Piscirickettsia salmonis workshop. Campbell River
|
|
- Mervin Pope
- 5 years ago
- Views:
Transcription
1 Piscirickettsia salmonis workshop Campbell River
2 Snapshot of Cermaq 142 thousand tons gwe sold in thousand tons gwe estimated for 2014 Revenue (2013) NOK 5.2bn EBIT (2013) NOK 495m Norway Cermaq head office Canada Chile Employees: % owned by Mitsubishi Corporation Cermaq + Mitsubishi Corporation = #2 global salmon farmer Page 2
3 R&D within Cermaq at a glance R&D Manager at HQ Cermaq Group Central R&D Fish Health Research Group and lab in Bergen Norway Arctic Salmon Research Centre Finnmark, Norway About 20 project leaders whereof ca 10 with scientific background (Norway, Chile and Canada). Dedicated resources in each of the operation companies Two research centers with specialized operators started in 2015 Actively involved in joint public-private R&D with public funding (FHF, RCN, CORFO, Tax-refund) Turnover in R&D projects (2015) - NOK 61 mill of which 2/3 from Cermaq - 1/3 of the projects have public co-funding Page 3 Cermaq Chile R&D farm in Colaco Los Lagos, Chile
4 SRS R&D program SRS is currently the largest economic and environmental sustainability challenge in Chilean aquaculture, and for Cermaq as a group. This disease produces severe clinical manifestations causing high mortalities and is the major cause of antibiotic use in Chilean aquaculture Cermaq Chile initiated in 2011 the R&D project STOP SRS Early in 2015 this activity was strengthened by developing a SRS R&D program with overall objective to develop new knowledge and tools to combat SRS. Consisting of 12 specific projects with start-up in 2015 and Targeting to aid: - Vaccine development - Production / Area management - Treatment efficacy and optimization Page 4
5 Todays talk Characterization of Piscirickettsia salmonis from Chilean and Canadian salmonids P. Salmonis challenge experiment and treatment with Florfenicol Survival of two P. salmonis isolates in a active and sterile FW and SW microcosm Page 5
6 Page 6
7 Background Three species affected - Atlantic salmon, Rainbow trout and Coho salmon Differences in clinical signs and severity in Chile - Time - Species Difference in treatment efficacy Exists in Canada and Europe but causes more severe disease in Chile Most research and vaccine development done on the type strain isolate Page 7
8 Objective The main objective was to characterize genotypically and phenotypically various Piscirickettsia spp. isolates from Chile and Canada and compare them to the type-strain - This was done to obtain information about possible presence of heterogeneous clades that may explain the variable vaccine effect and the variable clinical expressions observed in the field Page 8
9 Materials and Methods P. salmonis isolates ( ) Puerto Montt 18 Chilean (including LF-89) 3,4 6 1 o Atlantic salmon (12) o Rainbow trout (4) o Coho salmon (LF-89) o Region X (17) o Region XI (1) o Mortalities from 1.9 to 21.4 % o Subacute acute and chronic clinic conditions o Microbiological samples from lesions, kidney, liver, spleen, brain 12, 14, 16, Chiloé Island , Two Canadian (same outbreak) o Atlantic salmon o British Columbia, Campbell River o Mortalities < 0.03 % o Chronic clinic condition o Microbiological samples from kidney Page 9
10 Isolates Isolate code Country County (Region) Sampling date Mortality (%) Host Sample tissue Clinical condition LF-89 Chile Puerto Montt (X) 1989 na Coho salmon kidney na Ch2-As-I Chile Chiloé Sur (X) ,8 Atlantic salmon k-l-sp-b acute Ch3-Rt-L Chile Calbuco (X) ,7 Rainbow trout lession sub-acute Ch4-Rt-L Chile Calbuco (X) ,7 Rainbow trout lession sub-acute Ch5-As-I Chile Chiloé Centro (X) ,1 Atlantic salmon k-l-b sub-acute Ch6-Rt-L Chile Calbuco (X) ,2 Rainbow trout lession sub-acute Ch7-As-L Chile Aysén (XI) na na Atlantic salmon muscle chronic Ch8-Rt-K Chile Chiloé Centro (X) ,9 Rainbow trout kidney sub-acute Ch9-As-na Chile Chiloé Centro (X) ,4 Atlantic salmon na sub-acute Ch10-As-I Chile Chiloé Sur (X) ,5 Atlantic salmon k-l-sp-b acute Ch11-As-I Chile Chiloé Centro (X) ,2 Atlantic salmon k-l-b sub-acute Ch12-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-l-b acute Ch13-As-I Chile Chiloé Centro (X) ,6 Atlantic salmon k-l-sp-b chronic Ch14-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-sp acute Ch15-As-I Chile Chiloé Centro (X) ,4 Atlantic salmon k-l-b-sp sub-acute Ch16-As-I Chile Chiloé Centro (X) June ,8 Atlantic salmon k-l-b acute Ch17-As-I Chile Chiloé Centro (X) ,8 Atlantic salmon k-l-b acute Ch18-As-I Chile Chiloé Centro (X) ,6 Atlantic salmon k-l-b-sp chronic Ca19-As-I Canada British Columbia < 0,03 Atlantic salmon kidney chronic Ca20-As-I Canada British Columbia < 0,03 Atlantic salmon kidney chronic Page 10
11 Methods - Genotypic study Target gene Primer Direction Sequence (5-3 ) Reference 16s rdna Eug B27F Fwd AGAGTTTGATCMTGGCTCAG [28] Eug A1518R Rev AAGGAGGTGATCCANCCRCA [28] ITS SRS-ITS/F Fwd GTACACACCGCCCGTCACAC Present study SRS-ITS/R Rev CCTCACGGTACTAGTTCACTATCGG Present study dnak SRS-dnaK/F2 Fwd CCGTGTCGTGTGGCGCTAAAA Present study SRS-dnaK/R2 Rev TTGAGATTGAGCCTGCTCCGC Present study SRS-dnaK3/F1 Fwd CCGCGTGTGATTGAGAGTGC Present study SRS-dnaK3/R1 Rev CGTCATCACCCCACCCATGG Present study groel SRS-groEL/F1 Fwd CTTCGGTACCGGTTCCCGTC Present study SRS-groEL/R1 Rev TCTTGCAGTTTCTCGCGGTCG Present study SRS-groEL/F2 Fwd GTGAAGCTCTGGCAACACTCGTC Present study SRS-groEL/R2 Rev AGGAAGCTCTGCAACCATCGC Present study tbpb SRS-tbpB/F1 Fwd AACTGGGCAGGCGTCACTGTT Present study SRS-tbpB/R1 Rev CGGCGCGTCTCTAATGTTCG Present study SRS-tbpB2/F2 Fwd CCAAGCTGGATCACCGCCAT Present study SRS-tbpB2/R2 Rev AAAGATAGGCCCAGCCACGC Present study mltb SRS-mltB/F Fwd ACCACTCACGCGGCATCTAA Present study SRS-mltB/R Rev ACTCAAATCATACACCGCCATTGCA Present study ospa SRS-ospA/F Fwd AGCCGTCAAGAAGTCGGAGCT Present study Genetic characterization: Phylogeny of 16S rdna-its Phylogeny using ten concatenated housekeeping genes (MLSA) Multilocus sequence typing (MLST) method SRS-ospA/R Rev TGCCAACGACCATCCGCTTG Present study rada SRS-radA/F1 Fwd ATCAGTCGCCAGCCTGTTGG Present study SRS-radA/FR1 Rev GTCCTCGTTGCACTGGACGA Present study aira SRS-air/F1 Fwd GGGTGCGTCCGGGGATTATG Present study SRS-rairA/R1 Rev TAAGGTGCACGCAGTGGCAT Present study bax SRS-bax/F1 Fwd TCAAGGGATCTGGGAAGTGCT Present study SRS-bax/R1 Rev ACCACTGCCTATCTTGCTCAACA Present study tnpa SRS-tnpA/F1 Fwd ACCTGTTAAGTTCTCGGCCATT Present study SRS-tnpA/R1 Rev AGCCTTCACAAATGTCAACAAGTGA Present study elfp SRS-elfP/F Fwd GCCACKGCTAATTCAGCAA Present study SRS-elfP/R Rev STGGAATGGTCAGCCACYT Present study Page 11
12 The Fish Disease Group / The Department of Biology Methods - Phenotyping The phenotypic study: - Growth medium experiment - Optimization of growth medium - Temperature experiment - Antibiotic test - Other test - Indole test - Gram-staining - Oxidase test - Catalase test - Cefinase test - Triple Sugar Iron Agar - API ZYM kit - Hydrogen sulfide strips Page 12
13 Results Phylogeny of 16S rdna-its - Three clades: 2 Chilean - one Canadian Ch7 Ch14 Ch15 99 Ch12 Ch8 Ch11 Ch16 Ch17 Ch18 Ch10 Clade G2 Ch3 Ch4 Ch5 99 Ch6 LF-89 Ch2 Ca20 Clade G1 Ca19 Clade G Page 13
14 Results Phylogeny of concatenated HK genes - Isolates in clade 1 and 2 are better differentiated Ch7 Ch Ch11 Ch8 Ch16 Ch14 Ch12 Ch15 Ch17 Clade G2 Ch Ch Ch2 LF-89 Ch5 Ch3 Ch6-Rt-L Clade G1 Ca20 Ca19 Clade G Page 14
15 Results - MLST - Isolates from clade 1 and 2 are even better differentiated into several sequence types Ch18, ST12 Ch17, ST11 Ch15, ST10 Ch12, ST9 Ch8 Ch7 Ch14I ST8 Ch16 Ch11, ST7 Ch10 Ch3, ST6 Ch4 Ch5 ST5 Ch6, ST4 Ch2 LF-89 Ca19, ST2 ST3 Ca20, ST1 Page 15
16 Conclusions Chilean P. salmonis are differentiated into two groups, G1 and G2 The Chilean isolates are genetically distinct from the Canadian isolates, G3 The three genetic methods used show the same grouping among the 18 isolates of P. salmonis analyzed. MLST gives the best separation Page 16
17 Results - Growth media test Isolate SRS-BA CHAB CHAB w/fe Austral-TSHem BA BA w/2 % NaCl Ch11-G2-As-I Ch7-G2-As-L Ch14-G2-As-I Ch9-G2-As-na Ch13-G2-As-I Ch17-G2-As-I Ch2-G1-As-I Ch12-G2-As-I Ch15-G2-As-I W + + Ch10-G2-As-I Ch8-G2-Rt-K Ch18-G2-As-I Ca19-G3-As-I Ch16-G2-As-I LF Page 17
18 The Fish Disease Group / The Department of Biology Results - Optimal growth medium results Growth mediums: 1. SRS-BA 2. CHAB CHAB w/ 0.2 mm Fe 4. Austral-TSHem 5. BA w/ 2% NaCl 6. BA 7. MA 8. FLPA Page 18
19 Results - Growth medium To improve the growth of P. salmonis on solid media, a new optimized SRS blood agar (SRS-BA) was developed The composition of this agar was: - 40g of TSA (BD, Difco) - 20g of Red Sea Salt (RSS) (Red Sea, USA) - 50 ml of defibrinated sheep blood (DSB) (Oxoid Limited, UK) - 1g of L-cysteine (Sigma-Aldrich) - 5g of D-glucose (Sigma-Aldrich) - 50 ml of fetal bovine serum (FBS) (Thermo Scientific Hyclone, USA) mm ferric nitrate (Sigma-Aldrich) - Reverse osmosis water (RO) to a final volume of 1000 ml Page 19
20 Results - Temperature optimum Isolate Optimum growing temp ( C) LF Ch2-As-I Ch3-Rt-L Ch4-Rt-L Ch5-As-I Ch6-Rt-L Ca20-As-K Ch7-As-L Ch8-Rt-K Ch9-As-na Ch10-As-I Ch11-As-I Ch12-As-I Ch13-As-I Ch14-As-I Ch15-As-I Ch16-As-I Ch17-As-I Ch18-As-I Ca19-As-K Page 20
21 Results - Antibiotic sensitivity test Isolate Streptomycin Oxytetracycline Penicilin Ceftazidime Ampicilin Florfenicol LF ,5 19,5 24 Ch2-As-I 0,5 0,5 1, ,5 Ch3-Rt-L 3,5 8,5 0,5 0,5 2,5 4 Ch4-Rt-L ,5 17, Ch5-As-I ,5 12,5 19,5 Ch6-Rt-L 0 16, , Ch7-As-L ,5 10,5 14,5 Ch8-Rt-K ,5 13,5 24,5 Ch9-As-na ,5 24 Ch10-As-I 32,5 27,5 1,5 18, ,5 Ch11-As-I ,5 19 Ch12-As-I 0,5 17 9,5 12,5 1,5 22 Ch13-As-I 0,5 22 2, Ch14-As-I ,5 11,5 11,5 24,5 Ch15-As-I ,5 Ch16-As-I 0 3,5 6,5 12,5 8 17,5 Ch17-As-I 0,5 24,5 5, ,5 23 Most isolates sensitive to Florfenicol and Oxytetracycline One isolate with low sensitivity for Florfenicol Two isolates show low sensitivity to Oxytetracycline Most isolates has low sensitivity to Streptomycin Ch18-As-I Ca19-As-I Ca20-As-I 2, ,5 15, , ,5 2, ,5 Page ,5
22 Summery Phenotypic characterization Based in growth the isolates were defined as less fastidious and fastidious which correlates with clade 1 and 2 The fastidious had 16 ºC 19ºC as optimum growth temperature and less fastidious had 19ºC 22ºC which correlates with clade 1 and 2 Growth (speed, medium and numbers) and temperature optimum correlates with clades 1 and 2 Most isolates were susceptible to Florfenicol and Oxytetraclycline No significant differentiation in the other biochemical tests Page 22
23 P. Salmonis challenge experiment and treatment with Florfenicol
24 Background In Chile we can experience rapid reinfections of SRS resulting in several antibiotic treatments We wanted to investigate if the fish was reinfected by itself (No clearance) or from the environment. We also wanted to identify minimal inhibitory concentrations for 13 of our isolates and look at treatment regimes. Page 24
25 Challenge and treatment of SRS Objective - Identify if a Florfenicol and Flumequin treatment clears the P. salmonis infection Secondary objectives - Identify MIC values for Cermaq Chile P. salmonis isolates. - See if the does 10mg pr. kg for 10 or 20 days outperform or is equal to the florfenicol treatment dose used in Chile Page 25
26 MIC testing 13 isolates of P. salmonis collected in 2012 from Cermaq Chile sites were tested using 8 different doses for Florfenicol (a bacteriostatic) and Flumequin (Bactericidal) An inoculum of Mcfarland 4 was used and 100 ul was plated out on SRS-BA in triplicate, negative and positive controls were included Plates were read after 7 and 14 days to document growth Page 26
27 Nr. of isolates The MIC for 13 isolates of P.salmonis, 13 from Cermaq Chile Florfenicol 1 0 <0,25 0,25 0, >16 MIC ug/ml Page 27
28 Nr. of isolates The MIC for 13 isolates of P.salmonis, 13 from Cermaq Chile Flumequine 1 0 <0,25 0,25 0, >16 MIC ug/ml Page 28
29 Summary There were considerable variation in MIC for different isolates for both Florfenicol and Flumequine Different sensitivity phenotypes of P. salmonis exist within the same outbreak of SRS 3 of 4 isolates with quinolone resistance were isolated from rainbow trout We recommend an surveillance of the MIC in the future Page 29
30 Challenge trial setup 10 ip infected shedders 50 kohabitants of 65 gr. at start of treatment - 15 fish sampled during trial We used three treatment regimes: - 10 mg/kg for 10 days (suggested by the supplier) - 10 mg/kg for 20 days - 25 mg/kg for 18 days Skretting 3mm pellet standard or with 1 or 2 gram floraqpharma Page 30
31 Sampling Kidney for CFU and qpcr - Kidney of five fish is quantified and homogenized before plating in triplicates on SRS-BA for CFU counting - Kidney is quantified for qpcr quantifiaction (NA) Sampling was performed the day before treatment start and the day after treatment end Plasma and muscle tissue is sampled for Florfenicol quantification Gill and heart for detection of viral pathogens Water samples to monitor changes in infection pressure Page 31
32 Summary challenge Shedders mortality 11 dpi, develops different in the tanks - 3 weeks post challenge 9 of 70 shedders are alive - Positive control Cohab mortality starts 29 dpi - Total accumulative mortality 91% Treatment effects: - No cohab mortality in treated groups - No treated cohabs positive for P. salmonis by cultivation on agar - No differentiation between treatment regimes Page 32
33 Conclusions Chilean Piscirickettsia isolates in this study can be divided into two genogroups, 1 and 2 Canadian isolates in this study are genetically distinct from Chilean isolates Growth speed, media preference and temperature optimum correlates with genogroups MIC values varies among the tested isolates in Chile and it is recommended to do MIC testing going forward Page 33
34 Conclusions 2 Florfenicol seems to be able to clear P. salmonis under experimental conditions Page 34
Infectious Salmon Anemia - ISA. Dagfinn Ulriksen, M.Sc Special Adviser Aquaculture Aon Grieg Norway
Infectious Salmon Anemia - ISA Dagfinn Ulriksen, M.Sc Special Adviser Aquaculture Aon Grieg Norway 1 Initial comments Since the first confirmed outbreak of ISA in Norway in 1984, ISA has been associated
More informationThe surveillance program for infectious salmon anaemia (ISA) and bacterial kidney disease (BKD) in Norway 2016
Annual Report The surveillance program for infectious salmon anaemia (ISA) and bacterial kidney disease (BKD) in Norway 2016 Norwegian Veterinary Institute The surveillance program for infectious salmon
More informationAnnual Report. The surveillance program for infectious salmon anaemia (ISA) and bacterial kidney disease (BKD) in Norway 2018
Annual Report The surveillance program for infectious salmon anaemia (ISA) and bacterial kidney disease (BKD) in Norway 2018 The surveillance program for infectious salmon anaemia (ISA) and bacterial kidney
More informationBackground - aquaculture. Vaccination of fish Present status and future challenges. Background - vaccines. salmonid fish in Norway
Vaccination of fish Present status and future challenges Roar Gudding National veterinary institute Oslo, Norway Background - aquaculture Agriculture and fisheries will soon reach the maximum capacity
More informationScreening of Chinese Medicinal Herbs for the Inhibition of Brucella melitensis
5 th Proceedings of the Seminar in Veterinary Sciences, 5-8 January 2010 Screening of Chinese Medicinal for the Inhibition of Khoo Wen Wen & 1 Siti Khairani Bejo 1 Department of Veterinary Pathology and
More informationBusiness Idea We provide environmentally sound, safe and efficacious health products for the global aquaculture industry through targeted research
2009 Business Idea We provide environmentally sound, safe and efficacious health products for the global aquaculture industry through targeted research and the commitment of dedicated people index this
More informationFish Health Program 2006
Fish Health Program 2006 Fish Health Program 2006 FISH HEALTH REPORT 2006 i SECTION 1 OVERVIEW...1 1.1 EXECUTIVE SUMMARY...1 1.2 MANDATE...2 1.3 OBJECTIVES...2 SECTION 2 FISH HEALTH MANAGEMENT PLANS...3
More informationOIE work in pathogen differentiation (ISA as example)
OIE work in pathogen differentiation (ISA as example) Larry Hammell OIE Collaborating Centre (ERAAAD) Based on presentation by Brit Hjeltnes Guiding principles for appropriate pathogen differentiation
More informationSAFETY AND EFFICACY RESULTS AFTER VACCINATION WITH ALPHA MARINE Vibject.
SAFETY AND EFFICACY RESULTS AER VACCINATION WITH ALPHA MARINE Vibject. ALPHA MARINE Vibject is an emulsion vaccine for injection against vibriosis in cod. It contains formaldehyde-inactivated cultures
More informationStatus of Fish Health in Chile. Seminar Chile -Noruega August 2017
Status of Fish Health in Chile Seminar Chile -Noruega August 2017 Active monthly salmon sea sites 2016 15-16 Ene Feb Mar Abr May Jun Jul Ago Sept Oct Nov Dic Año 2015 360 348 349 350 351 355 339 350 351
More informationNorthern aquaculture; modern vaccine- and gene technology giving health and welfare to the fish and well-being to the farmer
Northern aquaculture; modern vaccine- and gene technology giving health and welfare to the fish and well-being to the farmer Paul J. Midtlyng School of Veterinary Medicine Norwegian University of Life
More informationTenacibaculum in Chile, current situation and potential preventive strategies. Jaime Tobar, PhD Virbac-Centrovet Chile
Tenacibaculum in Chile, current situation and potential preventive strategies Jaime Tobar, PhD Virbac-Centrovet Chile Virbac-Centrovet Founded in 1979, focused on the development of antibiotics, vitamins,
More informationRisk analysis for the movement of wild caught wrasse in Ireland
26 th September 2016 Risk analysis for the movement of wild caught wrasse in Ireland 1. Identification of Hazards: identification of pathogens that: (a) are notifiable and/or (b) could cause disease in
More informationVirulence Properties of Moritella viscosa Extracellular Products
Virulence Properties of Moritella viscosa Extracellular Products Bryndis Bjornsdottir Þorunn Gudmundsdottir Bjarnheidur K Gudmundsdottir Moritella viscosa Causes Winter ulcer disease in fish reared in
More informationFish Vaccination. Rohana Subasinghe
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Workshop 2 in cooperation with Malaysia Department of Fisheries and
More informationTenacibaculosis of farmed fish in Southern Europe
Departamento de Microbiología y Parasitología Fac. de Biología/CIBUS e Instituto de Acuicultura Universidad de Santiago de Compostela Tenacibaculosis of farmed fish in Southern Europe Alicia E. Toranzo
More informationDIAGNOSTIC TEST VALIDATION: EPIDEMIOLOGICAL APPROACHES
DIAGNOSTIC TEST VALIDATION: EPIDEMIOLOGICAL APPROACHES Larry Hammell Professor, Dept of Health Management Atlantic Veterinary College University of Prince Edward Island Charlottetown, Canada Edgar Brun
More informationThe fine art of protection
The fine art of protection NEW Protec is Skretting s prime functional feed for farmed fish. New Protec helps to shield skin, gut and gills; it supports the immune system, provides building blocks for new
More informationInfectious Salmon Anemia
Infectious Salmon Anemia A paradigm shift for understanding risk of ISAV infection Jill Rolland US Geological Survey Western Fisheries Research Center Seattle, Washington Infectious Salmon Anemia history
More informationEpidemiological study of CMS
Epidemiological study of CMS An ongoing research project in Norway Julie Christine Svendsen Photo credit: Johan Wildhagen An outline of todays talk: Introduction A brief history of CMS Epidemiology Knowledge
More informationSurvival of antibiotic resistant Pseudomonas strains in different types of water
Bangladesh}. Fish. Res., 1 (2) : 39-45 Bangladesh Fisheries Research Institute July 1997 Survival of antibiotic resistant Pseudomonas strains in different types of water M. S. Islam and M. B. R. Chowdhury
More informationThe surveillance and control programme for viral haemorrhagic septicaemia
Annual Reports 2008 Surveillance and control programmes for terrestrial and aquatic animals in Norway National Veterinary Institute The surveillance and control programme for viral haemorrhagic septicaemia
More informationDNA Vaccination Against IHN Virus: A Disease of Trout and Salmon
DNA Vaccination Against IHN Virus: A Disease of Trout and Salmon Scott E. LaPatra Clear Springs Foods, Inc., Research Division, Buhl, Idaho, U.S.A. Infectious Hematopoietic Necrosis Virus (IHNV) Family:
More informationThe surveillance programme for virus associated with disease in rainbow trout (PRVom) in 2016
Annual Report The surveillance programme for virus associated with disease in rainbow trout (PRVom) in 2016 Norwegian Veterinary Institute The surveillance programme for virus associated with disease in
More informationAnti-Pathogenic Flowthrough Treatment with Iodophor in Large- Scale Salmon Egg Incubation
Anti-Pathogenic Flowthrough Treatment with Iodophor in Large- Scale Salmon Egg Incubation Casey A. L. Risley & Mark A. Ahrens Spring Creek NFH Introduction Bonneville Dam Introduction Tule Fall Chinook
More informationBiosecurity in Water Recirculation Aquaculture Systems. Christopher Good. Biosafety and Biocontainment Symposium Baltimore, Maryland February 6-9
Biosecurity in Water Recirculation Aquaculture Systems Christopher Good Biosafety and Biocontainment Symposium Baltimore, Maryland February 6-9 Research at The Freshwater Institute At Issue Courtesy of
More informationEffects of Yeast Products on Immune Function and Disease Resistance of Hybrid Striped Bass
Effects of Yeast Products on Immune Function and Disease Resistance of Hybrid Striped Bass Peng Li and Delbert M. Gatlin, III Department of Wildlife and Fisheries Sciences and Faculty of Nutrition, Texas
More informationP. Varvarigos 1 & K. Way 2
Bull. Eur. Ass. Fish Pathol., 22(3) 2002, 195 First isolation and identification of the Infectious Pancreatic Necrosis (IPN) virus from rainbow trout Onchorhynchus mykiss fingerlings farmed in Greece P.
More informationRifampin Resistance. Charlottesville, Virginia i0w organisms in Trypticase soy broth (BBL Microbiology
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1980, p. 658-662 0066-4804/80/04-0658/05$02.00/0 Vol. 17, No. 14 Treatment of Experimental Staphylococcal Infections: Effect of Rifampin Alone and in Combination
More informationGill diseases in maricultured Atlantic salmon in Norway - results from ongoing projects
Gill diseases in maricultured Atlantic salmon in Norway - results from ongoing projects Terje Steinum, Mona Gjessing, Duncan Colquhoun, Anne Berit Olsen, Kai- Inge Lie* and Anne-Gerd Gjevre *FishVetGroup
More informationApplication of the QuEChERS extraction method for the analysis of pyrethrin and pyrethroid pesticides in fin and non-fin fish.
Application of the QuEChERS extraction method for the analysis of pyrethrin and pyrethroid pesticides in fin and nonfin fish. Veronica Roscoe, Judy Judge, Dorothea F. K. Rawn 2 Health Products and Food
More informationValidation of the MALDI-TOF for the Identification of Neisseria gonorrhoeae
Proposal Validation of the MALDI-TOF for the Identification of Neisseria gonorrhoeae Laboratory Director Sandip H. Shah, Ph.D. 517-335-8063 517-335-8051 (fax) ShahS@Michigan.gov Acting Director, Division
More informationEvolution of infectious salmon anaemia virus (ISA virus)
Arch Virol (2012) 157:2309 2326 DOI 10.1007/s00705-012-1438-0 ORIGINAL ARTICLE Evolution of infectious salmon anaemia virus (ISA virus) Heidrun Plarre Are Nylund Marius Karlsen Øyvind Brevik Per Anton
More informationThe use of acidifiers in fisheries and aquaculture
The use of acidifiers in fisheries and aquaculture Christian Lückstädt, PhD in Fish Nutrition, ADDCON Nordic AS, Norway Contact address: christian.lueckstaedt@addcon.net Since the early 1980s, yearly growth
More informationReport on susceptibility of Salmonella serotypes in Belgium Vicky Jasson
CODA-CERVA Report on susceptibility of Salmonella serotypes in Belgium 2014. Vicky Jasson Veterinary and Agrochemical Research Centre 1 Introduction Salmonella is one of the most important bacterial zoonotic
More informationResistance against CMS and AGD. Vibeke Emilsen, Research scientist Aviemore 25. May 2016
Resistance against CMS and AGD Vibeke Emilsen, Research scientist Aviemore 25. May 2016 The farmers have some challenges Many of those challenges can be solved through focused and knowledge based breeding!
More informationPost-smolt welfare, performance and water quality in commercial scale, floating, semi-closed containment systems: Preline, Neptune and Eco-Cage.
Post-smolt welfare, performance and water quality in commercial scale, floating, semi-closed containment systems: Preline, Neptune and Eco-Cage. Sigurd Handeland Senior scientist, prof. II Production of
More informationCHAPTER 1. INTRODUCTION. Along with growth and spawning season, year at sexual maturity counts as another
CHAPTER 1. INTRODUCTION 1.1 Year at Sexual Maturity in Rainbow Trout Along with growth and spawning season, year at sexual maturity counts as another important trait in farming rainbow trout. Year at sexual
More informationShort Communication. S M Saksida 1, D Morrison 2 and C W Revie 3
doi:10.1111/j.1365-2761.2010.01192.x Short Communication The efficacy of emamectin benzoate against infestations of sea lice, Lepeophtheirus salmonis, on farmed Atlantic salmon, Salmo salar L., in British
More informationStool bench. Cultures: SARAH
Stool bench The bacteria found in stool are representative of the bacteria that are present in the digestive system (gastrointestinal tract). Certain bacteria and fungi called normal flora inhabit everyone's
More informationSurveillance of Enterococci in Belgium. M. Ieven, K. Loens, B. Jans and H. Goossens
Surveillance of Enterococci in Belgium M. Ieven, K. Loens, B. Jans and H. Goossens Surveillance of Enterococci in Belgium Overview Introduction and epidemiological surveillance Results of isolates received
More informationPathogen recognition proteins in rainbow trout (O. mykiss) plasma
Pathogen recognition proteins in rainbow trout (O. mykiss) plasma S Russell*, K Young, M Edwards, A Peterson, A Reid, JS Lumsden. Fish Pathology Laboratory, Dept. of Pathobiology, University of Guelph,
More informationRESPONSIBLE USE OF ANTIMICROBIALS IN FISH PRODUCTION
RESPONSIBLE USE OF ANTIMICROBIALS IN FISH PRODUCTION Fish farmers have a responsibility to safeguard the health of the fish on their farm. Where appropriate farmers may ask their veterinary surgeon to
More informationVaccine development & Monitoring of field performance of a new PD vaccine in Norway
Vaccine development & Monitoring of field performance of a new PD vaccine in Norway PD TriNation 2016, Aberdeen 12 th Oct Ingunn Sommerset MSD Animal Health Human Health Animal Health 2 Development of
More informationSurvey & Diagnosis of fish diseases in 2014
Survey & Diagnosis of listed fish diseases in the European Community 214 2 Survey & Diagnosis of fish diseases in 214 An Annual questionnaire 1. General data Niels Jørgen Olesen, Niccolò Vendramin 19 th
More informationMolecular characterization of infectious pancreatic necrosis virus strains isolated from the three types of salmonids farmed in Chile
Manríquez et al. Virology Journal (2017) 14:17 DOI 10.1186/s12985-017-0684-x RESEARCH Molecular characterization of infectious pancreatic necrosis virus strains isolated from the three types of salmonids
More informationJ. Moya a, H. Pizarro a, M. Jashés a, E. De Clercq b, A.M. Sandino a, * Abstract
Antiviral Research 48 (2000) 125 130 www.elsevier.com/locate/antiviral In vivo effect of EICAR (5-ethynyl-1- -D-ribofuranosylimidazole-carboxamide) on experimental infected rainbow trout (Oncorhynchus
More informationHARMONISED PHARMACOPOEIA DEHYDRATED CULTURE MEDIA FOR SUPPORTING REGULATORY COMPLIANCE AVAILABLE NOW P O RTF O LIO.
DEHYDRATED CULTURE MEDIA FOR ENHANCED P O RTF O LIO AVAILABLE NOW HARMONISED PHARMACOPOEIA SUPPORTING REGULATORY COMPLIANCE A Neogen Company THE GATEWAY TO MICROBIOLOGY INTRODUCTION Harmonised Pharmacopoeia;
More informationA potential vaccine to control bacterial coldwater disease (CWD)
A potential vaccine to control bacterial coldwater disease (CWD) Ken Cain 1 and Jerry Zinn 2 Northwest Fish Culture Conference, Dec. 6-8 2011 1 Department of Fish and Wildlife and the Aquaculture Research
More informationProblems with early sexual maturation in on-growth farms
Utrecht University PUBERTIMING Photoperiod control of puberty in farmed fish: Development of new techniques and research into underlying physiological mechanisms G.L. Taranger 1, Eva Andersson 1, S.O.
More informationp.0 A new dimension in sustainable feed ingredients and sea lice treatment
p.0 A new dimension in sustainable feed ingredients and sea lice treatment October 2014 Salmon: a sustainable and organic alternative p.1 Key benefits Tested in trials and commercial farms Improves general
More informationALMA AQUACULTURE RESEARCH STATION University of Guelph, Office of Research
ALMA AQUACULTURE RESEARCH STATION University of Guelph, Office of Research RESEARCH HIGHLIGHTS 2007 2008 Project ARS 120 - Investigating the Radiation Bystander Effect in Fish. CONTACT INFORMATION: Aquaculture
More informationAhmed M. Darwish. HKD-Stuttgart National Aquaculture Research Center, ARS, USDA, Stuttgart, Arkansas. Introduction
Efficacy of florfenicol, copper sulfate and potassium permanganate in controlling a natural infection of Aeromonas hydrophila and Flavobacterium columnare in sunshine bass Ahmed M. Darwish HKD-Stuttgart
More informationEffects of water salinity and exercise on Atlantic salmon performance as postsmolts in land-based closedcontainment
Effects of water salinity and exercise on Atlantic salmon performance as postsmolts in land-based closedcontainment systems B.F. Terjesen 1*, T. Ytrestøyl 1, J. Kolarevic 1, S. Calabrese 2,3, B.O. Rosseland
More informationSession 2. TiLV isolation and Koch s Postulates
Session 2 Win Surachetpong DVM, PhD, CertAqV, DTBVP Kathy Tang-Nelson PhD TiLV isolation and Koch s Postulates Learning objectives Describe how viruses are isolated Apply the appropriate method to the
More informationTuesday September 4 th Archibald / Campbell Sea Lice 1 & 2 Moderator Mark Fast ( Atlantic Veterinary College / UPEI )
Sea Lice 2 Sea Lice 1 Tuesday September 4 th Archibald / Campbell Sea Lice 1 & 2 Moderator Mark Fast ( Atlantic Veterinary College / UPEI ) 9:30 AM Nowak - Amoebic Gill Disease An Emerging Disease in Mariculture?
More informationROVIMIX STAY-C 35. The vitamin C form for fish and shrimp. DSM Nutritional Products
ROVIMIX The vitamin C form for fish and shrimp DSM Nutritional Products ROVIMIX ROVIMIX designed for maximum stability in aggressively produced extruded diets. Fully bioavailable in salmon and trout. ROVIMIX
More informationSALMONIDS. Project Component Termination Report for the Period June 1, 1990 to August 31, 1996
SALMONIDS Project Component Termination Report for the Period June 1, 1990 to August 31, 1996 NCRAC FUNDING LEVEL: $479,796 (June 1, 1990 to August 31, 1996) PARTICIPANTS: Terence B. Barry University of
More informationReport: antimicrobial resistance in commensal Enterococcus spp. from poultry, pigs, cows and veal calves
Veterinary and Agrochemical Research Centre Report: antimicrobial resistance in commensal Enterococcus spp. from poultry, pigs, cows and veal calves P. Butaye 1 Introduction Enterococci are regarded as
More information*Corresponding author: ABSTRACT
Pathology and Hygiene SUSCEPTIBILITY, RESISTANCE AND ANTIBIOTIC PROFILE OF BACITRACIN AGAINST CLOSTRIDIUM PERFRINGENS STRAINS ISOLATED DURING CLINICAL OUTBREAKS OF EPIZOOTIC RABBIT ENTEROPATHY Richez P.
More informationFISH DISEASES - Diseases Caused By Viral Pathogens - Toshihiro Nakai, Motohiko Sano, Mamoru Yoshimizu, Hisae Kasai, Toshiaki Itami, Raja Sudhakaran
3. Salmon and Trout Viral Diseases Hisae Kasai and Mamoru Yoshimizu 3.1. Synopsis Transmissible diseases of socio-economic importance must be controlled within national boundaries. Salmon and trout viral
More informationUnderstanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry
Understanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry Timothy J. Johnson A, Lisa K. Nolan B, and Darrell W. Trampel C A University of Minnesota, Department of Veterinary
More informationOIE Collaborating Centre on Epidemiology and Risk Assessment for Aquatic Animal Diseases (ERAAAD)
OIE Collaborating Centre on Epidemiology and Risk Assessment for Aquatic Animal Diseases (ERAAAD) Workshop for OIE National Focal Points for Aquatic Animals Dubrovnik, Croatia, 16 18 November 2010 Edgar
More informationIMMUNOLOGICAL AND BACTERIOLOGICAL STUDIES ON ORNITHOBACTERIUM RHINOTRACHEALIS
IMMUNOLOGICAL AND BACTERIOLOGICAL STUDIES ON ORNITHOBACTERIUM RHINOTRACHEALIS PRESENTED BY RABAB AMIN KHALIFA UNDER THE SUPERVISION OF Prof. Dr. Mohamed Refai Prof. of Microbiology, Faculty of Vet. Med.
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS
The European Agency for the Evaluation of Medicinal Products Veterinary Medicines Evaluation Unit EMEA/MRL/104/96-FINAL June 1996 COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS FLUMEQUINE SUMMARY REPORT (1)
More informationDisinfection of unfertilized salmonid eggs: a new method for prevention of vertical transmission of Flavobacterium psychrophilum
Disinfection of unfertilized salmonid eggs: a new method for prevention of vertical transmission of Flavobacterium psychrophilum Akira Kumagai Miyagi Prefecture Fisheries Technology Institute Freshwater
More informationLyme Disease Diagnosed by Alternative Methods and Similar Syndromes: Research Approaches to Take us Forward
Lyme Disease Diagnosed by Alternative Methods and Similar Syndromes: Research Approaches to Take us Forward David M. Patrick University of British Columbia, Vancouver, Canada 2016 David Patrick, MD 1 Disclosures
More informationGram-negative rods. Enterobacteriaceae. Biochemical Reactions. Manal AL khulaifi
Gram-negative rods Enterobacteriaceae Biochemical Reactions Bacteria Gram positive Gram negative Cocci Bacilli Cocci Rods Characters of Enterobacteriaceae All Enterobacteriaciae Gram-negative rods Reduce
More informationReport: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013
Veterinary and Agrochemical Research Centre Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013 1 Introduction Commensal E. coli are regarded as general
More informationEpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management
EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management CPTR 2016 Workshop Washington, DC M.Rodrigue April 7th, 2016 1 Healthcare Associated Infection A Global Burden KNOWING
More informationDepartment of Employment, Economic Development and Innovation
Department of Employment, Economic Development and Innovation Berringa bioactive honey Comparison of honey vs silver for antibacterial activity January 2012 This project was commissioned by: Peter Woodward
More informationVirology 3. Polinski - Piscine Orthoreovirus Infection Dynamics and Host Interactions Depend on the Strain of Atlantic Salmon Infected
Virology Wednesday September 5 th Langevin / Cartier Virology Moderator - Mark Polinski ( Dept of Fisheries & Oceans Canada ) :5 PM Polinski - Piscine Orthoreovirus Infection Dynamics and Host Interactions
More informationInfectivity of a Scottish isolate of Piscirickettsia salmonis for Atlantic salmon Salmo salar and immune response of salmon to this agent
DISEASES OF AQUATIC ORGANISMS Vol. 60: 97 103, 2004 Published August 9 Dis Aquat Org Infectivity of a Scottish isolate of Piscirickettsia salmonis for Atlantic salmon Salmo salar and immune response of
More informationAspirin antagonism in isonizaid treatment of tuberculosis in mice ACCEPTED. Department of Molecular Microbiology & Immunology, Bloomberg School of
AAC Accepts, published online ahead of print on 4 December 2006 Antimicrob. Agents Chemother. doi:10.1128/aac.01145-06 Copyright 2006, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationWhy Bio Security is Essential in the Ornamental Fish Industry, and How to Implement it Danny Benjamin Hazorea Aquatics Kibbutz Hazorea, Israel
Why Bio Security is Essential in the Ornamental Fish Industry, and How to Implement it Danny Benjamin Hazorea Aquatics Kibbutz Hazorea, Israel 2 nd International Ornamental Fish Trade and Technical Conference
More informationNexus. Protec Special Edition. Skretting NEW. no.16 - Spring
Nexus Skretting no.16 - Spring 2013 www.skretting.com.au Protec Special Edition NEW Contents Protec Experiences 20 years of proactive fish health Protec s Australasian Success 6 4 Editorial James Rose
More informationGut Inflammation: Effects on Animal Production and Management Approaches
Gut Inflammation: Effects on Animal Production and Management Approaches Carrie Cook, Ph.D., Aova Technologies, Inc. The more we learn about inflammation, the more it captures a key role in our understanding
More informationCommunity acquired pneumonia due to Legionella pneumophila in a tertiary care hospital
101 Research article Community acquired pneumonia due to Legionella pneumophila in a tertiary care hospital Abstract BN Dissanayake 1,, DE Jayawardena 2, CG Senevirathna 1, TM Gamage 1 Sri Lankan Journal
More informationS. aureus NCTC 6571, E. coli NCTC (antibiotic
ISO Sensitivity Test Agar Code: KM1204 A semi-defined nutritionally rich sensitivity medium. It is composed of specially selected peptones with a small amount of glucose, solidified with a very pure agar
More informationESCMID Online Lecture Library. by author
Factors influencing the results of metronidazole resistance testing Elisabeth Nagy Institute of Clinical Microbiology, University of Szeged, National Anaerobe Reference Laboratory, Szeged, Hungary Postgraduate
More informationACCEPTED. Comparison of disk diffusion and agar dilution methods for erythromycin and
AAC Accepts, published online ahead of print on January 00 Antimicrob. Agents Chemother. doi:./aac.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationSuperchilling of organic food. Part 2: Storage test with superchilled organic salmon and pork chops
- Unrestricted Report Superchilling of organic food Part 2: Storage test with superchilled organic salmon and pork chops Authors Ingrid Camilla Claussen Per Egil Gullsvåg; Michael Bantle; Ignat Tolstorebrov;
More informationAs Easy as ABC -- Always Be Commercializing: Cellana s Multiproduct, Biorefinery- Based Business Model: Today, Tomorrow and in the Future
As Easy as ABC -- Always Be Commercializing: Cellana s Multiproduct, Biorefinery- Based Business Model: Today, Tomorrow and in the Future Valerie Harmon, Senior Director of R&D Cellana, LLC Page 1 Cellana
More informationDOSAGE AND ADMINISTRATION
Pr COLISTIMETHATE FOR INJECTION USP Colistimethate for Injection contains the sodium salt of colistimethate which is a polypeptide antibiotic with an approximate molecular weight of 1 750. The empirical
More informationAn update on research using nutrition to improve health in aquaculture
XIV FENACAM 15 DE NOVEMBRO DE 2017 CENTRO DE CONVENÇÕES DE NATAL An update on research using nutrition to improve health in aquaculture Xavier Cordoba DVM Animal Nutrition Director, Bioiberica S.A.U. Let
More informationVoriconazole Rationale for the EUCAST clinical breakpoints, version March 2010
Voriconazole Rationale for the EUCAST clinical breakpoints, version 2.0 20 March 2010 Foreword EUCAST The European Committee on Antimicrobial Susceptibility Testing (EUCAST) is organised by the European
More informationEvaluation of Antibacterial Effect of Odor Eliminating Compounds
Evaluation of Antibacterial Effect of Odor Eliminating Compounds Yuan Zeng, Bingyu Li, Anwar Kalalah, Sang-Jin Suh, and S.S. Ditchkoff Summary Antibiotic activity of ten commercially available odor eliminating
More informationOIE listed diseases Proposed changes. Brit Hjeltnes Aquatic Animal Health Standards Commission The OIE
OIE listed diseases Proposed changes Brit Hjeltnes Aquatic Animal Health Standards Commission The OIE Listed Diseases Safe movement Safe trade The OIE Aquatic Animal Health Code The OIE Manual of Diagnostic
More informationFish Waste Management :
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Final Workshop in cooperation with AVA Singapore and INFOFISH 12-14
More informationGrupo de Investigación en Acuicultura (GIA;
DIETARY USE OF PREBIOTICS IN GREATER AMBERJACK JUVENILES: EFFECTS ON GROWTH PERFORMANCE, IMMUNE GENE EXPRESSION AND DISEASE RESISTANCE AGAINST Neobenedenia girellae EU project 2014-2019 Grupo de Investigación
More informationThe surveillance and control programme for viral haemorrhagic septicaemia
Annual Report 2012 Surveillance and control programmes for terrestrial and aquatic animals in Norway Norwegian Veterinary Institute The surveillance and control programme for viral haemorrhagic septicaemia
More informationNew Brunswick E5B 2L9, Canada
Aquaculture 247 (2005) 211 217 www.elsevier.com/locate/aqua-online Development of an Atlantic salmon (Salmo salar) genetic improvement program: Genetic parameters of harvest body weight and carcass quality
More informationAPPLICATION Detection and isolation of pathogenic intestinal bacteria including Shigella and Salmonella from surfaces, food, or liquid samples.
HEK/SS Code 5543 COMING SOON! BioPaddles Colony Identification App Hektoen Enteric Agar (HEK) Salmonella Shigella Agar (SS) USE: Detection and isolation of pathogenic intestinal bacteria including Shigella
More informationCambridge International Examinations Cambridge International General Certificate of Secondary Education
www.xtremepapers.com Cambridge International Examinations Cambridge International General Certificate of Secondary Education *0510876364* BIOLOGY 0610/32 Paper 3 Extended October/November 2014 1 hour 15
More informationCHAPTER 8 ANTIBACTERIAL ACTIVITY OF THE CRUDE ETHANOLIC EXTRACT AND THE ISOLATED COMPOUNDS FROM THE STEM OF COSTUS IGNEUS
CHAPTER 8 ANTIBACTERIAL ACTIVITY OF THE CRUDE ETHANOLIC EXTRACT AND THE ISOLATED COMPOUNDS FROM THE STEM OF COSTUS IGNEUS 8.1 INTRODUCTION Medicinal plants are the backbone of traditional medicine and
More informationPD TriNation meeting & CMS workshop, VilVite, Bergen March th 2018 Program outline
PD TriNation meeting & CMS workshop, VilVite, Bergen March 13-15 th 2018 Program outline Tuesday, March 13th PD TriNation 8.30 Registration opens 9.00 Welcome & Chair: Camilla Wilson Situation updates
More informationLab-15 Gram Negative Bacteria Neisseria:
Lab-15 Gram Negative Bacteria Neisseria: د. زينب عادل چابك م. جوان احمد علي الهماوندي The genus Neisseria consists of gram-negative, catalase ve, oxidase +ve, non motile, diplococci. Grows well at aerobic
More information466 Biomed Environ Sci, 2014; 27(6):
466 Biomed Environ Sci, 2014; 27(6): 466-470 Letter to the Editor Modification and Evaluation of Brucella Broth Based Campylobacter jejuni Transport Medium * BAI Yao 1,2,$, CUI Sheng Hui 3,$, XU Xiao 3,
More informationSummary of epidemiological reports regarding outbreaks of ISA in Norway 2004
Summary of epidemiological reports regarding outbreaks of ISA in Norway 2004 To Norwegian Food Safety Authority From National Veterinary Institute, Norway Date 30.11.2004 Summary The Norwegian Veterinary
More information