REGULATORY MECHANISMS OF TRANSCRIPTION FACTOR FUNCTION

Transcription

1 Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) RG Clerc REGULATORY MECHANISMS OF TRANSCRIPTION FACTOR FUNCTION Protein synthesized Protein phosphorylated Ligand binding Release inhibitor Change partner, etc

2 CREB FOXO NFAT

3 Body plan is constructed through interactions of the developmentally regulated homeotic gene expression posterior late low RA response anterior early high RA response trunk hindbrain Alexander T and Krumlauf R. Ann.Rev.Cell.Dev.Biol: 25_431 (2009)

4 Transcription control of the Hox genes: insight into the colinearity mechanism P A Tarchini B and Duboule D. Dev.Cell 10_93 (2006) a p a p a p a p a p a p correlation between linear arrangement along the chromosome and timing of transcriptional regulation WT MUT WT MUT WT MUT

5 Activation of TRX following G-Protein Coupled Receptor GPCR Ligand Binding

6 CREB (cyclic-amp Responsive Elements Binding Protein) Structure of the CREB basic region/leucine zipper domain (amino acids ) (bzip) bound to the somatostatin CRE (TGACGTCA)

7 Phosphorylation of CREB at Ser133 Induces Complex Formation With an α-helical Domain in CBP KIX CBP-CREB complex

8

9

10 The Heat Shock Transcription Factor DBD (whth) cgcctcgaatgttcgcgaaa -46 hsp70

11 The Heat Shock Factor Family Across Species Canonical HSE (multiple adjacent pentanucleotide motifs) cgcctcgaatgttcgcgaaa -46 hsp70

12 Regulation of the HS Response and the HSF Cycle Inert monomer in the cytoplasm and nucleus Stress induced DNA binding and TA potential (hyperphosphorylation) Trimerization HSF binding protein (HSBP1) negatively regulates trimer Dissociation of trimers Generation of unactive monomers upon binding of chaperones Hsp70 and Hdj-1

13 CREB FOXO NFAT

14 The Nuclear Pore Complex is the Gateway That Regulates the Two-Way Traffic Between the Nucleus and the Rest of the Cell

15 The Nuclear Pore Complex is the Gateway That Regulates the Two-Way Traffic Between the Nucleus and the Rest of the Cell

16 Nucleocytoplasmic Trafficking: Nucleopore Complex and Karyopherins

17 Regulation of FoxO by Nuclear Shuttling in Response to AKT Mediated Phosphorylation Winged-helix family of trx factors are involved in development, metabolism, cell differentiation Fox=Forkhead box (100AA) Phosporylation stimulates nuclear export (NES) and prevents nuclear import (NLS)

18 The activity of FoxO is tightly regulated by post-translational modifications including phosphorylation, acetylation and ubiquitylation

19 Multiple Levels of Control of NFAT Signaling TCR, IGF, EGF inhibition CsA induction IL2,IL3,IL4,GMCSF,TNF

20 Cooperative Binding of Two Unrelated Transcription Factors to Neighboring Sites Chen L. and Harrison SC. Nature 392:42-48 NF-AT (REL homology domain), AP-1 (Fos-Jun) cooperatively bind a composite DNA site (ARRE from IL-2 promoter)

21 CREB FOXO NFAT

22 Hormone Dependent Gene Activation by a Homodimeric or Heterodimeric Nuclear Hormone Receptor

23 Conformational Change of the LBD of Two Related Nuclear Hormone Receptors Upon Ligand Binding

24 The NFκB Paradigm: Signal Induced Degradation of a Cytosolic Inhibitor Proteins Which Activates the TF Phosphorylation dependent release by inhibitor

25 The NFκB/REL Family and IκB Proteins NF-kappa B p50 homodimer bound to DNA Müller CW, Harrisson SG and Verdine GL. Nature 373:

26 The NFκB Paradigm: Signal Induced Degradation of a Cytosolic Inhibitor Proteins Which Activates the TF: Today! TRX factors such as NFκB are final effectors of various cellular signaling cascades Oeckinghaus A. Hayden M. Ghosh S (2011) Nature Immunology 12:

27 Helix-Loop-Helix Domains E box TF 5 CANNTG3

28 Structural Classes Helix-Loop-Helix Domains - the DBD is Separated by Nonhelical Loops from the Leu-Zipper Region (Coiled-Coil) T. Kadesch Cell Growth and Diff.4:49 (1993)

29 bhlh Factors Activity is Modulated by Partner Exchange bhlh dimers in which both subunits have a basic region can bind DNA; a dimer in which a subunit lacks the basic region (eg Id) cannot bind the promoter regulatory element

30 Cholesterol and Triglyceride Synthesis Pathways

31 Domain Structure of SREBP s Membrane Bound TF (sterol regulatory element (SRE) binding protein - 5 PyCAPyNPyCAPy3 )

32 Sterol Dependent Two-Steps Proteolytic Cleavage of TF

33 The Sterol Response: Cleavage to Release the Active TF Brown M. Goldstein JL. Cell 89 (1997)

34 Activation of Tubby TF Upon Ligand Binding to G-protein Coupled Receptor (GPCR s) Ligand Binding The tubby gene is mainly expressed in the hypothalamus and is involved in feeding behaviour control. Mice bearing a tubby null allele develop adult onset of obesity Tubby contains both a DBD and a AD; it is localized in the cytoplasm, near the plasma membrane (unusual for a TF!) Tubby is bound tightly to PIP2 in the plasma membrane and Go or Gqcoupled receptors (which activate phospholipase C) activate Tubby by activating PIP2 hydrolysis and the consequent release of Tubby into the nucleus

35 LEF-1/TCF-1

36 The canonical Wnt β-catenin pathway W. Birchmeier. Nature Reviews 8: (2008)