCACCCATGG Present study groel SRS-groEL/F1 Fwd CTTCGGTACCGGTTCCCGTC Present study SRS-groEL/R1 Rev TCTTGCAGTTTCTCGCGGTCG Present study SRS-groEL/F2 Fwd GTGAAGCTCTGGCAACACTCGTC Present study SRS-groEL/R2 Rev AGGAAGCTCTGCAACCATCGC Present study tbpb SRS-tbpB/F1 Fwd AACTGGGCAGGCGTCACTGTT Present study SRS-tbpB/R1 Rev CGGCGCGTCTCTAATGTTCG Present study SRS-tbpB2/F2 Fwd CCAAGCTGGATCACCGCCAT Present study SRS-tbpB2/R2 Rev AAAGATAGGCCCAGCCACGC Present study mltb SRS-mltB/F Fwd ACCACTCACGCGGCATCTAA Present study SRS-mltB/R Rev ACTCAAATCATACACCGCCATTGCA Present study ospa SRS-ospA/F Fwd AGCCGTCAAGAAGTCGGAGCT Present study Genetic characterization: Phylogeny of 16S rdna-its Phylogeny using ten concatenated housekeeping genes (MLSA) Multilocus sequence typing (MLST) method SRS-ospA/R Rev TGCCAACGACCATCCGCTTG Present study rada SRS-radA/F1 Fwd ATCAGTCGCCAGCCTGTTGG Present study SRS-radA/FR1 Rev GTCCTCGTTGCACTGGACGA Present study aira SRS-air/F1 Fwd GGGTGCGTCCGGGGATTATG Present study SRS-rairA/R1 Rev TAAGGTGCACGCAGTGGCAT Present study bax SRS-bax/F1 Fwd TCAAGGGATCTGGGAAGTGCT Present study SRS-bax/R1 Rev ACCACTGCCTATCTTGCTCAACA Present study tnpa SRS-tnpA/F1 Fwd ACCTGTTAAGTTCTCGGCCATT Present study SRS-tnpA/R1 Rev AGCCTTCACAAATGTCAACAAGTGA Present study elfp SRS-elfP/F Fwd GCCACKGCTAATTCAGCAA Present study SRS-elfP/R Rev STGGAATGGTCAGCCACYT Present study Page 11

12 The Fish Disease Group / The Department of Biology Methods - Phenotyping The phenotypic study: - Growth medium experiment - Optimization of growth medium - Temperature experiment - Antibiotic test - Other test - Indole test - Gram-staining - Oxidase test - Catalase test - Cefinase test - Triple Sugar Iron Agar - API ZYM kit - Hydrogen sulfide strips Page 12

13 Results Phylogeny of 16S rdna-its - Three clades: 2 Chilean - one Canadian Ch7 Ch14 Ch15 99 Ch12 Ch8 Ch11 Ch16 Ch17 Ch18 Ch10 Clade G2 Ch3 Ch4 Ch5 99 Ch6 LF-89 Ch2 Ca20 Clade G1 Ca19 Clade G Page 13

14 Results Phylogeny of concatenated HK genes - Isolates in clade 1 and 2 are better differentiated Ch7 Ch Ch11 Ch8 Ch16 Ch14 Ch12 Ch15 Ch17 Clade G2 Ch Ch Ch2 LF-89 Ch5 Ch3 Ch6-Rt-L Clade G1 Ca20 Ca19 Clade G Page 14

15 Results - MLST - Isolates from clade 1 and 2 are even better differentiated into several sequence types Ch18, ST12 Ch17, ST11 Ch15, ST10 Ch12, ST9 Ch8 Ch7 Ch14I ST8 Ch16 Ch11, ST7 Ch10 Ch3, ST6 Ch4 Ch5 ST5 Ch6, ST4 Ch2 LF-89 Ca19, ST2 ST3 Ca20, ST1 Page 15

16 Conclusions Chilean P. salmonis are differentiated into two groups, G1 and G2 The Chilean isolates are genetically distinct from the Canadian isolates, G3 The three genetic methods used show the same grouping among the 18 isolates of P. salmonis analyzed. MLST gives the best separation Page 16

17 Results - Growth media test Isolate SRS-BA CHAB CHAB w/fe Austral-TSHem BA BA w/2 % NaCl Ch11-G2-As-I Ch7-G2-As-L Ch14-G2-As-I Ch9-G2-As-na Ch13-G2-As-I Ch17-G2-As-I Ch2-G1-As-I Ch12-G2-As-I Ch15-G2-As-I W + + Ch10-G2-As-I Ch8-G2-Rt-K Ch18-G2-As-I Ca19-G3-As-I Ch16-G2-As-I LF Page 17

18 The Fish Disease Group / The Department of Biology Results - Optimal growth medium results Growth mediums: 1. SRS-BA 2. CHAB CHAB w/ 0.2 mm Fe 4. Austral-TSHem 5. BA w/ 2% NaCl 6. BA 7. MA 8. FLPA Page 18

19 Results - Growth medium To improve the growth of P. salmonis on solid media, a new optimized SRS blood agar (SRS-BA) was developed The composition of this agar was: - 40g of TSA (BD, Difco) - 20g of Red Sea Salt (RSS) (Red Sea, USA) - 50 ml of defibrinated sheep blood (DSB) (Oxoid Limited, UK) - 1g of L-cysteine (Sigma-Aldrich) - 5g of D-glucose (Sigma-Aldrich) - 50 ml of fetal bovine serum (FBS) (Thermo Scientific Hyclone, USA) mm ferric nitrate (Sigma-Aldrich) - Reverse osmosis water (RO) to a final volume of 1000 ml Page 19

20 Results - Temperature optimum Isolate Optimum growing temp ( C) LF Ch2-As-I Ch3-Rt-L Ch4-Rt-L Ch5-As-I Ch6-Rt-L Ca20-As-K Ch7-As-L Ch8-Rt-K Ch9-As-na Ch10-As-I Ch11-As-I Ch12-As-I Ch13-As-I Ch14-As-I Ch15-As-I Ch16-As-I Ch17-As-I Ch18-As-I Ca19-As-K Page 20

21 Results - Antibiotic sensitivity test Isolate Streptomycin Oxytetracycline Penicilin Ceftazidime Ampicilin Florfenicol LF ,5 19,5 24 Ch2-As-I 0,5 0,5 1, ,5 Ch3-Rt-L 3,5 8,5 0,5 0,5 2,5 4 Ch4-Rt-L ,5 17, Ch5-As-I ,5 12,5 19,5 Ch6-Rt-L 0 16, , Ch7-As-L ,5 10,5 14,5 Ch8-Rt-K ,5 13,5 24,5 Ch9-As-na ,5 24 Ch10-As-I 32,5 27,5 1,5 18, ,5 Ch11-As-I ,5 19 Ch12-As-I 0,5 17 9,5 12,5 1,5 22 Ch13-As-I 0,5 22 2, Ch14-As-I ,5 11,5 11,5 24,5 Ch15-As-I ,5 Ch16-As-I 0 3,5 6,5 12,5 8 17,5 Ch17-As-I 0,5 24,5 5, ,5 23 Most isolates sensitive to Florfenicol and Oxytetracycline One isolate with low sensitivity for Florfenicol Two isolates show low sensitivity to Oxytetracycline Most isolates has low sensitivity to Streptomycin Ch18-As-I Ca19-As-I Ca20-As-I 2, ,5 15, , ,5 2, ,5 Page ,5

22 Summery Phenotypic characterization Based in growth the isolates were defined as less fastidious and fastidious which correlates with clade 1 and 2 The fastidious had 16 ºC 19ºC as optimum growth temperature and less fastidious had 19ºC 22ºC which correlates with clade 1 and 2 Growth (speed, medium and numbers) and temperature optimum correlates with clades 1 and 2 Most isolates were susceptible to Florfenicol and Oxytetraclycline No significant differentiation in the other biochemical tests Page 22

23 P. Salmonis challenge experiment and treatment with Florfenicol

24 Background In Chile we can experience rapid reinfections of SRS resulting in several antibiotic treatments We wanted to investigate if the fish was reinfected by itself (No clearance) or from the environment. We also wanted to identify minimal inhibitory concentrations for 13 of our isolates and look at treatment regimes. Page 24

25 Challenge and treatment of SRS Objective - Identify if a Florfenicol and Flumequin treatment clears the P. salmonis infection Secondary objectives - Identify MIC values for Cermaq Chile P. salmonis isolates. - See if the does 10mg pr. kg for 10 or 20 days outperform or is equal to the florfenicol treatment dose used in Chile Page 25

26 MIC testing 13 isolates of P. salmonis collected in 2012 from Cermaq Chile sites were tested using 8 different doses for Florfenicol (a bacteriostatic) and Flumequin (Bactericidal) An inoculum of Mcfarland 4 was used and 100 ul was plated out on SRS-BA in triplicate, negative and positive controls were included Plates were read after 7 and 14 days to document growth Page 26

27 Nr. of isolates The MIC for 13 isolates of P.salmonis, 13 from Cermaq Chile Florfenicol 1 0 <0,25 0,25 0, >16 MIC ug/ml Page 27

28 Nr. of isolates The MIC for 13 isolates of P.salmonis, 13 from Cermaq Chile Flumequine 1 0 <0,25 0,25 0, >16 MIC ug/ml Page 28

29 Summary There were considerable variation in MIC for different isolates for both Florfenicol and Flumequine Different sensitivity phenotypes of P. salmonis exist within the same outbreak of SRS 3 of 4 isolates with quinolone resistance were isolated from rainbow trout We recommend an surveillance of the MIC in the future Page 29

30 Challenge trial setup 10 ip infected shedders 50 kohabitants of 65 gr. at start of treatment - 15 fish sampled during trial We used three treatment regimes: - 10 mg/kg for 10 days (suggested by the supplier) - 10 mg/kg for 20 days - 25 mg/kg for 18 days Skretting 3mm pellet standard or with 1 or 2 gram floraqpharma Page 30

31 Sampling Kidney for CFU and qpcr - Kidney of five fish is quantified and homogenized before plating in triplicates on SRS-BA for CFU counting - Kidney is quantified for qpcr quantifiaction (NA) Sampling was performed the day before treatment start and the day after treatment end Plasma and muscle tissue is sampled for Florfenicol quantification Gill and heart for detection of viral pathogens Water samples to monitor changes in infection pressure Page 31

32 Summary challenge Shedders mortality 11 dpi, develops different in the tanks - 3 weeks post challenge 9 of 70 shedders are alive - Positive control Cohab mortality starts 29 dpi - Total accumulative mortality 91% Treatment effects: - No cohab mortality in treated groups - No treated cohabs positive for P. salmonis by cultivation on agar - No differentiation between treatment regimes Page 32

33 Conclusions Chilean Piscirickettsia isolates in this study can be divided into two genogroups, 1 and 2 Canadian isolates in this study are genetically distinct from Chilean isolates Growth speed, media preference and temperature optimum correlates with genogroups MIC values varies among the tested isolates in Chile and it is recommended to do MIC testing going forward Page 33

34 Conclusions 2 Florfenicol seems to be able to clear P. salmonis under experimental conditions Page 34