CELLULAR RETINOIC ACID-BINDING PROTEIN 2 COOPERATES WITH HUR TO STABILIZE RNA AND INHIBIT TUMOR GROWTH AMANDA C. VREELAND

Transcription

1 CELLULAR RETINOIC ACID-BINDING PROTEIN 2 COOPERATES WITH HUR TO STABILIZE RNA AND INHIBIT TUMOR GROWTH by AMANDA C. VREELAND Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Dr. Noa Noy Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY January, 2015

2 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Amanda C. Vreeland candidate for the degree of Doctor of Philosophy*. Committee Chair: Monica M. Montano, Ph.D Committee Member: Hua Lou, Ph.D. Committee Member: Noa Noy, Ph.D. Committee Member: Derek J. Taylor, Ph.D. Committee Member: Bingcheng Wang, Ph.D Date of Defense: August 29, 2014 *We also certify that written approval has been obtained for any proprietary material contained therein. i

3 TABLE OF CONTENTS Page TABLE OF CONTENTS ii LIST OF TABLES v LIST OF FIGURES vi ACKNOWLEDGEMENTS viii ABSTRACT 1 CHAPTER 1: Background and Statement of Purpose 3 Background 3 Vitamin A and Retinoids 3 RA as a Regulator of Gene Expression 7 Intracellular Lipid Binding Proteins 12 Post-Transcriptional Regulation of Gene Expression by HuR 19 Breast Cancer 24 CRABP2 and FABP5 Regulate RA Signaling in Carcinogenesis 27 Statement of Purpose 32 CHAPTER 2: Transcript Stabilization by the RNA-binding protein HuR is Regulated by Cellular Retinoic Acid-Binding Protein 2 33 Abstract 33 Introduction 34 Materials and Methods 36 Results 40 CRABP2 upregulates the expression of Apaf1 and Elavl1 independently of its cooperation with RAR. 40 CRABP2 stabilizes Apaf1 and Elavl1 mrna in an HuR-dependent manner. 45 ii

4 Apo-CRABP2 interacts with HuR and enhances its affinity for target mrnas. 53 RA triggers transient dissociation of CRABP2 from HuR and target transcripts. 58 CRABP2 enhances apoptosis and suppresses carcinoma cell growth through its cooperation with HuR. 62 Discussion 67 Acknowledgements 69 CHAPTER 3: Cellular retinoic acid binding protein 2 (CRABP2) inhibits tumor growth by two distinct mechanisms 70 Abstract 70 Introduction 72 Materials and Methods 74 Results 77 CRABP2 and HuR regulate a common cohort of cancer-related genes. 77 CRABP2 inhibits mammary carcinoma cell growth by two distinct mechanisms. 82 HuR is required for CRABP2-mediated activation of RAR. 87 HuR is required for the RA-induced nuclear import of CRABP2. 90 Discussion 92 Acknowledgements 93 CHAPTER 4: Summary and Future Directions 95 Summary 95 Future Directions 96 What structural features mediate the interaction of CRABP2 and HuR? 96 Does CRABP1 cooperate with HuR? 98 Does HuR mediate the ER localization of CRABP2? 99 iii

5 Do HuR and CRABP2 interact in the nucleus? 100 What is the full spectrum of mrnas regulated by the cooperation of CRABP2 and HuR? 100 What is the role of HuR in general nuclear trafficking? 101 REFERENCES 102 iv

6 LIST OF TABLES Page Table 1.1: Nuclear Hormone Receptors 8 Table 1.2: Intracellular Lipid Binding Proteins 12 v

7 LIST OF FIGURES Page Figure 1.1: Chemical Structures of Retinoids 5 Figure 1.2: Vitamin A: Distribution and Metabolism 6 Figure 1.3: Nuclear Hormone Receptors 11 Figure 1.4: Three dimensional structure of holo-crabp2. 14 Figure 1.5: CRABP2 directly channels RA to RAR. 17 Figure 1.6: CRABP2 and FABP5 deliver RA to RAR and PPARβ/δ 30 Figure 2.1: Apo-CRABP2 upregulates Apaf1 and Elavl1 mrnas. 43 Figure 2.2: HuR mediates the ability of CRABP2 to stablize Apaf1 and Elavl1 mrnas. 47 Figure 2.3: HuR mediates the association of CRABP2 with mrna. 51 Figure 2.4: Apo-CRABP2 associates with HuR and enhances its affinity for target mrnas. 56 Figure 2.5: RA triggers transient dissociation of CRABP2 from HuR and target transcripts. 60 Figure 2.6: CRABP2 enhances apoptosis by cooperating with HuR. 64 Figure 2.7: A model for the parallel involvement of CRABP2 in HuR-mediated mrna stabilization and in RAR-mediated transcriptional regulation. 66 Figure 3.1: CRABP2 and HuR regulate a common subset of genes. 80 Figure 3.2: CRABP2 and HuR co-regulate cancer-related genes. 81 Figure 3.3: CRABP2 inhibits mammary carcinoma cell growth by two distinct mechanisms 85 Figure 3.4: Cell proliferation and apoptosis in tumors expressing CRABP2 or CRABP2ΔNLS 86 Figure 3.5: HuR is required for actvation of RAR and suppression of tumor development by CRABP2 89 vi

8 Figure 3.6: HuR is required for RA-induced nuclear translocation of CRABP2 _ 91 vii

9 ACKNOWLEDGEMENTS I would like to thank the many people who have supported me during the many years of education that has culminated in this dissertation. It was a true privilege to work under the mentorship of Dr. Noa Noy during graduate school. Noa has been a true mentor during the past several years helping me to grow as a scientist and as a person. Thank you for everything. Thank you to my thesis committee, Dr. Monica Montano (chair), Dr. Hua Lou, Dr. Derek Taylor, and Dr. Bingcheng Wang for their thoughtful suggestions and constructive critiques throughout graduate school. I would also like to thank past and present members of the Noy Lab. Everyone has been supportive in both scientific endeavors and helped to make it enjoyable to come to the lab on a daily basis. A special thank you to Daniel Berry, Ann Koehler, Liraz Levi, Daniella Rossetto, Shuiliang Yu, and Wei Zhang for collaborating with me on the work presented in this dissertation. I am also particularly grateful to Dan Berry, Grace Jin, and Darcie Seachrist for their help in my early years of graduate school and continued support and friendship today. Thank you to my family, especially my parents and sister, for their support throughout all my years of schooling. You have always been cheering me on (sometimes literally) and helping me when I asked (and even when I didn t). Words cannot describe how grateful I am for the help and support of all of you. viii

10 Cellular Retinoic Acid-Binding Protein 2 Cooperates with HuR to Stabilize RNA and Inhibit Tumor Growth ABSTRACT by AMANDA C. VREELAND Cellular retinoic acid-binding protein 2 (CRABP2) enhances the transcriptional activation of the nuclear receptors termed retinoic acid receptors (RARs) by transporting retinoic acid (RA) from the cytosol to the nucleus and directly channeling it to RARs. One outcome of this cooperation is that CRABP2 enhances the RAR-mediated anti-carcinogenic activity of RA. Interestingly, it has been reported that CRABP2 also regulates the expression of some genes and displays pro-apoptotic activities in the absence of RA, using a mechanism that does not involve RAR. These observations suggest a novel function for the protein. The goal of this work was to determine the molecular mechanism by which apo-crabp2 exerts its RA-independent activity and to examine whether it contributes to the tumor suppressive function of the protein. We found that apo-crabp2 cooperates with the RNA-binding and stabilizing protein HuR to upregulate and stabilize mrnas. CRABP2 directly interacts with HuR and enhances its affinity for target mrnas. We found further 1

11 that some transcripts that are co-regulated by CRABP2 and HuR include mrnas for cancer-related proteins such as apoptotic peptidase activating factor-1, caspase 7, BRCA1, and BRCA2. Additional studies revealed that both functions of CRABP2 respectively mediated by RAR and by HuR contribute to the tumor suppressive activity of the protein. 2

12 CHAPTER 1: Background and Statement of Purpose Background Vitamin A and Retinoids Since its discovery by McCollum and Davis a century ago (1), vitamin A has been appreciated as essential for life. Vitamin A is involved in a wide range of physiological processes including development, vision, immune responses, and reproduction. Vitamin A, retinol, and its metabolites, collectively termed retinoids, consist of a β-ionone ring, an isoprenoid tail, and a polar head group (Figure 1.1). Retinoids vary in the oxidation state of the polar head group. Retinol, the parental vitamin A molecule, has an alcohol moiety, retinal has an aldehyde moiety, and retinoic acid (RA) has a carboxylic acid moiety. Humans and other mammals are unable to synthesize vitamin A and must obtain it from dietary sources. Plant sources contain carotenoids, such as β- carotene (see Fig. 1.1 for chemical structure), which are cleaved by carotenoid oxygenases to form retinal; retinal is then oxidized to retinol by retinal dehydrogenases (2). Alternatively, vitamin A can be obtained from animal products in the form of retinyl esters (see Fig. 1.1 for chemical structure). After consumption, these esters are hydrolyzed into retinol (3). The conversion of these dietary components into retinol occurs in the intestinal lumen by lipases associated 3

13 with the plasma membrane of enterocytes. Retinol then moves into the enterocytes, where it is esterified and packaged into chylomicrons for secretion into circulation (3). A majority of these retinyl ester-containing chylomicrons are taken up into the liver, where the retinyl esters are hydrolyzed to retinol in the hepatocytes. Retinol is then transferred to the hepatic stellate cells and is reesterified by lecitchin:retinol acyl transferase (LRAT) for storage in the hepatic stellate cells (4). When the body is in need of vitamin A, retinyl esters are mobilized from stores in the hepatic stellate cells. The esters are hydrolyzed to retinol and retinol is transferred to hepatocytes. In the hepatocytes, retinol is bound by retinol binding protein (RBP) and secreted into the circulation for delivery to tissues throughout the body. Retinol enters target tissues where it is further metabolized(4). In target tissues, retinol can be re-esterified for storage or converted to RA by two enzymatic steps: retinol is oxidized to retinal by retinol dehydrogenases and retinal is then further oxidized into RA by retinal dehydrogenases(5). all-trans RA (hereafter referred to as RA) is the major transcriptionally active metabolite of vitamin A. It activates several members of the nuclear hormone receptor family of transcription factors: retinoic acid receptors (RARs- RARα, RARβ, RARγ) (6, 7) and peroxisome proliferator activated receptor β/δ (PPARβ/δ) (8, 9). The retinol pigment epithelium (RPE) of the eye can convert retinol to 11- cis retinal. After uptake into the RPE, retinol is re-esterified to retinyl esters. These esters are hydrolyzed and isomerized to 11-cis retinol by the isomerohydrolase 4

14 RPE cis retinol is then oxidized by retinol dehydrogenases to 11-cis retinal which serves as the visual chromophore (10, 11). See Figure 1.2 for a schematic of vitamin A distribution and metabolism. Figure 1.1: Chemical Structures of Retinoids Chemical structures of vitamin A (retinol), its dietary sources, and some metabolites. 5

15 Figure 1.2: Vitamin A: Distribution and Metabolism See text for details. RBP crystal structure was generated from PDB coordinates 1RBP using Pymol. 6

16 RA as a Regulator of Gene Expression RA activates several members of nuclear hormone receptor superfamily of transcription factors- retinoic acid receptors (RARα, RARβ, and RARγ) and peroxisome proliferator activated receptor β/δ (PPARβ/δ) (6-9). Nuclear Hormone Receptors. Nuclear hormone receptors are transcription factors. Upon binding of cognate ligands, some family members initiate gene transcription upon ligand binding (12-15). While others, such as reverse erbas (Rev-erbα, Rev-erbβ), repress gene transcription (16). Members of the nuclear hormone receptor super family are shown on Table 1.1. Based on a phylogenetic tree, nuclear receptors can be divided into 6 subclasses, 1-6. Unusual receptors are placed into their own subclass, 0. Ligands for nuclear receptors are small lipophilic compounds and hormones. Some members of the superfamily do not have a known ligand and are referred to as orphan receptors. There are two types of orphan receptors: 1) Receptors that are not able to bind ligand due to the presence of bulky sidechains in the ligand binding pocket (13, 17). Nurr1 is an example of an orphan receptor that cannot bind ligand (17). 2) Other orphan receptors have a functional ligand binding pocket, but the physiological ligand is unknown (13, 14, 18). Testis receptors (TR2 and TR4) are examples of orphan receptors believed to have an undiscovered physiological ligand (18). 7

17 Subclass Name Abbreviation/ Subtypes Some Reported Ligands 1 thyroid hormone receptor retinoic acid receptor peroxisome proliferator-activated receptor reverse erba RAR-related orphan receptor liver X receptor farnesoid X receptor TRα TRβ RARα RARβ RARγ PPARα PPARβ/δ PPARγ Rev-erbα Rev-erbβ RORα RORβ RORγ LXRα LXRβ FXRα FXRβ thyroid hormones thyroid hormones retinoic acid retinoic acid retinoic acid fatty acids, leukotriene B 4, fibrates fatty acids, retinoic acid fatty acids, prostaglandin J 2, thiazolidinediones orphan orphan cholesterol, cholesteryl sulfate retinoic acid orphan oxysterols, T , GW3965 oxysterols, T , GW3965 bile acids, fexaramine lanosterol vitamin D receptor VDR vitamin D, 1,25-dihydroxyvitamin D 3 pregnane X receptor PXR xenobiotics, 16α-cyanopregnenolone constitutive androstane receptor CAR xenobiotics, phenobarbital human nuclear factor 4 HNF4α orphan HNF4γ orphan RXRα retinoic acid retinoid X receptor RXRβ retinoic acid RXRγ retinoic acid 2 testis receptor TR2 orphan TR4 orphan tailless TLL orphan photoreceotpr-specific nuclear receptor PNR orphan chicken ovalbumin upstream promotertranscription COUP-TFI orphan factor COUP-TFII orphan ErbA2-related gene 2 EAR2 orphan estrogen receptor ERα estradiol-17β, tamoxifen, raloxifene ERβ estradiol-17β, various synthetic compounds ERR α orphan estrogen related receptor ERRβ DES, 4-OH tamoxifen 3 ERRγ DES, 4-OH tamoxifen glucocorticord receptor GR cortisol, dexamethasone, RU486 mineralcorticoid receptor MR aldosterone, spirolactone progesterone receptor PR progesterone, medroxyprogesterone acetate, RU486 androgen receptor AR testosterone, flutamide NGF-induced factor B NGFI-B orphan 4 Nur related factor 1 NURR1 orphan neuron-derived orphan receptor 1 NOR1 orphan 5 steroidogenic factor 1 SF1 orphan liver receptor homologous protein 1 LRH-1 orphan 6 germ cell nuclear factor GCNF orphan DSS-AHC critical region on the 0 chromosome, gene 1 DAX-1 orphan short heterodimeric partner SHP orphan Table 1.1: Nuclear Hormone Receptors 8

18 Structure and Mechanism of Action of Nuclear Receptors. Nuclear receptors have a common domain organization, as depicted in Figure 1.3 (12-15, 19). The N-terminal A/B domain is responsible for ligand-independent interactions with co-activators and other transcription factors. This domain is variable between family members (14, 19). The C-domain, also known as the DNA binding domain (DBD) consists of two zinc fingers and is responsible for receptor binding to DNA. This domain is highly conserved across family members and mediates interaction of receptors with specific response elements on DNA (12, 14, 19). Each type of receptor binds to a unique DNA sequence or response element. Response elements usually consist of direct or inverted repeats of the following six nucleotides (referred to as a half-site): (A/G)GGTCA. Repeats are separated a variable number of nucleotides (12). Members of subclass 0, DSS-AHC critical region on the chromosome gene 1 (DAX-1) and short heterodimeric partner (SHP), are unique because they do not contain a DBD (20, 21). These receptors bind to the ligand binding domain (LBD) of other nuclear receptors and prevent their transactivation by inhibiting co-activator recruitment, enhancing co-repressor binding, or preventing DNA binding (20, 21). The D-domain serves as a hinge between the DBD and the ligand binding domain (LBD) and often contains residues that target the receptors to the nucleus(19). 9

19 The E-domain serves as the LBD, where receptors interact with their ligands. The LBD consists of twelve alpha helices. Ligand binding induces a conformational change in the twelfth helix. This conformational change caps the ligand binding pocket and provides a surface for co-activator binding (22). The C-terminal F-domain is highly variable across family members and is not functionally well characterized(19). Dimerization of Nuclear Receptors. Many nuclear receptors act as dimers and can be classified based on mode of dimerization (summarized on Fig. 1.3B) (12): Class I receptors homodimerize upon ligand binding and bind inverted repeats of the half-site. Class I receptors include steroid receptors such as glucocorticoid receptor (GR), estrogen receptor (ER), progesterone receptor (PR), and androgen receptor (AR). Class II receptors include retinoic acid receptors (RARs) and peroxisome proliferator activated receptors (PPARs). These receptors bind DNA as heterodimers with a common heterodimerizaton partner, retinoid X receptor (RXR). The response element of class II receptors is a direct repeat of the halfsite. Class III receptors bind DNA as homodimers. In addition to being the obligatory partner for class II receptors, RXRs can also bind DNA as homodimers. The response element for class III receptors are direct repeats of the half-site. Class IV receptors bind to DNA and half-sites as monomers. 10

20 RARs and PPARβ/δ- RA serves as the ligand for two distinct groups of nuclear receptors- the retinoic acid receptors (RARα, RARβ, and RARγ) and PPARβ/δ. Both groups of nuclear receptors heterodimerize with RXR, but induce expression of distinct cohorts of target genes. Figure 1.3: Nuclear Hormone Receptors (A) Diagram showing domains of the nuclear hormone receptor superfamily. (B) Cartoon showing modes of dimerization of the 4 classes of receptors. See text for further details. 11

21 Intracellular Lipid Binding Proteins In addition to RAR and PPARβ/δ, RA-induced gene expression is mediated by two intracellular lipid binding proteins (ilbps) - cellular-ra binding protein 2 (CRABP2), and fatty acid-binding protein 5 (FABP5) (9, 23). ilbps are small (approximately 15 kilodaltons) cytosolic proteins that bind a variety of hydrophobic compounds (reviewed in (13, 24)). ilbps include fatty acid binding proteins (FABPs), cellular retinoic acid binding proteins (CRABPs), and cellular retinol binding proteins (CRBPs) as summarized on table 1.2. Name Tissue Expression Some Reported Ligands FABP1 liver, intestine, pancreas, kidney, stomach, lung oleate, fatty acyl-carnitines, 1- oleoylglycerol, lipoxygenase products, heme, bilirubin, xenobiotic drugs FABP2 intestine, liver long chain fatty acids, lipophilic drugs FABP3 cardiac/skeletal muscle, kidney, lung, stomach, palmitate, oleate, arachidonic acid, nonprostanoid oxygenated fatty acids testis, adrenal gland, mammary gland, placenta, ovary, brown adipose tissue FABP4 adipocytes, macrophages, dendritic cells, skeletal muscle fibers long chain fatty acids FABP5 skin, tongue, adipocytes, macrophage, dendritic cells, mammary gland, brain, stomach, intestine, kidney, liver, lung, heart, skeletal muscle, testis, retina, lens, spleen, placenta Table 1.2: Intracellular Lipid Binding Proteins stearic acid, all-trans RA, arachidonic acid FABP6 ileum, ovary, adrenal gland, stomach bile acid FABP7 brain, central nervous system, glial cell, retina, oleate, arachidonic acid, docosahexaenoic mammary gland acid (DHA) FABP8 peripheral nervous system, Schwann cells long chain fatty acids FABP9 testis, salivary gland, mammary gland long chain fatty acids FABP12 retina, testis CRABP1 ubiquitous RA CRABP2 skin, adipocyte progenitor cells, mammary gland, choroid plexus RA CRBP1 liver, kidney, lung, reproductive organs, choroid plexus, retinal pigment epithelium retinol, retinal CRBP2 small intestine retinol, retinal CRBP3 heart, skeletal muscle retinol, retinal 12

22 CRABPs and CRBPs display a strict ligand selectivity. CRABPs selectively bind isomers of RA (all-trans, 9-cis, 13-cis) with sub-nanomolar affinity (25, 26). CRBPs bind retinol and retinal with affinities in the range of nanomolar (27-29). FABPs, on the other hand, are much less selective in ligand binding and they bind many fatty acids and fatty acid derivatives (24). All ilbps have a similar three dimensional structure, consisting of an N- terminal helix-loop-helix domain and two anti-parallel β-sheets. The β-sheets form the ligand binding pocket and the helix-loop-helix serves as a cap to the pocket. The ligand is oriented with the polar head group (carboxylic acid, alcohol or aldehyde) buried in the ligand binding pocket (24). In figure 1.4, the three dimensional structure of holo-crabp2 is shown, as an example of an ilbp. In addition to solubilizing their hydrophobic ligands, ilbps also serve as trafficking molecules moving their ligands around cells and delivering them to other proteins. Ligand binding induces several ilbps, including CRABP2, FABP4, FABP5, and FABP1 to undergo nuclear translocation (9, 30-34). In the nucleus, these ilbps directly bind to specific nuclear receptors and form a complex through which ligand is mobilized to specific nuclear receptors. CRABP2, FABP4, FABP5, and FABP1 thus selectively deliver ligand to RARs (30, 35, 36), PPARγ (31, 37), PPAR β/δ (9, 31), and PPARα (38, 39), respectively. 13

23 Figure 1.4: Three dimensional structure of holo-crabp2. Generated using Pymol using PDB code 2FR3. RA is shown in red. Residues important for interaction with RAR are shown in blue and residues comprising the NLS are shown in green. CRABP2. CRABP2 is expressed throughout embryonic development, notably in the limbs and hindbrain, but its expression in the adult is limited to skin, uterus, mammary epithelium, choroid plexus, and adipocyte progenitor cells (40-48). Mice lacking CRABP2 (CRABP -/- ) display no defects in development, viability, fertility, life-span and general behavior, when fed a chow diet that is enriched with vitamin A (49). The only observed phenotype in CRABP2 -/- mice, under normal housing conditions, is the development of an extra digit on ~45% of mice (49). When CRABP2 +/- mice are challenged with a high-fat diet, they display enhanced adiposity (40). 14

24 CRABP2 enhances RAR transcriptional activation. A series of studies has shown that CRABP2 potentiates the response to RA by enhancing the transcriptional activation of RAR (30, 35, 36). First, over-expression of CRABP2, enhances RA-induced activation of an RAR response element (RARE)-driven reporter gene (30, 35, 36). Second, CRABP2 was shown to directly channel RA to RAR (30, 35). In support of this notion, recombinant CRABP2 was found to interact with recombinant RAR in a RA-dependent manner (30). Third, it was shown that CRABP2 translocates to the nucleus in response to RA (30, 32), where it can cooperate with RAR. Three residues near the entrance to the ligand binding pocket of CRABP2 were shown to mediate the cooperation of the protein with RAR. Comparison of the electrostatic surface potentials of CRABP2 and CRABP1 revealed a difference between the two proteins near the entrance to the ligand binding pocket at residues 75, 81, and 102 (36). CRABP1 is ~75% homologous to CRABP2, binds RA with nanomolar affinity, but does not enhance RAR transactivation or translocate to the nucleus in response to RA (25, 35, 36). Replacing residues Gln75, Pro81, and Lys102 of CRABP2 with the corresponding residues present on CRABP1- Glu75, Lys81, and Gln102, negated the ability of CRABP2 to enhance RAR transactivation (36). Likewise, swapping residues on CRABP1 for those on CRABP2, enabled CRABP1 to enhance RAR transactivation (36). These key residues are highlighted on Figure 1.4. Nuclear Localization of CRABP2. Nuclear localization of many proteins is mediated by interactions of cargo proteins with proteins termed importins. It is 15

25 well established that cargo proteins interact with importinα through a cluster of basic amino acid residues, known as a nuclear localization signal (NLS) (50-53). Cargo-bound importinα then interacts with importinβ, which facilitates transport across the nuclear pore complex (50). The ligand-induced change in its subcellular localization suggests that, in response to ligand binding, CRABP2 undergoes a conformational change that activates an NLS. Comparison of the electrostatic surface potentials of apo and holo CRABP2 revealed a cluster in the helix-loop-helix region of the protein that was neutral on apo-crabp2, but was basic on holo-crabp2 (32). This basic patch was mapped to Lys20, Arg29, and Lys30, highlighted in Figure 1.4. Mutation of these three basic residues to alanine inhibited interactions of CRABP2 with importinα and prevented nuclear translocation of the protein (32). Further, mutation of the NLS prevented CRABP2 from enhancing RAR transactivation (32). Lys20, Arg 29, and Lys 30 are conserved between CRABP1 and CRABP2; however, CRABP1 does not translocate to the nucleus in response to RA (30) 16

26 Figure 1.5: CRABP2 directly channels RA to RAR. Figure was modified from (54) apo-crabp2 is localized to the endoplasmic reticulum (ER). Microscopic examination of the subcellular localization of CRABP2, in the absence of RA, revealed that the protein is not evenly distributed throughout the cytoplasm (32, 55). This suggested that apo-crabp2 may be associated with a specific cellular organelle(s). Indeed, it was shown that CRABP2 co-localizes with ER markers in the absence of RA (56). It was further shown that SUMO-ylation at Lys102 is necessary for RA-induced dissociation of CRABP2 from the ER and nuclear translocation of the protein(55). 17

27 FABP5 FABP5, also known as epidermal FABP (E-FABP), keratinocyte FABP(K-FABP), and mal1, is expressed in a variety of tissues, including skin, tongue, adipocytes, macrophages, dendritic cells, mammary gland, brain, stomach, intestine, kidney, liver, lunch, heart, skeletal muscle, testis, retina, lens, spleen and placenta (24). FABP5 null (FABP5 -/- ) mice are viable and fertile (57), but they display deficits in learning and memory (58). FABP5 -/- mice also display deficits in adipose tissue and are protected from high-fat diet induced insulin resistance (57). In addition to binding fatty acids, FABP5 has also been shown to bind RA with nanomolar affinity (9). FABP5 binding to RA induces nuclear translocation of the protein and once in the nucleus, FABP5 enhances PPARβ/δ transactivation in a manner similar to that by which CRABP2 enhances RAR transactivation (9, 31, 33). Overexpression of FABP5 in cultured cells results in an increase in ligand induced PPARβ/δ transactivation (9, 31, 33). In response to ligand, FABP5 translocates to the nucleus (9, 31, 33). Like CRABP2, FABP5 contains a nuclear localization sequence consisting of Lys24, Arg33, and Lys34 in the helix-loop-helix domain of the protein(33). 18

28 Post-Transcriptional Regulation of Gene Expression by HuR Post transcriptionally, gene expression is regulated by a variety of mechanisms, including RNA splicing, mrna stability, and RNA interference. One of the proteins best characterized in regulating gene expression post-transcriptionally is HuR. HuR is a member of the Hu/embryonic lethal abnormal vision (Elav) family of proteins. This family consists of 4 proteins in vertebrates- HuR/HuA, HuB, HuC, and HuD, all of which bind to AU-rich or U-rich regions on RNA (59-63). Hu family members all have a similar domain structure, consisting of 3 RNA recognition motifs (RRMs), and a hinge region which is located between the second and third RRM (62, 63). HuB, HuC, and HuD are specifically expressed in neuronal tissues and have been reported to pay a role in RNA splicing, RNA stability and translation(64). HuR is expressed throughout the body (62, 63) and has been reported to be involved in translation of mrna, RNA interference, and RNA splicing (65-67). However, the best characterized function of HuR is in regulating mrna stability (65-67). HuR stabilizes mrnas. HuR is present in both the cytosol and nucleus and it is known to bind AU-rich elements (ARE) on RNA (62, 68, 69). mrnas containing AREs with a central AUUUA sequence are targeted for degradation(70). HuR stabilizes these transcripts and overexpression of HuR increases their half-lives (71). It was further shown that not all RRM containing proteins are able to stabilize ARE containing mrnas and that HuR does not stabilize mrnas containing a sequence involved in nonsense-mediated rapid decay (71). These observations 19

29 suggest that the ability to stabilize ARE containing mrnas is not a general feature of all proteins containing RRMs and that not all rapidly degraded mrnas are stabilized by HuR. It is believed that HuR regulates mrna stability by protecting mrnas from destabilizing proteins (72). ARE/poly-U-binding degradation factor 1 (AUF1) is well characterized to bind ARE and target such RNAs for degradation (73). Indeed, fluorescence resonance energy transfer (FRET) has shown that HuR is in close proximity to AUF1 in cells(74). Further, the two proteins can competitively bind the same sites on ARE-containing RNAs (75). These data suggest that there is an interplay between HuR and AUF1 in regulating the stability of ARE-containing mrnas. HuR undergoes nucleo-cytoplasmic shuttling. Although present in the cytosol of cells, HuR is predominantly a nuclear protein (71). Since ARE-mediated decay of RNA is believed to occur in the cytoplasm of cells, the possibility that HuR shuttles between the nucleus and cytoplasm was examined using heterokaryon assays. Indeed, HuR was able to move between nuclei, showing that it shuttles between the nucleus and cytoplasm of cells (71). Nucleo-cytoplasmic shuttling of HuR is mediated by residues , which are located in the hinge region of HuR (76). This same group of residues was also shown to be important for nuclear export of HuR, and these residues are referred to as the HuR nucleocytoplasmic shuttling or HNS sequence (76). Shuttling of HuR between the nucleus and cytosol suggests that HuR may export ARE containing RNAs from the nucleus into the 20

30 cytosol (71, 76). Indeed, it was later shown that HuR does export ARE containing mrnas (77). The specific mechanisms regulating the nuclear import and export of HuR are not completely understood. The nucleo-cytoplasmic shuttling of HuR is mediated by the same stretch of residues within the HNS (residues ) (76). These residues regulate nuclear import of HuR through Transportin 2 (TRN2) independent of a traditional NLS or importins (78). However, HuR has also been reported to interact with importinα (79, 80), but a NLS was not identified. Under cellular stress such as heat shock, HuR has been reported to be exported through two mechanisms. The first is through TRN2 and the second is the Crm1 export machinery. Crm1 export is mediated through protein-protein interactions with nuclear export signal (NES) containing proteins pp32 and APRIL (acidic protein rich in leucine) (81). Phosphorylation of HuR at several serine residues in the hinge region controls the nucleo-cytoplasmic distribution of HuR ((82-84) and reviewed in (85)). Under normal conditions, HuR is phosphorylated at serine 202, 221, or 242 resulting in a primarily nuclear localization of HuR. Inhibition of HuR phosphorylation results in a primarily cytosolic HuR. However, the relationship between phosphorylation of HuR and its ability to undergo nuclear import and export has not been examined. Additionally, phosphorylation of HuR at sites outside the HNS regulate its binding to target mrnas (84, 86-88). 21

31 Other Activities of HuR. In the nucleus, HuR has been reported to be involved in splicing of Fas pre-mrna (65) and polyadenylation of RNAs with U-rich sequences (89). More recently, RNA-sequencing technology has been used to identify, in an unbiased manner, what RNAs are bound by HuR (67, 90). Two groups independently showed that a large number of HuR binding sites are located in introns of pre-mrnas, supporting the previous report (65) that HuR is involved in splicing (67, 90). Many sequences found to be HuR binding sites were within nucleotides of seed sequences for microrna binding (67, 90), suggesting a role for HuR in RNA interference. HuR has also been reported to directly alter the translation of a number of RNAs (reviewed in (72)), including its own (91). Biological Functions of HuR. As suggested by its ubiquitous expression, HuR is involved in a wide variety of biological activities including cell growth, apoptosis, differentiation, adipogenesis and inflammation (reviewed in (72, 92-95)). HuR-null (HuR -/- ) die in utero; postnatal whole body deletion of HuR results in death of mice within ten days (96), reflecting the importance of the protein. HuR has been reported to enhance proliferation and cell cycle progression through stabilization of a number of pro-proliferative target mrnas (reviewed in (97)). However, it has also been reported that the protein is required for apoptosis (98), that it sensitizes cells to doxorubicin-induced cell death (99), and that it inhibits tumor growth in a mouse model (100). Further, in human breast cancers, 22

32 low expression of HuR was found to be correlated with a higher risk of tumor recurrence (101). 23

33 Breast Cancer Breast cancer has been recognized as a heterogeneous disease(102). As early as 1968, more than 8 distinct subtypes of breast cancer had been described(103). Traditionally, the disease has been classified based on clinical characteristics such as tumor size, metastases and histopathology. A more modern approach to classifying breast cancer is by the molecular characteristics of tumors, such as gene expression, as first demonstrated by Perou and coworkers in 2000(104). Another way of classifying the disease is on the basis of three receptors: estrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (EGFR2/ErbB2/Her2/neu). Estrogen Receptors (ERs) Approximately 75% of mammary cancer patients have ER positive (ER+) tumors (105). Like RARs and PPARβ/δ, ERs (ERα and ERβ) are nuclear hormone receptors. ERs are class II nuclear hormone receptors that act as homodimers. Estrogen-activated ER promotes mammary tumor development and inhibition of the receptor is widely used to treat ER+ breast cancers(106). Selective estrogen receptor modulators (SERMs) such as tamoxifen and raloxifene bind to ER and inhibit its activation in breast tissue but activate it in other tissues (106, 107). Aromatase Inhibitors (AIs) such as letrozole, anastrozole, and exemestane, inhibit the aromatase enzyme that synthesizes estrogen (106, 107). Inhibition of aromatases results in lower circulating levels of estrogen and decreased activation of ER. 24

34 Progesterone Receptor (PR) PR is often used as a means to predict what patients with ER+ tumors will respond to anti-estrogen therapies. PR is transcriptionally regulated by ER, and patients whose tumors co-express ER and PR are the most responsive to estrogen targeted therapies (105). Approximately 60% of breast cancer patients have PR positive (PR+) tumors, with a large majority of those cases also being ER+ (105). Epidermal Growth Factor Receptor 2 Epidermal growth factor receptor 2 (EGFR2), also known as ErbB2, Her2 and neu, is a member of the epidermal growth factor receptor (EGFR) family of tyrosine kinases. The 4 EGFRs (EGFR1-4) are transmembrane proteins that activate signaling cascades leading to cell growth and proliferation. Thus, misregulation of EGFRs can lead to uncontrolled proliferation. Ligand binding to the extracellular domain of EGFRs leads to dimerization of two receptors and phosphorylation of their intracellular domains, activating a pro-proliferative signaling cascade. EGFR2/ErbB2/Her2/neu is unique because it does not have an extracellular ligand binding domain and heterodimerization with another family member is obligatory for its activation (108, 109). EGFR2/ErbB2/Her2/neu is amplified in 30% of breast cancers and is a predictor of relapse and overall survival (110). Overexpression of EGFR2/ErbB2/Her2/neu specifically in the mammary gland (referred to as the MMTV-neu model) of female mice leads to tumor development in 100% of animals by 89 days (111). 25

35 Aberrant EGFR2/ErbB2/Her2/neu signaling in breast cancers is treated by small molecule inhibitors, such as lapatinib, to the intracellular tyrosine kinase domain of EGFR and EGFR2 (112). Trastuzamab (brand name- Herceptin) is a monoclonal antibody that binds to the extracellular domain of Her2 and prevents activation of the intracellular tyrosine kinase domain ( ). Triple Negative Breast Cancer 15-20% of breast cancers do not express ER, PR or EGFR2/ErbB2/Her2/neu and are considered triple negative. These cancers are particularly aggressive. As they do not express receptors for any of the targeted therapies, traditional chemotherapy is the only treatment option for these tumors (107). 26

36 CRABP2 and FABP5 Regulate RA Signaling in Carcinogenesis RA can either be growth-promoting or growth-suppressive (reviewed in (115)). In some cells, such as MCF7 human breast cancer cells and F9 teratocarcinoma cells, treatment with RA leads to a decrease in proliferation and increase in apoptosis (9, 116, 117). Clinically, RA is used to treat acute promyelocytic leukemia (APL) (118). 75% of patients treated with RA, in addition to traditional chemotherapies, are cured of APL and are still in remission five years posttreatment (119). In other cells, such as HaCat immortalized keratinocytes, treatment with RA leads to an increase of cell growth (9). Treatment of the MMTVneu mouse model of breast cancer with RA facilitates tumor growth (9, 120). These opposing effects result from the ability of RA to activate two different groups of nuclear receptors- RARs and PPARβ/δ. Activation of RARs induces transcription of target genes involved in cell cycle arrest, apoptosis, and differentiation leading to an inhibition of tumor growth(30, , 121). On the other hand, activation of PPARβ/δ induces the transcription of genes involved in proliferation, angiogenesis and survival, and can thus promote tumor development (9, ). Partitioning of RA between these two nuclear receptors is regulated by two ilbps- CRABP2 and FABP5. CRABP2 delivers RA to RARs and FABP5 delivers RA to PPAR β/δ. CRABP2 in carcinogenesis. In mammary carcinoma cell lines, CRABP2 expression level was shown to correlate with inhibition of growth in response to RA (125). CRABP2 overexpression in MCF7 breast cancer cells promotes induction 27

37 of RAR target genes upon RA treatment(116, 117) and levels of RAR target genes are increased in mouse mammary tumors that overexpress CRABP2 (46). When CRABP2 is overexpressed in a variety of mammary carcinoma cell lines (MDA- MB-231, SC115, MCF7, NaF), cells display enhanced apoptosis and growth inhibition in response to RA treatment (9, 30, 46, 117, 125). Similarly, ectopic expression of CRABP2 retards tumor development, decrease in tumor volume, and increased levels of apoptosis and differentiation mouse models of mammary carcinoma (46, 120). In accordance with an anti-carcinogenic role, CRABP2 expression is silenced in a variety of human cancers, including gliomas (126), head and neck cancer (127), pancreatic cancer (128), and meduloblastoma (129). This silencing is a result of promoter methylation. FABP5 in carcinogenesis. The ability of RA to enhance carcinoma cell growth (9, 120) can be attributed to activation of the FABP5-PPARβ/δ pathway and induction of pro-oncogenic target genes (9, 46). Expression of FABP5, in cultured carcinoma cells, promotes several oncogenic properties of cultured cells, including proliferation, invasion, and migration (130). Genetic ablation of FABP5 in the MMTV-neu mouse model of breast cancer results in delayed tumor development, fewer tumors per mouse, and decreased tumor volume (130). Analyses of tumors revealed that tumors from FABP5 -/- mice are characterized by decreased proliferation, increased apoptosis, and lower levels of pro-oncogenic PPARβ/δ target genes compared to tumors that arose in wild-type mice (130). 28

38 FABP5 is upregulated in a variety of human tumors, including mammary (130), prostate ( ), head and neck (135), bladder (136), and esophageal (137). Interestingly, transcription of the FABP5 gene is regulated by EGFR2/ErbB2/Her2/neu signaling (138) and it has been shown that FABP5 is crucial for tumor development in MMTV-neu mice, where tumorigenesis is driven by this pathway (130). The relative expression of CRABP2 and FABP5 dictate the activity of RA. The ratio of CRABP2 to FABP5 dictates if RA is anti- or pro- carcinogenic (see Fig. 1.6 for schematic). In the MMTV-neu mouse model of breast cancer, CRABP2 is expressed in normal mammary epithelium but not in tumors. FABP5 levels are low in the normal epithelium but significantly increase in tumors. This decrease in the ratio of CRABP2 to FABP5 suggests that RA acts as a growth suppressive agent in normal tissues but acts as a growth promoting agent in these tumors (46). Indeed, in tumors of MMTV-neu mice, RA promotes tumor growth (9, 120). Overexpression of CRABP2 in this mouse model converts RA to an anticarcinogenic agent (46, 120). In HaCat immortalized keratinocyte cells and NaF mammary carcinoma cells, which both express high levels of FABP5, RA promotes proliferation and protects cells from apoptosis (9). Ectopic expression of CRABP2 or decreasing the level of FABP5 in these cells results in RA sensitizing cells to apoptosis. Conversely, in MCF7 cells, which express high levels of CRABP2 (125), RA 29

39 sensitizes cells to apoptosis (9). Decreasing CRABP2 in MCF7 cells, switches RA to a pro-survival factor (9). Figure 1.6: CRABP2 and FABP5 deliver RA to RAR and PPARβ/δ CRABP2 delivers RA to RAR activating a transcriptional program that results in anti-carcinogenic activities such as apoptosis and cell cycle arrest. FABP5 delivers RA to PPARβ/δ activating a group of pro-carcinogenic genes. NLS residues are in green. CRABP2 is shown bound to RA. FABP5 is shown bound to linoleic acid. Three dimensional structures were modeled using Pymol from PDB codes 2FR3 (CRABP2) and 4LTK (FABP5). 30

40 A function for apo-crabp2 in carcinogenesis? Surprisingly, it was reported that over-expression of CRABP2 in MCF7 mammary carcinoma cells, grown in the absence of RA, upregulates the expression of some genes. These observations suggest that CRABP2 may have a RA-independent function (117). Gene expression analysis has shown that ectopic expression of CRABP2 increases the levels of several mrnas were upregulated, including APAF1, the mrna that encodes apoptotic peptidase activating factor 1 (Apaf-1). It was further shown that APAF1 is not an RAR target gene (117, 139). Apaf-1 is the core protein of the apoptosome; it complexes with cytochrome c and caspase 9 in an ATP-dependent manner to initiate cleavage of caspase 9 (140). Indeed, CRABP2 overexpression lead to an increase in caspase cleavage, even in the absence of RA (117). These data suggest that Apaf-1 may contribute to the enhancement of apoptosis by CRABP2. In the MMTV-neu mouse model of breast carcinoma, tumors that arose in mice transgenically overexpressing CRABP2 display higher levels of Apaf1 mrna and increased caspase activation compared to tumors that arose in wild type mice (46). Conversely, CRABP2 -/- mice develop tumors with lower levels of Apaf1 and cleaved caspases. Taken together, these data raise the intriguing possibility that CRABP2 may regulate expression of the Apaf1 mrna and modulate apoptotic responses in an RA-independent manner. 31

41 Statement of Purpose It is well established that CRABP2 exerts anti-carcinogenic activities by delivering RA to RAR and enhancing the transcriptional activation of the receptor. Interestingly, it has also been reported that CRABP2 upregulates several mrnas, including the Apaf1 mrna, and enhances apoptosis in the absence of RA. These observations suggest a novel function of apo-crabp2. This dissertation aims to elucidate the molecular mechanism by which apo- CRABP2 upregulates mrnas and enhances apoptosis. The contributions of apo and holo CRABP2 to the tumor suppressive activity of the protein will also be examined. 32

42 CHAPTER 2: Transcript Stabilization by the RNA-binding protein HuR is Regulated by Cellular Retinoic Acid-Binding Protein 2 Originally Published As: Transcript Stabilization by the RNA-binding Protein HuR Is Regulated by Cellular Retinoic Acid-Binding Protein 2 Amanda C. Vreeland, Shuiliang Yu, Liraz Levi, Daniella de Barros Rossetto and Noa Noy Mol. Cell. Biol. 2014, 34(12):2135. DOI: /MC/ Published Ahead of Print 31 March Abstract The RNA-binding protein HuR binds at 3 UTR regions of target transcripts thereby protecting them against degradation. We show that HuR directly interacts with cellular retinoic acid-binding protein 2 (CRABP2), a protein known to transport RA from the cytosol to the nuclear receptor RAR. Association with CRABP2 dramatically increases the affinity of HuR towards target mrnas and enhances the stability of such transcripts, including that of Apaf-1, the major protein in the apoptosome. We show further that its cooperation with HuR contributes to the ability of CRABP2 to suppress carcinoma cell proliferation. The data show that CRABP2 displays anti-oncogenic activities both by cooperating with RAR and by stabilizing anti-proliferative HuR-target transcripts. The observations that CRABP2 controls mrna-stabilization by HuR reveal that, in parallel to participating in transcriptional regulation, the protein is closely involved in post-transcriptional regulation of gene expression. 33

43 Introduction The vitamin A metabolite retinoic acid (RA) regulates transcription by activating two classes of nuclear receptors: the retinoic acid receptors (RARs) (141), and the peroxisome proliferator-activated receptor β/δ (PPAR β/δ) (8, 9). RA also associates in cells with intracellular lipid-binding proteins (ilbp) (29, 142). Two ilbps, cellular RA-binding protein 2 (CRABP2) and fatty acid-binding protein 5 (FABP5), support the biological activities of RA by transporting it from the cytosol to cognate nuclear receptors in the nucleus. In the absence of ligands, ilbps are cytosolic and upon binding ligand, a nuclear localization signal is activated and they translocate to the nucleus (9, 32, 37). Hence, CRABP2 delivers RA to RAR and FABP5 shuttles it to PPARβ/δ. These binding proteins thus facilitate the ligation and markedly enhance the transcriptional activities of the respective receptors (30-32, 35). The involvement of RA signaling in cancer is complex. While activation of RARs triggers cell cycle arrest, apoptosis, and differentiation and thus suppresses tumor growth (30, , 121), activation of PPARβ/δ results in enhanced proliferation and survival and can promote tumor development (9, 122, 124, 143). Consequently, RA suppresses growth of carcinomas in which CRABP2 is highly expressed, leading to efficient activation of RAR, but promotes the development of tumors in which the CRABP2/FABP5 ratio is low, resulting in diversion of RA to PPARβ/δ (9, 46, 120, 144). Available information indeed indicates that, by targeting RA to RARs, CRABP2 displays potent anti-oncogenic activities (9, 30, 46, 116, 117, 120). The reports that CRABP2 expression is 34

44 markedly downregulated in various cancers further suggest that its loss contribute to tumor development ( ). Surprisingly, we previously found that, in addition to promoting the transcriptional activity of RAR, expression of CRABP2 in mammary carcinoma cells increases the levels of mrnas that are not encoded by RAR target genes, and that the effect is exerted even in the absence of RA. For example, CRABP2 expression was found to markedly increase the level of mrna for apoptotic peptidase activating factor 1 (Apaf-1), the major protein of the apoptosome (46, 117). Consequently, CRABP2 displays pro-apoptotic activities in the absence of its ligand (117). These observations raise the possibility that, in addition to cooperating with RAR in transcriptional regulation, CRABP2 may regulate gene expression and exert tumor-suppressive activities by an additional, RAindependent, function. One possibility is that CRABP2 may be involved in posttranscriptional regulation of mrnas. One of the best characterized proteins involved in post-transcriptional regulation of gene expression in animals is HuR, a ubiquitously-expressed member of the (ELAV)/Hu family of RNA-binding proteins (72). In the nucleus, HuR is involved in various functions including RNA splicing and nuclear export. In the cytosol, it binds to AU-rich elements (ARE) in 3 UTR regions of target mrnas thereby protecting them against degradation (69, 93, 95, 145). By regulating the levels of its target mrnas, HuR is involved in key biological processes including cell-cycle progression, apoptosis, immune function, inflammation, and carcinogenesis (72, 94, 96). 35

45 Here we show that CRABP2 directly interacts with HuR and markedly increases its affinity for some target transcripts, thereby enhancing their stability and increasing their expression levels. Binding of RA triggers dissociation of the CRABP2 HuR complex and induces CRABP2 to undergo a transient nuclear translocation following which it returns to the extranuclear milieu and re-associates with HuR. We show further that the anti-oncogenic activity of CRABP2 partially stems from its cooperation with HuR, and that HuR is critical for enabling CRABP2 to enhance apoptosis in mammary carcinoma cells. Materials and Methods Cells. The M2 -/- cell line was generated from tumors that arose in MMTVneu/CRABP2-null mice (46). Cells were maintained in Dulbecco s Modification of Eagle s Media (DMEM) containing 4.5 g/l glucose, 4.5 g/l L-glutamine, 10% fetal bovine serum (FBS, Atlanta Biologicals), 100 I.U./mL penicillin, and 100 µg/ml streptomycin. Reagents. RA was purchased from Calbiochem. Actinomycin D and etoposide were from Sigma-Aldrich. Antibodies against HuR (3A2; sc-5261), actin (I-19, sc- 1616) and tubulin (H-235, sc-9104) were from Santa Cruz Biotechnology, Inc. Antibodies against caspase 3 (9665) and Apaf-1 (8723) were from Cell Signaling Technology, Inc. Antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were from Abcam (ab9485). Antibody against CRABP2 was a gift from Cecile Rochette-Egly (IGBMC, Strasbourg, France). LE540 was a gift from 36

46 Hiroyuki Kagechika (Tokyo Medical and Dental University). Transfections were carried out using PolyFect (Qiagen). sirnas were purchased from Ambion. Vectors. Mammalian expression vector harboring cdna encoding hcrabp2 with EGFP fused to the protein s N-terminus (pegfp-c2 vector) was previously described (30). hcrabp2δnls with N-terminal EGFP tag was generated by replacing residues K20, R29, and K30 of the EGFP-hCRABP2 with alanines using QuikChange 2 XL Site-Directed Mutagenesis Kit (Stratagene). psg5 vectors harboring cdna encoding hcrabp2 and hcrabp2δnls were previously described (32, 36). A vector encoding flag-tagged CRABP2 was generated by inserting cdna for human CRABP2 into BamHI and EcoRI sites of pcmv-3tag-1 vector with 3 flag tag coding sequences in frame. Adenovirus encoding hcrabp2 in pad5 was prepared by the Gene Transfer Vector Core (University of Iowa, Iowa City). Transactivation Assays were carried out as previously described (36). For analysis of the Apaf1 and Elavl1 promoters, the upstream 2 kb promoter fragments of each gene were PCR-amplified using Platinum Pfx DNA polymerase (Invitrogen) and subcloned into Nhe I and Hind 2I sites of pgl3-basic luciferase vector. Lentiviral shrna production. plko.1 vectors harboring shrnas (Elavl1- TRCN , CRABP2- TRCN , ELAVL1- TRCN , EGFP- RHS4459) were from Open Biosystems; plko.1 vector harboring luciferase shrna (SHC007) was from Sigma-Aldrich. Lentiviruses were produced in HEK293T cells and target cells were infected using standard protocols. 37

47 Real-time quantitative PCR (qpcr) was performed using a StepOnePlus Real Time PCR System with Taqman probes: Apaf1- Mm _m1, Casp7- Mm _m1, Elavl1- Mm _m1, Rarb- Mm _m1, ACTB- Hs _m1, APAF1- Hs _m1, BTG2- Hs _m1, CASP7- Hs _m1, CRABP2- Hs _m1, ELAVL1- Hs _m1, 18S E (Applied Biosystems). Levels of mrnas were normalized to 18S ribosomal RNA using the ΔΔCt Method (Applied Biosystems Technical Bulletin no. 2). 3 UTR Luciferase Reporter Assays. The Apaf1 and Elavl1 3 UTRs ( bp and bp downstream of transcription start sites, respectively) were cloned downstream of a luciferase reporter gene in pgl3 vector modified to include a minimal prolactin promoter. Putative ARE were deleted using QuikChange 2 XL Site-Directed Mutagenesis Kit (Stratagene). Cells were cotransfected with the reporter, a vector encoding β-galactosidase, and empty vector or vector encoding CRABP2. 48 h. post-transfection, luciferase activity was measured using the Luciferase Assay System (Promega) and normalized to β- galactosidase activity. Ribonucleoprotein Immunoprecipitations (RIP) were performed as described (146). Semi-quantitative PCR was performed using the primer sequences - Elavl1: CGCCTGCTAGGCGGTTTGGA (forward) and CCCAGGCGGTAGCCGTTCAG (reverse); Apaf1: GATGGCAGGCTGCGGCAAGT (forward), ACACGGAGGCGGTCTTTGGC (reverse); Actb: CCACCATGTACCCAGGCATT (forward) and 38

48 AGGGTGTAAAACGCAGCTCA (reverse); Gapdh: GGTTGTCTCCTGCGACTTCA (forward) TAGGGCCTCTCTTGCTCAGT (reverse). Confocal fluorescence microscopy. Cells, cultured in DMEM containing 5% delipidated FBS, were transfected with pcmv-3tag-1 vector encoding Flag- CRABP2. Cells were treated with 2 µm CGP-75415A (Sigma Aldrich) for 2 h., fixed with 4% parformaldehyde in PBS and permeabilized with 0.2% Triton X-100. Endogenous CRABP2 in MCF-7 cells and Flag-tagged CRABP2 in M2 -/- cells were visualized by immunostaining. Antibodies: CRABP2 (Millipore, MAB5488), Flag (Sigma-Aldrich, F1804), HuR (Millipore, ). Cells were imaged using a LSM510 confocal microscope (Leica). Proteins. His-CRABP2 was expressed in E.Coli BL21and purified as previously described (147). Protein viability was assessed by monitoring its ability to bind RA as described (25). GST-HuR was expressed in E. Coli DH5α, partially purified as described (148). Fluorescence anisotropy titrations. RNA was synthesized and labeled with fluorescein at the 5 end by Dharmacon. Fluorescence anisotropy titrations were carried out using a Photon Technology International Quantamaster spectrofluorometer equipped with Glan-Thompson polarizers. Labeled mrna (0.1 μm) was placed in a cuvette and titrated with GST-HuR, His-CRABP2, or CRABP2 pre-complexed with HuR at 4:1 mole ratio in the absence or presence of RA. Fluorescence anisotropy (λex = 494 nm, λem = 518 nm) was measured. 39

49 Flow cytometry analysis was performed as previously described (116) and analyzed on a BD Biosciences LSR 2 at the Case Comprehensive Cancer Center Cytometry and Imaging Microscopy Core Facility. Results CRABP2 upregulates the expression of Apaf1 and Elavl1 independently of its cooperation with RAR. The observations that CRABP2 induces the expression of Apaf1 in the absence of RA (117) suggest that the protein may have biological activities other than to deliver RA to RAR. To examine this notion, CRABP2-K20A/R29A/K30A, a mutant that lacks the nuclear localization signal of the protein (CRABP2ΔNLS) was used. This mutant folds properly and, similarly to the WT protein, binds RA with nanomolar affinity, but it does not translocate to the nucleus in response to ligand-binding (32). In the absence of RA, both the WT protein and its NLS mutant are cytosolic (30, 32, 56). A mammary carcinoma cell line derived from tumors that arose in transgenic MMTV-neu mice, a wellestablished mouse model of breast cancer (149), was used to examine whether CRABP2ΔNLS can enhance the transcriptional activity of RAR. The specific cell line used in these studies was generated from tumors that developed in MMTVneu mice in which expression of CRABP2 was ablated and, accordingly, they completely lack the protein (M2 -/- cells (46)). M2 -/- cell lines that stably express EGFP, EGFP-CRABP2, or EGFP-CRABP2ΔNLS were generated (Fig. 2.1A), and the effects of the proteins on RA-induced activation of RAR were monitored by transactivation assays using a luciferase reporter driven by an RAR response 40

50 element (RARE). When cells are cultured in medium containing delipidated serum, neither CRABP2 nor its ΔNLS mutant had any effect of the transcriptional activity of RAR (Fig. 2.1C), demonstrating efficient depletion of RA. In the presence of RA, CRABP2 enhanced reporter activation but the CRABP2ΔNLS had no effect on RAinduced activation of RAR (Fig. 2.1B). The data thus demonstrate that the mutant does not cooperate with the receptor. Reducing the expression of CRABP2 in MCF-7 breast cancer cells, which express a high level of CRABP2 (117), decreased the levels of APAF1 mrna and protein (Fig. 2.1D-E). Correspondingly, ectopic expression of CRABP2 in M2 -/- cells, which do not express the protein, increased the level of Apaf1 mrna and protein (Fig. 2.1F-2.1H). Notably, ectopic expression of either WT-CRABP2 or CRABP2ΔNLS increased the level of Apaf-1 mrna and protein to a similar extent (Fig. 2.1F-2.1H). These observations suggest that CRABP2 upregulates Apaf-1 by a mechanism unrelated to its ability to promote the transcriptional activity of RAR. In support of this conclusion, silencing CRABP2 in MCF-7 cells had no effect on established RAR target gene, BTG2 (Fig. 2.1D), and treatment of M2 -/- cells stably expressing CRABP2 with RA induced expression of the well-established RAR target gene Rarb but had no effect on Apaf1 mrna (Fig. 2.1I). Moreover, while the pan-rar antagonist LE540 attenuated the ability of RA to upregulate Rarb, the compound had no effect on expression of Apaf1 (Fig. 2.1I). Correspondingly, transactivation assays showed that RA effectively induced the expression of a luciferase reporter gene driven by an RARE, but had no effect on 41

51 a luciferase reporter driven by the proximal promoter of Apaf1 (Fig 2.1J). The data thus clearly show that Apaf1 does not constitute RAR target gene. These observations raise the possibility that CRABP2 elevates the level of Apaf1 mrna by increasing the stability of this transcript. We therefore wondered whether CRABP2 may function in conjunction with HuR (encoded by the Elavl1 gene), an RNA-binding protein which is arguably the best characterized regulator of mrna stability in animals (72, 150). Remarkably, down-regulation of CRABP2 expression in MCF-7 cells decreased the levels of HuR mrna (Fig 2.1D) and protein (Fig 2.1E), and, in M2 -/- cells, ectopic expression of either WT-CRABP2 or CRABP2ΔNLS cells increased HuR expression (Fig. 2.1F-2.1H). Similarly to Apaf1, the expression of Elavl1 was not affected either by RA or by an RAR antagonist (Fig. 2.1I), and RA did not affect the expression of a luciferase reporter driven by the Elavl1 promoter (Fig. 2.1J). Hence, expression of both Apaf1 and Elavl1 is regulated by CRABP2 but not through transactivation of RAR. The observations that CRABP2 upregulates the expression of both mrnas and proteins suggest that the effect is mediated by stabilization of the mrnas and not the proteins. Indeed, while over-expression of CRABP2 in M2 -/- cells increased the level of HuR (Fig. 2.1K, top), monitoring the time course of protein degradation following treatment with protein synthesis inhibitor cycloheximide showed that CRABP2 did not have a discernible effect on the stability of HuR (Fig 2.1K, bottom). 42

52 Figure 2.1: Apo-CRABP2 upregulates Apaf1 and Elavl1 mrnas. (A) Immunoblots demonstrating stable over-expression of EGFP-CRABP2 (2) and EGFP-CRABP2ΔNLS (2ΔNLS) in M2 -/- cells. (B) M2 -/- cell lines stably expressing denoted proteins were co-transfected with RARE-driven luciferase reporter gene and a vector encoding β-galactosidase. Cells were cultured for 48 h in delipidated media and luciferase activity was assayed. Data are mean±sd (n=3). (C) M2 -/- cell lines stably expressing denoted proteins were co-transfected with RAREdriven luciferase reporter and a vector encoding β-galactosidase. Cells were treated with vehicle or 20 nm RA for 16 h. and luciferase activity was measured and normalized to β-galactosidase activity. Data are mean±sem (n=3). *p 0.01 vs. RA-treated EGFP-expressing control, determined using two-tailed student t- test. (D, E) MCF-7 cells were infected with lentiviruses containing vector harboring shrna targeting CRABP2 (shcrabp2) or luciferase (shluc). 3 days postinfection, cells were harvested and levels of indicated mrnas (D) and proteins (E) were assessed by qpcr and immunoblotting, respectively. *p 0.01, vs. shluc, determined using two-tailed student t-test. (F) M2 -/- cells were transfected with empty vector (e.v.) or vectors harboring cdna for CRABP2 or CRABP2ΔNLS. Levels of Apaf1 and Elavl1 mrna were measured by qpcr. Data are mean±sem (n=3). *p 0.01 vs. corresponding e.v. control, calculated using a two-tailed student t-test. Inset: Immunoblots demonstrating CRABP2 expression in M2 -/- cells transfected with empty vector (e.v.) or vectors harboring cdna for denoted proteins. (G, H) M2 -/- cells were transfected with empty vector (e.v.) or vectors harboring cdna for CRABP2 or CRABP2ΔNLS. (G) Levels of 43

53 Apaf-1 and HuR protein were assessed by immunoblot. (H) Immunoblots were quantitated and data are mean±sem (n=3). *p 0.01, #p=0.034 vs. corresponding e.v. control, calculated using a two-tailed student t-test. (I) M2 -/- cells stably overexpressing EGFP-CRABP2 were treated with RA in the absence or presence of the RAR antagonist LE540 (1 μm each, 4 h.). Rarb, Apaf1, and Elavl1 mrnas were measured by qpcr. Data are mean±sem (n=3). *p 0.01 vs. vehicle control, calculated using a two-tailed student t-test. (J) M2 -/- cells stably overexpressing EGFP-CRABP2 were transfected with luciferase reporter constructs driven by 2 kb of the proximal promoters of Apaf1 or Elavl1 or by an RARE. Cells were treated with 100 nm RA for 16 h. and luciferase activity was measured. Data are mean±sem (n=3). *p 0.01 vs. corresponding vehicle control, calculated using a two-tailed student t-test. (K) M2 -/- cells stably overexpressing EGFP-CRABP2 were treated with 10 µg/ml cycloheximide for indicated times. Level of HuR protein was assessed by immunoblot. Top: immunoblot showing HuR protein expression levels in M2 -/- cell lines stably overexpressing CRABP2. Bottom: immunoblot showing HuR protein levels after treatment with cycloheximide. 44

54 CRABP2 stabilizes Apaf1 and Elavl1 mrna in an HuR-dependent manner. The possibility that CRABP2 upregulates the expression of Apaf-1 and HuR by stabilizing their mrnas was then evaluated. M2 -/- cells were transfected with an empty vector or a vector encoding CRABP2 (Fig. 2.2A), treated with transcription inhibitor actinomycin D, and the rates of degradation of Apaf1 and Elavl1 mrnas were monitored. The mean half-lives of the Apaf1 and Elavl1 mrna were found to be 1.81±0.08 and 2.44±0.27 h, respectively in the absence of CRABP2, and respectively increase to 6.94±0.9 and 6.23±0.38 h in cells expressing CRABP2 (Fig. 2.2B-C). In contrast, CRABP2 had no effect on the stability of Gapdh mrna (Fig 2.2D), indicating that the effect of CRABP2 on the half-life of the Apaf1 and Elavl1 mrnas is specific to a subset of mrnas. Considering that CRABP2 does not contain a recognizable RNA-binding motif, we wondered whether its ability to stabilize mrnas involves cooperation with HuR. In agreement with this notion, decreasing the expression of HuR (Fig. 2.2E, inset) reduced the level of Apaf1 mrna and completely abolished the ability of CRABP2 to upregulate the expression of this gene (Fig. 2.2E). Reducing the expression of HuR also reduced Apaf1 mrna levels in MCF-7 mammary carcinoma cells (Fig. 2.2F). HuR stabilizes target transcripts by interacting with specific sequences within their 3 UTR (69, 93, 95, 145). To assess whether Apaf1 and Elavl1 comprise targets for HuR and to examine whether HuR cooperates with CRABP2 in stabilizing their mrnas, the entire 3 UTRs of Apaf1 and Elavl1 were cloned downstream of a luciferase reporter gene. The reporters were transfected into M2 - /- cells and the effect of modulating the expression of CRABP2 and HuR on 45

55 luciferase activity was monitored. Similarly to the response of the endogenous transcripts, ectopic expression of CRABP2 upregulated the expression of luciferase reporters containing either the Apaf1 or the Elavl1 3 UTRs, and decreasing the expression of HuR downregulated the basal levels of both reporter genes and abolished the ability of CRABP2 to upregulate their expression (Fig. 2.2G-H). We noted that over-expression of CRABP2 was somewhat lower in cells expressing Elavl1 shrna. This likely reflects a lower expression efficiency resulting from the multi-vector transfection of these cells. Nevertheless, the observations that, upon decreasing HuR levels, ectopic expression of CRABP2 had no effect on reporter expression indicate that HuR is critical for enabling modulation of the levels of the Apaf1 and the Elavl1 transcripts by CRABP2. 46

56 Figure 2.2: HuR mediates the ability of CRABP2 to stablize Apaf1 and Elavl1 mrnas. (A-D) M2 -/- cells were transfected with e.v. or vector encoding CRABP2 (A). Cells were treated with actinomycin D (2.5 μg/ml) and levels of Apaf1 (A), Elavl1 (B), and Gapdh (C) mrnas at varying time points following treatment were measured by qpcr. Data were normalized to corresponding values at time 0. Data are mean±sem (n=3). Insets: mrna levels of Apaf1, Elavl1, and Gapdh mrnas in the absence and presence of CRABP2 overexpression at t=0. (D) M2 -/- cells were transfected with scrambled sirna (siscrm) or sirna targeting Elavl1 (sielavl1). 24 h later, cells were infected with control adenovirus (Ad0) or adenovirus encoding CRABP2 (Ad2). 48 h. post-infection, Apaf1 mrna levels were assessed by qpcr. Data are mean±sem (n=3). *p<0.01 vs. cells expressing siscrm and Ad-0, by two-tailed student t-test. Inset: immunoblots demonstrating decreased expression of HuR in cells expressing sielavl1 and increased expression of CRABP2 upon infection with Ad2. (D, E) M2 -/- cells were infected with lentiviruses containing vector harboring shrnas targeting Elavl1 (shelavl1) or EGFP (shegfp) and transfected with e.v. or a vector encoding CRABP2, and luciferase reporter harboring the Apaf1 (D) or Elavl1 (E) 3 UTR. βgalactosidase was used as a transfection control. Data were normalized to corresponding e.v./shegfpexpressing cells. Data are mean±sem (n=3). *p 0.01 and #p = vs. 47

57 e.v./shegfp control, by two-tailed student t-test. Insets: Immunoblots demonstrating reduced expression of HuR and overexpression of CRABP2. 48

58 It was previously reported that HuR stabilizes its own mrna (91). However, the Apaf1 transcript is a novel target and the location of HuR-binding sequences within the gene s 3 UTR is unknown. Inspection of the 3 UTR of the Apaf1 mrna revealed 3 potential AREs (Fig. 2.3A). To identify ARE responsible for mediating the ability of CRABP2 and HuR to stabilize this mrna, the 3 elements were individually deleted from the luciferase reporter containing the 3 UTR of Apaf1 and reporter assays were carried out. Deletion of putative ARE 1 and 2 had little effect on reporter activity, but deletion of the ARE at site 3 abolished the ability of CRABP2 to upregulate the expression of the reporter (Fig 2.3B). Site 3 thus appears to contain the sequence through which HuR and CRABP2 stabilize the Apaf1 transcript. Fluorescence anisotropy titrations were then used to directly examine whether site 3 of the Apaf1 mrna is the HuR binding site. GST-tagged HuR were expressed in E.Coli and purified (Fig. 2.3C). A 39 nucleotide-long RNA containing the CRABP2-responsive sequence of the Apaf1 3 UTR (Fig. 2.3A, 2.3B) was covalently labeled with the fluorescent probe fluorescein and its ability to bind HuR was examined. Fluorescence anisotropy reports on the rotational volume of a fluorophore, and thus on the size of complexes containing it, and they have been widely used to monitor molecular associations (151). Titration of the RNA with GST-HuR resulted in a saturable increase in fluorescence anisotropy, demonstrating protein-rna association (Fig. 2.3D). Analysis of the data (25) showed that the Kd for the interaction between the RNA and HuR complexes is 413±147 nm (mean±s.d., n=3). Deletion of site3 of the mrna from the 39 49

59 nucleotide long RNA markedly decreased the affinity of the protein for the RNA (Fig. 2.3D), indicating that this site is the primary binding site for HuR. Ribonucleoprotein immunoprecipitation (RIP) assays were carried out to further examine whether HuR and CRABP2 associate with the Apaf1 or Elav1 mrna. Both mrnas co-precipitated with either HuR or with CRABP2, indicating that both proteins are bound to these transcripts in cells (Fig. 2.3E). To examine the effect of HuR on the ability of CRABP2 to associate with target transcripts, a derivative of the M2 -/- cell line that stably express CRABP2 (Fig. 2.1A) in which the expression HuR was stably reduced was generated (Fig. 2.3F, top). Reducing the expression of HuR markedly decreased the association of CRABP2 with the Apaf1 mrna (Fig. 2.3D, bottom), indicating that HuR mediates the association of CRABP2 with this transcript. 50

60 Figure 2.3: HuR mediates the association of CRABP2 with mrna. (A) Diagram of the luciferase reporter harboring the Apaf1 3 UTR. Putative AREs are bolded and underlined. (B) M2 -/- cells were transfected with an e.v. or a vector encoding CRABP2 and the luciferase reporter harboring the Apaf1 3 UTR or counterparts lacking the indicated putative HuR binding sites (Δ1, Δ2, Δ3). β- galactosidase was used as a transfection control. Data were normalized to luciferase activity in cells transfected with e.v. and the WT luciferase reporter. Data are mean±sem (n=3). *p 0.01, p=0.025 vs. e.v. control by a two-tailed student t-test. (C) Coomassie-blue stained gels visualizing recombinant, bacterially expressed and purified GST-HuR. (D) Fluorescein-labeled RNA containing 39 bases corresponding to site 3 in the Apaf-1 3 UTR (WT RNA) or fluoresceinlabeled RNA with the AUUUA of site 3 deleted (mutant RNA) was titrated with recombinant GST-tagged HuR. Progress of titrations was followed by monitoring the increase in the fluorescence anisotropy of the labeled RNA (λex 494; λem 518 nm). Data representative of 3 independent experiments are shown. (E) HuR and CRABP2 were immunoprecipitated from lysates of M2 -/- cells stably expressing EGFP-CRABP2 (see Fig. 1A). Apaf1 and Elavl1 mrnas that coprecipitated with the proteins were assessed by semi-quantitative PCR. (F) M2 -/- cells that stably over-express CRABP2 were infected with lentivirues harboring vectors encoding shrna targeting Elavl1 (shelavl1) or luciferase (shluc) and stable cell lines were generated. Top: Immunoblot demonstrating HuR levels in 51

61 cells expressing shluc or shelavl1. Actin was used as loading control. Bottom: CRABP2 was immunoprecipitated and RNAs that co-precipitated with the protein were assessed by semi-quantitative PCR. 52

62 Apo-CRABP2 interacts with HuR and enhances its affinity for target mrnas. The observations that HuR is required for binding of CRABP2 to target transcripts and upregulate their expression suggest that the two proteins associate with each other. Indeed, immunoprecipitation assays showed that HuR and CRABP2 coprecipitate from MCF-7 cell lysates (Fig. 2.4A, 2.4B). Treatment of cell lysates with RNAse prior to precipitation did not inhibit the association, indicating that RNAbinding is not required for the interactions (Fig. 2.4A, 2.4B). Confocal fluorescence microscopy was used to examine if CRABP2 and HuR colocalize in cells. It was previously reported that, in the absence of RA, CRABP2 is located in the extra-nuclear milieu where it appears to be associated with endoplasmic reticulum (ER). However, the means by which this highly soluble protein is localized at the ER is unknown (30, 32, 56). In agreement with the previous reports, in the absence of retinoids, both endogenous CRABP2 in MCF- 7 cells and ectopically expressed CRABP2 in M2 -/- cells were present in the extranuclear milieu (Fig. 2.4C, 2.4D). HuR shuttles between the nucleus and the cytosol it is present predominantly in the nucleus in cell cycle phases other than late mitosis ((152, 153) and (Fig. 2.4C)). The cyto-nuclear shuttling of HuR is regulated by cyclin dependent kinase 1 (Cdk1)-catalyzed phosphorylation, and inhibition of the kinase results in retention of the protein in cytosol ((83) and Fig. 2.4C). To increase the level of HuR in the cytosol in resting cells and enhance microscopic examination of possible colocalization between CRABP2 and HuR, cells were treated with the Cdk1 inhibitor CGP-74514A prior to imaging. Immunostaining 53

63 showed that both endogenously expressed and ectopically over-expressed CRABP2 extensively co-localized with HuR (Fig. 2.4D). Two approaches were taken to examine whether association with CRABP2 affects the interactions of HuR with target transcripts. RIP assays showed that expression of CRABP2 increased the efficiency by which HuR binds both the Apaf-1 and the Elavl1 mrnas (Fig. 2.4E). The apparent enhancement of the association of HuR with these mrnas may result either from increased affinity towards the transcripts or from increased cellular levels brought about by CRABP2 expression (Fig. 2.1C- 2.1E). Fluorescence anisotropy titrations were then used to directly examine whether CRABP2 modulates the mrna-binding affinity of HuR. Histidine-tagged CRABP2 or CRABP2ΔNLS were expressed in E.Coli and purified (Fig. 2.4F). A 39 nucleotide-long RNA containing the CRABP2-responsive sequence of the Apaf- 1 3 UTR (Fig. 2.3A, 2.3B) was covalently labeled with the fluorescent probe fluorescein and titrated with recombinant HuR, CRABP2-bound HuR, or CRABP2 alone and fluorescence anisotropy was monitored (Fig. 2.4G). Titration of the RNA with either CRABP2 or CRABP2ΔNLS did not affect the fluorescence anisotropy of the RNA (Fig 2.4G inset), indicating that these proteins do not directly associate with the RNA. However, titrations with HuR complexed with either CRABP2 or its ΔNLS mutant displayed a markedly steeper curve and earlier saturation as compared to binding of HuR alone, demonstrating a dramatic increase in binding affinity (Fig. 2.4G). Analyses of the data (25) revealed that the Kd for the HuR-RNA association decreased from 413±147 nm that characterizes the interactions of the RNA with HuR alone to <0.1 nm. Note that the observed binding affinity was too 54

64 high for accurate measurements using this assay and thus this value reflects an upper limit. The data thus strikingly show that HuR directly binds both CRABP2 and CRABP2ΔNLS and that both CRABP2 and its ΔNLS mutant increase the affinity of HuR towards the transcript by over 3 orders of magnitude. 55

65 Figure 2.4: Apo-CRABP2 associates with HuR and enhances its affinity for target mrnas. For all experiments, cells were cultured in delipidated medium for 48 h to deplete retinoid stores. (A) Lysates from MCF-7 cells were treated with vehicle or RNAse (100 µg/ml), CRABP2 was immunoprecipitated and precipitates were immunoblotted for the presence of CRABP2 and HuR. (B) Lysates from MCF-7 cells were treated with vehicle or RNAse, HuR was immunoprecipitated and precipitates were immunoblotted for the presence of HuR and CRABP2. (C) M2 -/- cells were transfected with a vector encoding Flag-CRABP2 and treated or not with CGP74514A (2 µm, 2 h.). Flag-CRABP2 and HuR were detected by immunostaining and cells were counterstained with DAPI to visualize nuclei. Bars 5 µm. (D) MCF-7 cells and M2 -/- cells expressing Flag-tagged CRABP2 were treated with CGP-74514A (2 µm, 2 h.). Endogenous CRABP2 in MCF-7 cells and Flag-tagged CRABP2 in M2 -/- cells were visualized by immunostaining using CRABP2 and Flag antibodies, respectively. Cells were also immunostained for HuR and counterstained with DAPI. Confocal fluorescence microscopy was used to visualize cells. Bars 5 µm. (E) HuR was immunoprecipitated from M2 -/- cells stably overexpressing EGFP or EGFP-CRABP2 (Fig 1A). Apaf1, Elavl1, and Actb mrna co-precpitating with HuR were detected by semi-quantitative PCR. (F) Coomassie-blue stained gels visualizing recombinant, bacterially expressed and purified and his-crabp2 and his-crabp2δnls. (G) Fluorescein-labeled RNA 56

66 containing 39 bases corresponding to site 3 in the Apaf-1 3 UTR was titrated with recombinant GST-tagged HuR alone or in complex with CRABP2 or CRABP2ΔNLS. To ensure saturation, CRABP2s were pre-complexed with HuR at 4:1 mole ratio. Progress of titrations was followed by monitoring the increase in the fluorescence anisotropy of the labeled RNA (λex 494; λem 518 nm). Data representative of 3 independent experiments are shown. Inset: Fluoresceinlabeled RNA was titrated with CRABP2 or CRABP2ΔNLS. 57

67 RA triggers transient dissociation of CRABP2 from HuR and target transcripts. In vitro assays were carried out to examine whether the formation of the HuR CRABP2 complex is sensitive to RA. Bacterially-expressed recombinant GST-HuR was immobilized on glutathione-sepharose beads and incubated with recombinant his-crabp2 in the absence or presence of increasing concentrations of RA. Beads were precipitated and CRABP2 that co-precipitated with HuR visualized by Coomassie-blue staining (Fig. 2.5A). The data showed that CRABP2 efficiently coprecipitated with HuR in the absence but not in the presence of RA, indicating that the protein dissociates from HuR when ligated. In support of this conclusion, fluorescence anisotropy titrations of the HuR-binding region of the Apaf1 3 UTR showed that RA markedly decreased the affinity of HuR towards the RNA (Fig 2.5B). In the presence of RA, the Kd that characterizes the HuR-RNA interactions was found to be 178±46 nm, similar to that of the association of the RNA with HuR alone. These data thus demonstrate that HuR directly binds CRABP2 both in solution and on target RNAs, and that CRABP2 dissociates from HuR in the presence of RA. In agreement with previous reports (30, 32, 56), a 30 min. treatment of M2 -/- cells ectopically expressing CRABP2 with RA resulted in a massive nuclear localization of the protein (Fig. 2.5C). However, the residence of CRABP2 in the nucleus was found to be short-lived and the protein returned to the extra-nuclear milieu where it again co-localized with HuR 90 min. after RA treatment (Fig 2.5C). The cytonuclear shuttling behavior of CRABP2 was similar in the presence of the protein synthesis inhibitor cycloheximide, indicating that the protein indeed undergoes RA- 58

68 induced reversible cyto-nuclear shuttling and that the observations do not reflect de novo protein synthesis (data not shown). Moreover, co-immunoprecipitation assays showed that, in cells, a 30 min. treatment with RA results in complete dissociation of CRABP2 from HuR, and that the complex re-forms 90 min. posttreatment (Fig. 2.5D, 2.5E). RIP experiments similarly showed that RA induced dissociation of CRABP2 from both the Apaf1 and Elavl1 mrnas, but that the effect was transient and CRABP2 regained its RNA-binding capacity 90 min. following treatment (Fig. 2.5F). Taken together, the data indicate that the residence time of CRABP2 in the nucleus is short and hence that the ability of the protein to deliver RA to the nucleus does not significantly interfere with its ability to stabilize mrna in conjunction with HuR. The observations that RA treatment did not significantly affect RNA-binding by HuR likely reflect that the rate of dissociation of HuR from target transcript is slow and does not proceed to a significant extent during the short residence time of CRABP2 in the nucleus (Fig. 2.5F). 59

69 Figure 2.5: RA triggers transient dissociation of CRABP2 from HuR and target transcripts. In all experiments, cells were cultured in delipidated medium for 48 h. to deplete retinoid stores. (A) Recombinant, bacterially expressed GST-HuR was immobilized on glutathione sepharose beads. Beads were incubated in a buffer containing 1.25 μm recombinant his-crabp2 in the presence of denoted concentrations of RA. Beads were precipitated and proteins in precipitates visualized by Coomassie-blue staining. (B) Fluorescein-labeled RNA containing 39 bases corresponding to site 3 in the Apaf-1 3 UTR was titrated with his- CRABP2 precomplexed with GST-HuR in the presence or absence of 2 fold molar excess RA. Progress of titrations was followed by monitoring the increase in the fluorescence anisotropy of the labeled RNA. Data representative of 3 independent experiments are shown. (C) M2 -/- cells were transfected with a vector encoding Flag-CRABP2 and pre-treated with CGP-74514A (2 µm, 2 h) prior to treatment with RA (1 µm) for the denoted times. Flag-CRABP2 and HuR were detected by immunostaining and cells were counterstained with DAPI. Cells were visualized by confocal fluorescence microscopy. Bars 10 µm. (D) MCF-7 cells were treated with 1 µm RA for the denoted times and CRABP2 was precipitated. Precipitates were immunoblotted for CRABP2 and HuR. (E) MCF-7 cells were treated with 1 µm RA for the denoted times and HuR was precipitated. Precipitates were immunoblotted for HuR and CRABP2. (F) M2 -/- cells that stably express 60

70 CRABP2 (see Fig 2.1A) were treated with 1 μm RA for the denoted times. HuR and CRABP2 were immunoprecipitated and the presence of Apaf1, Elavl1, and Gapdh mrna in precipitates assessed by semi-quantitative PCR. 61

71 CRABP2 enhances apoptosis and suppresses carcinoma cell growth through its cooperation with HuR. It has been reported that HuR displays antiproliferative activities (98-100). In agreement, reducing the expression of HuR facilitated the growth of M2 -/- cells (Fig. 2.6A). It has also been reported that CRABP2 suppresses the growth of various carcinomas (9, 30, 46, 116, 117, 120). In accordance, over-expression of CRABP2 inhibited cell growth both in parental cells and in cells in which the expression of HuR was reduced (Fig. 2.6A). In these experiments, which were carried out in retinoid-depleted cells, downregulation of HuR enhanced cell growth to a similar extent in cells that do not express or ectopically express CRABP2 (Fig. 2.6A). In the presence of RA, both CRABP2 and CRABP2ΔNLS suppressed cell growth but the latter was less efficacious than the WT protein in exerting the effect (Fig. 2.6B). These observations suggest that CRABP2 inhibits proliferation by two distinct mechanisms, and that one of these but not the other depends on its cooperation with RAR. In agreement with this notion, in the absence of retinoids, CRABP2 and CRABP2ΔNLS inhibited proliferation with similar efficacy (Fig. 2.6C). To examine the basis for the growth-inhibitory activity of CRABP2, M2 -/- cells expressing either CRABP2 or CRABP2ΔNLS were treated with the proapoptotic agent etoposide (154). Apoptotic responses were monitored by fluorescence activated cell sorting (FACS) to measure fraction of cells undergoing DNA fragmentation (Fig. 2.6D), and by assessing etoposide-induced cleavage of caspase 3 (Fig. 2.6E) and poly ADP ribose polymerase (PARP) (Fig 2.6F). Both CRABP2 and CRABP2ΔNLS enhanced etoposide-induced apoptosis, and they 62

72 exerted similar effects in this capacity. The data thus indicate that the ability of CRABP2 to sensitize cells to apoptotic stimuli does not require cooperation with RAR. In agreement with this notion, decreasing the expression of HuR abolished the ability of CRABP2 to sensitize cells to etoposide-induced apoptosis (Fig. 2.6G). It is unlikely that the only genes regulated by HuR in cooperation with CRABP2 are Apaf1 and Elavl1. Considering the pro-apoptotic activities of the HuR CRABP2 complex, we examined its effect on the mrna for caspase 7. Decreasing the expression of CRABP2 in MCF-7 cells reduced the level of CASP7 mrna (Fig 2.6H) and overexpression of CRABP2 in M2 -/- cells upregulated Casp7 mrna (Fig 2.6I). Notably, downregulation of HuR in M2 -/- cells completely abolished the ability of CRABP2 to increase the level of this transcript (Fig. 2.6I). The data thus indicate that expression of caspase 7 is cooperatively regulated by HuR and CRABP2. The full spectrum of genes regulated by the CRABP2 HuR complex remains to be examined. 63

73 Figure 2.6: CRABP2 enhances apoptosis by cooperating with HuR. In all experiments, cells were cultured in delipidated medium for 48 h. to deplete retinoid stores. (A) M2 -/- cells stably expressing EGFP or EGFP-CRABP2 and harboring shrnas targeting Elavl1 (shelavl1) or luciferase (shluc) were plated at 35,000 cell/well and counted after 4 days of growth. Data are mean±sem (n=3). Statistical analysis was carried out by one way ANOVA and Bonferroni post-hoc test. *p<0.01 vs. cells expressing EGFP and shluc, #p<0.01 vs. cells expressing EGFP and shelavl1. Inset: number of shelavl1 expressing cells was normalized to the corresponding shluc control. (B) Growth of M2 -/- cells stably overexpressing denoted proteins in delipidated medium supplemented with 200 nm RA. Data are mean±sem (n=3). *p < 0.01 vs. EGFP control cells and, on day 3, *p < 0.01 comparing cells expressing EGFP-CRABP2 vs. EGFP-2ΔNLS. Analysis was carried out by one way ANOVA and Bonferroni post-hoc test. (C) Growth of M2 -/- cells stably overexpressing denoted proteins in delipidated medium. Data are mean±sem (n=3). *p 0.01 vs. control EGFP expressing cells, using one way ANOVA with Bonferroni post-hoc test. p > 0.1 for EGFP-CRABP2 vs. EGFP- 2ΔNLS on days 2 and 3, as calculated by two-tailed student t-test. (D, E) M2 -/- cells were transfected with vectors encoding EGFP-CRABP2 or EGFP- CRABP2ΔNLS. Cells were treated with etoposide (10 µm, 48 h.). (D) Apoptosis was evaluated by FACS to quantitate percentage of cells in sub-g1. The experiment was repeated with similar results. (E) Apoptosis was evaluated by 64

74 using immunoblots to monitor cleavage of caspase 3. The experiment was repeated with similar results. (F) M2 -/- cells were stably transfected with EGFP or EGFP-CRABP2 and treated with etoposide (10 µm, 48h.) and apoptosis was assessed by monitoring PARP cleavage by immunoblot.(g) Top: M2 -/- cells stably expressing EGFP or EGFP-CRABP2 were infected with lentivirus harboring shrna targeting either Elavl1 (shelavl1) or luciferase (shluc). Cells were then treated with etoposide (10 µm, 48 h.) and apoptosis evaluated by immunoblots monitoring caspase 3 cleavage. Bottom: Quantitation of immunoblots. The experiment was repeated with similar results. (H) MCF-7 cells were infected with lentiviruses containing vector harboring shrna targeting CRABP2 (shcrabp2) or luciferase (shluc). 3 days post-infection, cells were harvested and level of CASP7 mrna was assessed by qpcr. *p 0.01, vs. shluc, determined using two-tailed student t-test. See Fig 1D/E for knockdown of CRABP2. (I) M2 -/- cells were infected with lentiviruses containing vector harboring shrna targeting Elavl1 (shelavl1) or luciferase (shluc). 48 h later, cells were infected with control adenovirus (Ad0) or adenovirus encoding CRABP2 (Ad2). 48 h. post-adenoviral infection, RNA was extracted and Casp7 mrna levels were assessed by qpcr. Data are mean±sem (n=3). *p<0.01 vs. cells expressing shluc and Ad-0, by twotailed student t-test. Inset: immunoblots demonstrating decreased expression of HuR in cells expressing shelavl1 and increased expression of CRABP2 upon infection with Ad2. 65

75 Figure 2.7: A model for the parallel involvement of CRABP2 in HuRmediated mrna stabilization and in RAR-mediated transcriptional regulation. Apo-CRABP2 directly interacts with HuR, dramatically increases its RNA-binding affinity, and thereby enhances the stability of HuR-targeted transcripts. Ligation of CRABP2 by RA triggers its dissociation from HuR and induces the protein to mobilize to the nucleus where it delivers RA to RAR, enhancing the transcriptional activity of the receptor. The residence time of CRABP2 in the nucleus is short and, following ligand delivery, the protein rapidly returns to the extra-nuclear milieu and re-associates with HuR. The data suggest that the anti-carcinogenic activity of CRABP2 is exerted both by promoting HuR-mediated stabilization of transcripts for proteins that suppress proliferation, and by enhancing RA-induced RARmediated transcriptional upregulation of growth-inhibitory genes. 66

76 Discussion The observations suggest the following model (Fig. 2.7): in the context of some transcripts, apo-crabp2 associates with mrna-bound HUR. The association considerably enhances the RNA-binding affinity of HuR, promoting the stability and increasing the levels of such target transcripts, including Apaf1, Elavl1, and Casp7 mrnas. RA-binding by CRABP2 triggers dissociation from HuR and induces its translocation to the nucleus where it delivers RA to RAR. The residence of CRABP2 in the nucleus is short-lived and, following ligand delivery, the protein rapidly exits the nucleus and re-associates with HuR and target transcripts. The structural features of CRABP2 and HuR that mediate their interactions, the mechanism by which CRABP2 enhances the affinity of HuR towards target mrnas, and the structural basis for the RA-responsiveness of the complex remain to be elucidated. The observation that apo- but not holo-crabp2 binds to HuR suggests that the CRABP2 residues that mediate the interactions are located in a region that can sense ligand-binding. One such region is the protein s helix-loophelix domain which contains its ligand-controlled NLS (32). Another RA-responsive region is the RAR-interaction domain of CRABP2, comprised of residues Q75, P81, and K102 (36). The report that RA-induced SUMOylation of K102 allows CRABP2 to dissociate from the ER and mobilize to the nucleus in response to RA (56) raise the possibility that K102 may be involved in the association of CRABP2 with HuR. It is well-established that CRABP2 enables transcriptional activation by RAR by delivering RA directly to the receptor in the nucleus. The data presented here surprisingly reveal that CRABP2 also functions by cooperating with HuR to 67

77 enhance mrnas stability. The observations that the RA-induced nuclear translocation of CRABP2 is short-lived and that the protein rapidly returns to the cytosol and re-associates with HuR suggest that CRABP2 can exert its two functions in parallel. In support of this notion, RA treatment does not affect the levels of either the Apaf-1 or the HuR transcripts (Fig. 2.1I) or the interactions between HuR and target transcripts (Fig. 2.5F). The mechanism by which CRABP2 is exported from the nucleus remains to be clarified. Notably, while a nuclear export signal has been identified in other intracellular lipid-binding proteins, CRABP2 does not appear to contain such a signal (37, 155). An intriguing possibility is that, following delivery of RA to RAR, CRABP2 associates with nuclear HuR and leaves the nucleus in complex with this protein. The role that HuR plays in cancer cell biology is incompletely understood. It has been reported that it stabilizes some mrnas involved in cell proliferation (94). However, it was also shown that HuR is required for apoptosis (98), that it sensitizes cells to DNA damaging agents (99), and that it inhibits tumor growth in a mouse model (100). In addition, low expression levels of HuR were found to be predictive of a higher risk of breast cancer recurrence (101). In agreement with these observations, we show here that HuR stabilizes the transcripts of Apaf-1 and caspase 7, proteins closely involved in apoptotic responses, and that reducing the expression of HuR facilitates cell growth. We show further that the stability of the Apaf1 transcript is enhanced by the cooperation of HuR with CRABP2 and that the two proteins, working in concert, suppress the growth of mammary carcinoma cells and potently enhance cellular response to an apoptotic agent. While the spectrum 68

78 of anti-proliferative genes whose expression is regulated by HuR in cooperation with CRABP2 remains to be identified, the data establish that the tumor suppressive activity of CRABP2 are exerted both by its ability to deliver RA to RAR, resulting in induction of RAR-targeted growth inhibitory genes, and by its involvement in HuR-mediated stabilization of pro-apoptotic transcripts. Modulation of the interactions of HuR with mrnas may comprise a novel strategy for suppressing carcinoma cell growth. Acknowledgements We thank Ann Koehler for assistance with purification of recombinant proteins, Hua Lou (Case Western Reserve University) and Imed Gallouzi (McGill University) for HuR vectors, Cecile Rochette-Egly (IGBMC, Strasbourg) for CRABP2 antibodies, and Hiroyuki Kagechika (Tokyo Medical and Dental University) for LE540. This work was supported by NIH grants DK and CA to N.N. A.C.V. was partially supported by NIH grant 5T32GM The Cytometry and Imaging Microscopy Core Facility of the Case Comprehensive Cancer Center is supported by P30 CA

79 CHAPTER 3: Cellular retinoic acid binding protein 2 (CRABP2) inhibits tumor growth by two distinct mechanisms This work has been submitted for publication as: Cellular retinoic acid binding protein 2 (CRABP2) inhibits tumor growth by two distinct mechanisms by Amanda C. Vreeland, Liraz Levi, Wei Zhang, Daniel C. Berry, and Noa Noy Abstract Cellular retinoic acid-binding protein 2 (CRABP2) potently suppresses the growth of various carcinomas but the mechanism(s) that underlie this activity remain incompletely understood. CRABP2 displays two distinct functions: the classical function of this protein is to directly deliver retinoic acid (RA) to RAR, a nuclear receptor activated by this hormone, in turn inducing the expression of multiple antiproliferative genes. The protein s other function is exerted in the absence of RA and mediated by the RNA-binding and stabilizing protein HuR. CRABP2 directly binds to HuR, markedly strengthens its interactions with target mrnas, and thus increases their stability and upregulates their expression. Here we show that the anticarcinogenic activities of CRABP2 are mediated by both of its functions. Transcriptome analyses revealed that, in the absence of RA, a large cohort of transcripts are regulated in common by CRABP2 and HuR and many of these are involved in regulation of oncogenic properties. Furthermore, both in cultured cells and in vivo, CRABP2 or a CRABP2 mutant defective in its ability to cooperate with RAR but competent in interactions with HuR, suppressed carcinoma growth and did so in the absence of RA. Hence, transcript stabilization by the CRABP2-HuR 70

80 complex significantly contributes to the ability of CRABP2 to inhibit tumorigenesis. Surprisingly, the observations also revealed that HuR regulates the expression of multiple genes involved in nuclear pore formation and is required for nuclear import of CRABP2 and for transcriptional activation by RAR. The data thus point at a novel function for this important protein. 71

81 Introduction The vitamin A metabolite retinoic acid (RA) regulates gene transcription by activating several members of the nuclear receptor family of transcription factors: the classical RA receptors RARs (141, 156), and peroxisome proliferator activated receptor β/δ (PPARβ/δ) (8, 9). The partitioning of RA between these receptors is regulated by two intracellular lipid-binding proteins: cellular retinoic acid binding protein 2 (CRABP2), which has a high affinity for the hormone and shuttles it to RARs, and fatty acid binding protein 5 (FABP5), which has a lower affinity for RA and delivers it to PPARβ/δ. CRABP2 and FABP5 are cytosolic in the absence of their ligand, but, upon binding of RA, they undergo a conformational change that activates their nuclear localization signals and results in their mobilization to the nucleus (31-33, 155). In the nucleus, these binding proteins associate with their cognate receptors to form a complex through which RA is directly channeled to the receptor (35). CRABP2 and FABP5 thus markedly enhance the transcriptional activities of RAR and PPARβ/δ, respectively (9, 30-32, 36). Consequently, RA activates RARs in cells that highly express CRABP2 but functions through PPARβ/δ when FABP5 predominates. As RAR and PPARβ/δ regulate the expression of distinct cohorts of genes, RA displays different and sometimes opposing biological activities in cells where, due to a high CRABP2/FABP5 ratio, it activates RAR, and in cells where this ratio is low, resulting in activation of PPARβ/δ. For example, in many carcinoma cells, RAR upregulates genes that trigger differentiation, apoptosis and cell cycle arrest ( , 121, ) while PPARβ/δ induces the expression of genes that promote proliferation, angiogenesis 72

82 and survival (9, 122, 123, 160, 161). Consequently, RA inhibits the growth of carcinoma cells that express CRABP2 (30, 46, 116, 117, 120) but promotes oncogenic activities in FABP5-expressing cells (9, 130, 162). While it is well established that CRABP2 suppresses carcinoma cell growth by delivering RA to RAR, it was previously noted that this binding protein also exerts biological activities independently of either RA or its receptor (54). It was thus reported that although expression of apoptotic peptidase activating factor 1 (Apaf-1), the major protein in the apoptosome, is not controlled by either RA or RAR, ectopic expression of CRABP2 increases its level both in cultured carcinoma cells and in vivo (46, 54, 117). It was shown further that expression of CRABP2 in mammary carcinoma cells cultured in the absence of RA enhances the cleavage of several caspases, demonstrating that the protein exerts pro-apoptotic activities in the absence of its ligand (54, 117). These observations raise the possibility that the tumor-suppressive activities of CRABP2 may stem not only from its ability to activate RAR but also from an additional, RA- and RAR-independent function. It was recently reported that CRABP2 devoid of RA (apo-crabp2) functions in conjunction with HuR, one of the best characterized proteins involved in post-transcriptional regulation of gene expression in animals (72). HuR regulates various biological functions including RNA splicing, nuclear export, and transcript stabilization. It exerts the latter activity by binding to AU-rich elements (ARE) in 3 UTR regions of target mrnas thereby protecting them against degradation and upregulating their expression (69, 93, 95, 145). CRABP2 cooperates with HuR in stabilization of certain mrnas. It was thus shown that the binding protein directly 73

83 interacts with HuR both in solution and when associated with some target transcripts, and that it markedly increases the affinity of HuR for such transcripts. CRABP2 thus enhances the stability and increases the expression levels of such transcripts, including mrnas for the pro-apoptotic genes Apaf-1 and Casp7 and for HuR itself. Indeed, it was shown that CRABP2 can enhance apoptotic responses through its cooperation with HuR (54). The current work was undertaken to investigate whether its cooperation with HuR is involved in the anticarcinogenic activities of CRABP2, and to assess the relative contributions of CRABP2/RAR and the CRABP2/HuR pathways in mediating these activities. Materials and Methods Cells. The M-2 -/- cell line was generated from tumors that arose in MMTVneu/CRABP2-null mice (46). MCF-7 cells were purchased from ATCC (Manassas, VA). Cells were maintained in Dulbecco s Modification of Eagle s Media (DMEM) containing 4.5 g/l glucose, 4.5 g/l L-glutamine, 10% fetal bovine serum (Life Technologies/Gibco), 100 I.U./mL penicillin, and 100 µg/ml streptomycin. Reagents. RA was purchased from Calbiochem. Antibodies against HuR (3A2; sc-5261), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 6C5; sc-32233), actin (I-19, sc-1616), and RARβ (C-19; sc-552) were from Santa Cruz Biotechnology, Inc. Antibodies against Apaf-1 (8723) and poly-(adp-ribose)- polymerase (PARP, 9542) were from Cell Signaling Technology, Inc. Antibody against CRABP2 was a gift from Cecile Rochette-Egly (IGBMC, Strasbourg, France). Transfections were carried out using PolyFect (Qiagen). 74

84 Vectors. Mammalian expression vectors harboring cdna encoding wild-type (WT) or hcrabp2δnls N-terminus-tagged with EGFP (pegfp-c2 vector), and vector encoding flag-tagged CRABP2 were previously described (54). Lentiviral shrna production. plko.1 vectors harboring shrnas (Elavl1- TRCN , ELAVL1- TRCN CRABP2- TRCN ) were from Open Biosystems; plko.1 vectors harboring luciferase shrna (SHC007) or non-targeting shrna (SHC002) was from Sigma-Aldrich. Lentiviruses were produced in HEK293T cells and target cells were transduced using standard protocols. Expression of Elavl1 and ELAVL1, encoding mhur and hhur, respectively, was reduced using respective shrnas. Transcriptiome analyses. MCF-7 cells were transduced with lentiviruses harboring the indicated shrnas. 4 days post transduction, cells were harvested and RNA extracted using RNeasy columns (Qiagen). Samples were amplified, labeled, and hybridized on Affymetrix Human Gene 2.1 ST Arrays (Affymetrix, USA) by the Gene Expression & Genotyping Facility of the Case Comprehensive Cancer Center of Case Western Reserve University. Raw data files were analyzed using Affymetrix Expression Console and Transcriptome Analysis Console. Signal intensities were normalized using Robust Multichip Average Method (RMA). T- Test analyses were used to select genes differentially expressed in cells knocked down to either ELAVL1 or CRABP2 vs. luciferase, with fold change and p-value cutoffs respectively fixed at 1.2 and Venn analysis was used to identify the overlapping genes between the 2 groups. The list of overlapping genes was farther analyzed for known functions and pathways using IPA (Ingenuity Systems). 75

85 Real-time quantitative PCR (qpcr) was performed using a StepOnePlus Real Time PCR System with Taqman probes: Apaf1- Mm _m1, HuR/Elavl1- Mm _m1, Rarb- Mm _m1, Brca1- Mm _m1, Brca2- Mm _m1, Casp7- Mm _m1, Casp9- Mm _m1, Btg2- Mm _m1, BRCA1- Hs _m1, BRCA2- Hs _m1, CASP7- Hs _m1, HuR/ELAVL1- Hs _m1, CRABP2- Hs _m1, 18S E (Applied Biosystems). Levels of mrnas were normalized to 18S ribosomal RNA using the ΔΔCt Method (Applied Biosystems Technical Bulletin no. 2). Transactivation Assays were carried out as previously described (36). Confocal fluorescence microscopy. M-2 -/- cells, cultured in DMEM containing 10% charcoal-treated FBS, were transfected with pcmv-3tag-1 encoding Flag- CRABP2. Cells were fixed in 4% paraformaldehyde/pbs, blocked, and permeabilized with PBS containing 0.2% Triton X-100 and 1% BSA (room temperature, 1h.). Flag-tagged CRABP2 was visualized by immunostaining using antibodies against Flag (Sigma-Aldrich, F1804). Nuclei were visualized by DAPI staining. Cells were mounted with Fluoromount-G (SouthernBiotech) and imaged using a LSM510 confocal micrpscope (Leica). Animal studies. 9 weeks old NCr nu/nu nude female mice were purchased from the Athymic Animal and Xenograft Core Facility of the Case Comprehensive Cancer Center and housed at the Case Western Reserve University School of Medicine Animal Facility in accordance with the regulations of the American Association for the Accreditation of Laboratory Animal Care. 3x10 6 cells in 100 μl serum-free 76

86 DMEM were injected subcutaneously. Tumor growth was measured with calipers and tumor volumes were calculated using the following formula: (length width 2 )/2. Histology. Tumors were excised, fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, mounted on glass slides, and stained with hematoxylin and eosin (H&E) by the Tissue Procurement, Histology, & Immunochemistry Core Facility of the Case Comprehensive Cancer Center. Immunohistochemistry was performed using the EXPOSE Rabbit specific HRP/DAB detection IHC kit (Abcam, ab80437). Antigen retrieval was achieved by boiling slides in 10 mm sodium citrate, ph 6.0 for 10 min. Sections were incubated with antibodies against phosphorylated histone H3 (Cell Signalling Technology, 9701) at a 1:200 dilution (16 hrs. 4 C). Slides were imaged using a Leica DM6000 and Volocity Acquisition software at the Imaging Core facility of the Department of Genetics and Genome Sciences at CWRU. Results CRABP2 and HuR regulate a common cohort of cancer-related genes. In some carcinoma cells that express CRABP2, RA inhibits proliferation by activating RAR and thereby inducing the expression of anti-proliferative RAR target genes (30, 46, 116, 117, 120, 125). In accordance, treatment with RA inhibited the growth of MCF-7 mammary carcinoma cells, which highly express CRABP2 (125), and decreasing the expression of CRABP2 (Fig. 3.1A) diminished the anti-proliferative activity of RA (Fig. 3.1B). Interestingly however, decreasing the expression of CRABP2 in these cells promoted cell proliferation even in the absence of RA (Fig. 77

87 3.1B). These observations suggest that, in addition to delivering RA to nuclear RAR, CRABP2 suppresses cell growth by an additional, RA-independent mechanism. In regard to this possibility, it was recently reported that apo-crabp2 directly binds to the RNA binding protein HuR, increases its affinity for some target transcripts, and thereby enhances the stability of these mrnas and increases their expression (54). Transcriptome analyses were carried out to begin to examine whether the RA-independent growth-suppressive activity of CRABP2 may stem from its cooperation with HuR. The expression levels of CRABP2 or HuR in MCF- 7 cells were reduced using respective shrnas (Fig. 3.1C, 3.1D). Cells were depleted of retinoids by culturing them in charcoal-treated medium and transcriptome analyses were carried out using Affymetrix Human Gene 2.1 ST Arrays. Decreasing the expression of CRABP2 or HuR altered the expression of 607 or 1678 mrnas, respectively. Of these, 135 transcripts were found to be regulated in common by CRABP2 and HuR (Fig. 3.1E). Notably, these mrnas were predominantly regulated in the same fashion: 93 mrnas were downregulated and 38 mrnas were upregualted in response to reducing the expression of either protein (Fig. 3.1F, 3.1G). Only 4 mrnas were regulated by HuR and CRABP2 in opposite directions (Fig. 3.1F, 3.1G). Hence, a significant subset of HuR-regulated mrnas are also targeted by CRABP2. Ingenuity Pathway Analysis (IPA) revealed that many genes commonly regulated by CRABP2 and HuR are involved in regulation of oncogenic properties, including cell proliferation and survival, migration, invasion, and death, with about 90 clustering as cancer genes (Fig. 3.2A). Validation of three genes identified by the transcriptome 78

88 analysis by quantitative real-time PCR (qpcr) showed that mrna for the apoptotic gene CASP7, which was previously shown to be controlled by the CRABP2-HuR complex (54), and the tumor suppressor genes BRCA1 and BRCA2 (163) were markedly downregulated in cells with decreased expression of either CRABP2 (Fig. 3.2B) or HuR (Fig. 3.2C). 79

89 Figure 3.1: CRABP2 and HuR regulate a common subset of genes. (A) MCF-7 cells were transduced with lentiviral particles harboring a non-targeting shrna (shctrl) or shrna targeting CRABP2 (shcrabp2). Cells were selected with puromycin to generate cell lines stably expressing the respective shrnas. Immunoblots demonstrate reduced expression of CRABP2. (B) Cells were cultured in delipidated medium for 48 hours, treated with vehicle or RA (1 µm) for 4 days and counted. Data are mean±sem (n=3). (C, D) MCF-7 cells were transduced with lentiviral particles containing shrnas targeting luciferase (shctrl), CRABP2 (shcrabp2, C), or HuR (shhur, D). Levels of mrna for CRABP2 (C) or HuR (D) were assayed by qpcr. Data are mean±sem (n=3). *p 0.01 by twotailed student t-test. (E) Venn diagram depicting changes in gene expression in cells with reduced expression of CRABP2 and HuR. 135 genes were found to be regulated by both CRABP2 and HuR. (F, G) Expression profiles of genes commonly regulated by CRABP2 and HuR, represented in a heat map clustering (F) or plotted as log2(fold change) of genes regulated by CRABP2 vs. HuR (G). 80

90 Figure 3.2: CRABP2 and HuR co-regulate cancer-related genes. (A) Top 16 biological functions and diseases found significantly represented in the set of genes commonly regulated by CRABP2 and HuR (B, C) Levels of denoted mrnas in MCF-7 cells expressing shrnas targeting luciferase (shctrl) or CRABP2 (shcrabp2, B), or HuR (shhur, C) measured by qpcr. Mean ±SEM (C: n=3, D: n=4). *p 0.01, ǂp=0.02 by two-tailed student t-test 81

91 CRABP2 inhibits mammary carcinoma cell growth by two distinct mechanisms. A nuclear localization-defective CRABP2 mutant was used to assess the relative contributions of the two functions of the protein to its ability to inhibit carcinoma cell growth. This mutant, CRABP2-K20A/R29A/K30A (CRABP2ΔNLS), binds RA with native affinity but lacks the protein s nuclear localization signal and thus does not undergo RA-induced nuclear translocation and does not enhance the transcriptional activity of RAR (32, 54). CRABP2ΔNLS nevertheless retains a high affinity for HuR and is indistinguishable from the WT protein in its ability to cooperate with HuR in enhancing mrna stability (54). M-2 -/- mammary carcinoma cells, a line derived from mammary tumors that arose in the MMTV-neu mouse model of breast cancer bred with Crabp2-null mice (46), was used. These cells do not express CRABP2, providing a clean background for examining effects of CRABP2 on cell growth. M-2 -/- cells lines that stably overexpress a control vector encoding EGFP, or EGFP-tagged CRABP2, or EGFP- CRABP2ΔNLS were generated (Fig. 3.3A). Ectopic expression of CRABP2 suppressed the growth of M-2 -/- cells in the absence of RA and notably, CRABP2ΔNLS exerted a similar effect (Fig. 3.3B). Hence, in accordance with its activity in MCF-7 cells (Fig. 3.1B), CRABP2 can suppress cell growth by a RA- and RAR-independent mechanism. Treatment of these cells with RA markedly facilitated their growth (Fig. 3.3B). This response reflects that, as these cells lack CRABP2 but express FABP5, RA is directed to PPARβ/δ and thus exerts proliferative activities (9, 46). Indeed, expression of CRABP2 converted RA from a pro-proliferative to a growth-suppressing agent (Fig. 3.3B). CRABP2ΔNLS also 82

92 inhibited cell growth in the presence of RA but it did so less efficiently than the WT protein. Interestingly, the rate of proliferation of CRABP2ΔNLS-expressing cells in the presence of RA was similar to that of CRABP2-expressing cells devoid of RA. To further examine the involvement of the two functions of CRABP2 in regulation of carcinoma cell growth, M-2 -/- cells that express CRABP2 or CRABP2ΔNLS were subcutaneously injected into female NCr nu/nu athymic mice and tumor growth was monitored. To minimize variability between animals, each mouse was injected with the M-2 -/- cells stably expressing a control vector into one flank, and with M-2 -/- cells that stably express either CRABP2 or CRABP2ΔNLS into the opposite flank. Tumors that arose at sites injected with CRABP2- expressing cells developed at a slower rate than those that arose from control cells (Fig. 3.3C). Similarly to their behavior in cultured cells, CRABP2ΔNLS-expressing cells developed tumors at an intermediate rate, displaying slower growth than that displayed by control cells, but faster than that observed by cells that express WT- CRABP2 (Fig. 3.3C). Reflecting activation of RAR, expression of CRABP2 resulted in an increase in mrna and protein of three established RAR target genes: Rarb, Casp9, and Btg2 (Fig. 3.3D, 3.3E). In accordance with its inability to cooperate with RAR, CRABP2ΔNLS did not affect the levels of these RAR targets (Fig. 3.3D, 3.3E). However, both CRABP2 and CRABP2ΔNLS upregulated the expression of Apaf1, Elavl1, Casp7, Brca1, and Brca2, genes that are controlled by CRABP2 in conjunction with HuR ((Fig. 3.3F-3.3H) and (54)). Taken together, these observations indicate that CRABP2 exerts anticarcinogenic activities through two distinct mechanisms, that one of these is mediated through the ability of the protein 83

93 to enhance RA-induced activation of RAR, and that the other likely emanates from upregulation of anti-proliferative genes brought about through the cooperation with HuR. Histological analyses revealed that while the general morphology of all tumors was similar (Fig. 3.4A), tumors that arose from cells expressing CRABP2 had fewer nuclei that were positively stained for the proliferation marker phosphorylated histone H3 (phospho-histone-h3), while tumors from cells expressing CRABP2ΔNLS displayed an intermediate number of positive nuclei (Fig. 3.4A). Tumors that arose from cells that express either CRABP2 or CRABP2ΔNLS similarly displayed a marked increase in cleavage of the apoptotic protein PARP (Fig. 3.4B). The data thus suggest that suppression of cell growth by CRABP2 is mediated both by RAR and by HuR, while pro-apoptotic activities of the protein are exerted primarily through its cooperation with HuR. 84

94 Figure 3.3: CRABP2 inhibits mammary carcinoma cell growth by two distinct mechanisms (A) M-2 -/- cells stably expressing EGFP (Ctrl), EGFP-CRABP2 (2), or EGFP- 2ΔNLS (2ΔNLS). Immunoblotting demonstrate similar expression of WT and mutant CRABP2. GAPDH was used as a loading control. (B) Cells were cultured in delipidated medium for 48 h. and treated with vehicle of RA (200 nm) for 4 days and counted. (C) M-2 -/- cells (3x10 6 ) that stably over-express EGFP (Ctrl), EGFP- CRABP2 (2), or EGFP-CRABP2ΔNLS (2ΔNLS) were injected subcutaneously into female NCr nu/nu mice and tumor growth was monitored. Data are mean±sem (mice: Ctrl: n=20, CRABP2- and CRABP2ΔNLS: n=10 each). *p 0.05 vs. Ctrl, ǂp 0.05, using two-tailed student t-test. (D-H) Levels of denoted mrnas (D, F) and proteins (E, G, H) in tumors expressing EGFP (Ctrl), CRABP2 (2) or CRABP2ΔNLS (2ΔNLS). (D, F) Levels of mrnas assessed by qpcr. Mean±SEM (n=3-5) *p 0.05 vs. Ctrl using two-tailed student t-test. (E, G, H) Left: immunoblots using denoted antibodies. Right: Quantification of immunoblots.mean±sem (n=4). *p 0.05 vs. Ctrl using two-tailed student t-test. 85

95 Figure 3.4: Cell proliferation and apoptosis in tumors expressing CRABP2 or CRABP2ΔNLS (A) Histological analyses of tumors that arose from M-2 -/- cells that stably overexpress EGFP (Ctrl), EGFP-CRABP2 (2), or EGFP-CRABP2ΔNLS (2ΔNLS). Top: H&E: hematoxylin and eosin staining. Bottom: immunohistochemistry demonstrating expression of phosphorylated histone H3 (phospho-histone H3). Bars: 100 microns. (B) Left: immunoblots of full length and cleaved PARP in tumors. GAPDH was used as loading control. Right: Quantitation of immunoblots. *p 0.05 vs. Ctrl, using two-tailed student t-test. 86

96 HuR is required for CRABP2-mediated activation of RAR. Depletion of retinoids and usage of CRABP2ΔNLS allowed for dissection between the two functions of CRABP2 by negating its cooperation with RAR. To further examine the relative contributions of these activities, M-2 -/- cell lines that express different levels of HuR in the absence or presence of ectopically expressed CRABP2 were generated (Fig. 3.5A). Cell were cultured in the presence of 200 nm RA and cell growth was monitored (Fig. 3.5B). Ectopic expression of CRABP2 markedly suppressed proliferation. In agreement with previous reports that HuR displays anti-proliferative activities (54, ), decreasing the expression level of this protein enhanced cell growth. Surprisingly however, despite the presence of RA, decreasing the expression of HuR negated the ability of CRABP2 to inhibit cell growth. Cells with reduced expression of HuR and counterparts that express CRABP2 were then injected into NCr nu/nu athymic mice and tumor growth was monitored (Fig. 3.5C). Similarly to the behavior of cultured cells, ectopic expression of CRABP2 in M-2 -/- cells failed to suppress tumor development from cells with reduced level of HuR (Fig. 3.5C). These observations surprisingly suggest that HuR not only directly cooperates with CRABP2 in mediating growth inhibition, but that its presence is also necessary for enabling CRABP2 to inhibit proliferation in conjunction with RAR. In support of this conclusion, ectopic expression of CRABP2 had no effect on the RAR target genes Casp9 and Btg2 in tumors that arose from cells with reduced expression of HuR (Fig. 3.5D). Transcriptional activation assays were carried out to directly examine whether HuR affects the transcriptional activity of the CRABP2/RAR path. Cells that stably express different 87

97 levels of CRABP2 and HuR (Fig. 3.5A) were transfected with a luciferase reporter driven by an RAR response element (RARE), treated with RA, and luciferase activity was measured (Fig. 3.5E). In control cells, RA activated the reporter and CRABP2 enhanced the response. However, although expression of HuR was reduced in these cells by only 40-50% (Fig. 3.5A), the decrease inhibited RAinduced reporter activation both in the absence and in the presence of CRABP2. 88

98 Figure 3.5: HuR is required for actvation of RAR and suppression of tumor development by CRABP2 (A) M-2 -/- cell lines stably expressing EGFP (Ctrl) or EGFP-CRABP2 (CRABP2) (Fig. 3.3A) were transduced with lentiviral particles encoding a non-targeting shrna (shctrl) or shrna targeting HuR (shhur). Cells were selected with puromycin to generate cell lines stably expressing the respective shrnas. Top: Overexpression of CRABP2 and reduced expression of HuR demonstrated by immunoblotting. Bottom: quantitation of HuR immunoblots. (B) Cells were cultured in delipidated medium for 48 h., treated with vehicle or RA (200 nm) for 3 days and counted. Mean±SEM (n=3). *p (C) 3x10 6 M-2 -/- cells expressing reduced levels of HuR and ectopically expressing EGFP (Ctrl) or EGFP-CRABP2 (CRABP2) (Fig. 3.5A) were injected subcutaneously into the opposite flanks of female NCr nu/nu mice. Tumor growth was monitored. Mean±SEM (n=10). (D) Levels of denoted mrnas in tumors were assessed by qpcr. Mean±SEM (n=3). (E) Cells with varying expression levels of CRABP2 and HuR (Fig. 5A) were cultured in delipidated medium for 48 h., then co-transfected with an RARE-driven luciferase reporter gene and a vector encoding β-galactosidase. Cells were treated with vehicle or RA (20 nm, 16 h.) and luciferase activity was measured and normalized to β-galactosidase (βgal) activity. Mean±SD (n=3). *p 0.01 vs. RAtreated Ctrl cells. 89

99 HuR is required for the RA-induced nuclear import of CRABP2. Upon binding RA, CRABP2 undergoes re-localization to the nucleus where it delivers the ligand to RAR. Possible involvement of HuR in the nuclear translocation of CRABP2 was thus examined. Control M-2 -/- cells which stably express shrna against luciferase (shctrl) or HuR (shhur) were generated (Fig. 3.6A). Cells were transfected with a vector encoding Flag-tagged CRABP2, immunostained using Flag antibodies, and the protein visualized by confocal fluorescence microscopy (Fig. 3.6B). In control cells, CRABP2 was predominantly cytosolic in the absence of RA and mobilized to the nucleus 30 min. following RA treatment. Strikingly, in cells with reduced expression of HuR, RA induced a discernable shift in the subcellular localization of CRABP2 but this shift did not culminate in nuclear import. Instead, 30 min following RA treatment, CRABP2 accumulated around the nucleus and did not enter this compartment (Fig. 3.6B). The observations thus show that HuR expression is critical for enabling the nuclear import of CRABP2. Interestingly, examination of data emerging from transcriptome analysis revealed that reducing the expression of HuR significantly decreased the expression levels of multiple proteins involved in nuclear pore formation, nuclear import/export (Fig. 3.6C). 90

100 Figure 3.6: HuR is required for RA-induced nuclear translocation of CRABP2 (A) M-2 -/- cells were transduced with lentiviral particles encoding shrnas targeting luciferase (shctrl) or HuR (shhur), and selected with puromycin to generate cell lines stably expressing the shrnas. Immunoblot demonstrating downregulation of HuR in cell line stably expressing shhur. (B) Cells were cultured in delipidated medium and transfected with vector encoding Flag-CRABP2. Flag-CRABP2 was immunostained in untreated cells and in cells treated with RA for 30 min. and visualized using confocal microscopy. DAPI was used to visualize nuclei. (C) Genes involved in nuclear import/export that were found by transcriptome analysis (Fig. 3.1) to be downregulated upon decreasing the expression of HuR. 91