The following slides are provided as presented by the author during the live educa7onal ac7vity and are intended for reference purposes only.

Transcription

1 The following slides are provided as presented by the author during the live educa7onal ac7vity and are intended for reference purposes only. If you have any ques7ons, please contact Imedex via at:

2 Chronic myelomonocytic leukemia 2016 European Focus on Myeloprolifera6ve Neoplasms and Myelodysplas6c Syndromes Zagreb, May 5 th, 2016

3 A myelodysplastic syndrome / myeloproliferative neoplasm WHO defini-on (2016) CMML MDS MPN Monocytosis > 1 G/L that persists for at least 3 months +/- BM cell dysplasia

4 Whole exome sequencing of 49 CMML 14 per patient (4-23) Mostly non synonymous variants Whole genome sequencing of 17 CMML 475 per patient (27-854) No recurrent variant in non-coding regions Nombre de mutations

5 Three genomic signatures, 2 clock-like processes CMML is a disease mostly due to ageing

6 Heterogeneous genetic landscape: ~40 recurrently mutated genes A characteristic molecular pattern TET2 (60%), SRSF2 (50%), ASXL1 (40%) +/- Ras path Epigene>c 92% Splicing 75% Signaling 60% Others 40%

7 CMML, myelodysplastic syndrome / myeloproliferative neoplasm New defini-on MDS NMP CMML Monocytosis > 1 G/L that persists for at least 3 months with clonal gene>c abnormali>es +/- BM cell dysplasia

8 ASXL1 mutations only have a strong negative prognostic impact Also prognostic: the number of mutations in recurrently mutated genes Overall survival AML- free survival Univariate analysis - OS ASXL1 P < CBL P = IDH2 P = 0.03 SRSF2 P = 0.03 M = 18.5 mo WT = 47.6 mo M = 14.7 mo WT = 45.7 mo

9 A prognostic score that includes ASXL1 mutations Parameter HR IC 95% P Points Age > ,007 2 WBC > 15 x10 9 /L 2, < 0,001 3 Hb < 11 (M) or 10 (F) g/dl 2, < 0,001 2 Platelets <100 x10 9 /L 1, < 0,001 2 ASXL1 mutaqon 1, ,001 2

10 A prognostic score that includes molecular information Training (GFM) : 312 Validation (MLL) :165 Low Int High Low Int High Risk Score Frequency Median OS Low % Not reached Intermediate % 38.5 High % 14.4 C index: 0.7 Itzykson R et al, J Clin Oncol, 2013

11 Conclusion 1 GeneQc abnormaliqes in CMML A mean number of 14 somatic mutations in coding regions A molecular signature of ageing A characteristic genomic fingerprint A strong prognostic impact of ASXL1 mutations A validated prognostic score (Mayo Clinic, International cohort)

12 CMML clonal architecture 1 Early clonal dominance 2 - Linear acquisition of mutations TET2 SRSF2 KRAS 3 - Growth advantage to the more mutated cells with differentiation

13 CMML clonal architecture 4 - Some branching events, mostly due to mito>c recombina>on Itzykson R et al, Blood 2013

14 Early dominance of TET2 mutations and GM differentiation bias CD34 + (Cord Blood) GM E CD33+,GPA- / CD33+,GPA+ 4,0 3,0 2,0 1,0 0,0 Sh:SCR * Sh:TET2 Sh:SCR ns Sh:TET2 CD34 + /CD38 - CD34 + /CD38 +

15 Response to GM- CSF is heterogeneous Nombre Number de of colonies % P= Contrôles Controls LMMC CMML 29% Serum- free medium GM- CSF 10 ng/ml

16 GranulomonocyQc hyperplasia in CMML GranulomonocyQc GranulomonocyQcMild bias of immature progenitors (100%) Early Mild phenotype Early clonal dominance of TET2 muta>ons? GM- CSF Myeloprolifera>ve GM- CSF hypersensiqvity (50%) Muta>on / variants deregula>on in cytokine signalling

17 exome sequencing - 1 untreated patients

18 Serial whole exome sequencing - 2 HMA-treated patients, Stable disease Non responders

19 Serial whole exome sequencing - 3 HMA-treated patients, Responders

20 100 Dynamic of molecular alterations 1 Before therapy 2 After decitabine initiation 3 After 10 cycles 4 After 23 cycles Variant frequency (%)

21 100 Dynamic of molecular alterations 1 Before therapy 2 After decitabine initiation 3 After 10 cycles 4 After 23 cycles Variant frequency (%)

22 100 Dynamic of molecular alterations 1 Before therapy 2 After decitabine initiation 3 After 10 cycles 4 After 23 cycles Variant frequency (%)

23 100 Dynamic of molecular alterations 1 Before therapy 2 After decitabine initiation 3 After 10 cycles 4 After 23 cycles Variant frequency (%)

24 Genetic alterations persist in an exceptional responder to HMA Serial analysis of an exceptionnal responders Eric Padron

25 Conclusion 3 In CMML, hypomethylating agents Do not decrease mutation allele burden Do not prevent genetic evolution of the leukemic clone

26 Changes in gene expression (RNA Seq) are observed mostly in responders Change > 2 Up Down Total Untreated Treated, non-responders Treated, responders

27 Changes in DNA methylation (errbs) are observed only in responders

28 Changes in DNA methylation pattern are observed only in responders

29 Response to hypomethylating agents Dissociation between Improved phenotype (with DNA demethylation & changes in gene expression) & Persistence / accumulation of genetic alterations Merlevede J et al, Nature Commun 2016

30 Baseline DNA methylation differences distinguish responders and nonresponders 20 sensi>ve and 19 resistant pa>ents 167 DMRs (FDR <0.1 and absolute methyla>on difference 25%) Hiearchical clustering of the pa>ents using the 167 DMRs

31 A specific transcriptional program associated with response to DAC.

32 Conclusion 5 CMML resistance to hypomethylating agents Differen>ally methylated regions (DMRs) of DNA at baseline (overlap with distal regulatory enhancers) Gene expression Cell cycle genes overexpressed in responders CXCL4 and CXCL7 overexpressed in nonresponders Meldi K et al, J Clin Invest 2015

33 Is CMML phenotype mostly due to epigenetic alterations?

34 tif1γ deletion/methylation in myeloid cells induces a CMML-like phenotype Control and CMML monocytes 4 n=9 n=9 Ctrl Δ/Δ Ctrl Δ/Δ * -139GGGAGGACGTCCGTGCGTACGTGCGCGTGCCGCAACCGCCCTCCTTCAAACGCGCGACGCG 3-139GGGAGGAYGT n=12 n= Weeks n=11 n= n=12 n=23 ** Ctrl Δ/Δ 44% 51% 1% Mac1-Alexa647 3% unconverted TYGTGYGTA YGTGYGYGTGT YGTAAT YGTTT TT TTTTAAA YGYGYGA YGYG! Control TIF1γ low TIF1γ normal expression (Subset # 1) (Part of subset # 2) Monocytes (k/mm3) Mouse KO model Gr1-FITC non methylated methylated

35 In CMML patients, TIF1γ expression increase in CD14 + cells is a biomarker of HMA efficacy Tif1γ mrna level Ctrl Dec. 170 TIF1γ 0 Cycles HSC70 Before decitabine -92 AAATGTGTGATGTGAGGGTGGGGGCGCCGCGTGCGTGTGTG! C C C C! Ader decitabine -92 AAATGTGTGATGTGAGGGTGGGGGTGTTGTGTGTGTGTGTG! Aucagne R et al, J Clin Invest. 2011

36 CD90+ CD45RA- HSC mttet2 early clonal dominace TIF1γ promoter méthyla>on Hyper signal (RAS) CD90- CD45RA- MPP CLP CD90- CD45RA+ CD10+ CMP CD123+ CD45RA- MEP CD123- CD45RA- (CD110+) GMP CD123+ CD45RA+ B/NK MK E G M DC B NK T

37 CD90+ CD45RA- HSC mttet2 early clonal dominance Responders to HMA CD90- CD45RA- MPP CLP CD90- CD45RA+ CD10+ RAS CMP CD123+ CD45RA- MEP CD123- CD45RA- (CD110+) GMP CD123+ CD45RA+ B/NK MK E G M DC B NK T

38 An international nomenclature defines three subsets of peripheral blood human monocytes CD14 low CD16 high non-classical monocytes MO3 CD14 + CD16 + Intermediate monocytes MO2 CD16 CD14 + CD16 - Classical monocytes MO1 Healthy donors MO1 < 94 % CD14

39 CMML monocytosis is made of classical CD14+,CD16- monocytes Aged healthy donor CMML Reac>ve monocytosis CD16 CD14

40 Increased fraction of classical (MO1) monocytes > 94% as a diagnostic marker of CMML Training cohort (CMML = 53, Others =175) Validation cohort (CMML=86; Others= 221) MO1 % of total monocytes *** MO1 (% of total monocytes) Cut-off 94% C o A g e d - C o N o n - C M M L R e a c t i v e C M M L Specificity 95.1% Sensitivity 91.9% Aged-Co Non-CMML Reactive CMML

41 The response to demethylating agents includes a decrease in classical MO1 monocyte fraction below 94% CD16 Before AZA CD14 Aler AZA MO1 (% of total monocytes) AZA Threshold 94% Responders (N=7) Selimoglu- Buet D et al, Blood 2015

42 Conclusion 5 Epigenetic alterations in CMML TIF1 gamma promoter methylation mir-150 down-regulation Restored in patients who respond to hypomathylating drugs

43 CMML, myelodysplastic syndrome / myeloproliferative neoplasm New defini-on MDS NMP CMML Monocytosis > 1 G/L that persists for at least 3 months with classical monocytes > 94% with clonal gene>c abnormali>es +/- BM cell dysplasia

44 GM- CSF Hypersensi>vity CD90+ CD45RA- HSC Muta6ons in TET2 / SRSF2 / RAS Hypermethyla6on TIF1γ, mir150 CD90- CD45RA- MPP CLP CD90- CD45RA+ CD10+ CMP CD123+ CD45RA- MEP MDSC CD123- CD45RA- (CD110+) GMP CD123+ CD45RA+ Defec6ve apoptosis B/NK pdc MK E G M DC B NK T

45 Conclusions CMML genetic abnormalities well-identified: the reason why these non-specific alterations generate the disease phenotype not well understood. A paradigmatic model to explore the link between genetic and epigenetic alteration Compared to AML, more phenotypic than genotypic heterogeneity Therapeutic strategies to explore: signaling & apoptosis, immune cell modulation, cytokine inhibition

46 INSERM U1170 Villejuif Sequencing Nathalie Droin Bioinforma6cs Jane Merlevede, Serge Koscielny Monocyte subsets Dorothée Selimoglu- Buet Clonal architecture Raphael Itzykson Margot Morabito Philippe Rameau CollaboraQons Romain Aucagne, Laurent Delva, Dijon Emile Chautard, Didier Auboeuf, Lyon Pierre Fenaux, Thorsten Braun, S de Bopon, B Quesnel, E Jourdan, GFM C Preudhomme, Lille O Kosmider, M Fontenay, Cochin Vincent Meyer, François Ar>guenave, Jean- François Deleuze, Evry William Vainchenker, Olivier Bernard, Villejuif Thérèse Commes, E Jourdan, Montpellier Valeria San>ni, Firenze Michael Strapon, Lev Alexandrov, Cambridge Ying>n Qin, Kristen Meldi, Maria Figueroa, Ann Harbor Velimir Gayevskiy, Marcel E Dinger, Mark J Cowley, Eric Padron, Tampa Kenishi Yoshida, Seichi Ogawa, Kyoto