Rapid detection of Mycobacterium tuberculosis complex from sputum samples using novel Loop-Mediated Isothermal Amplification
|
|
|
- Abel Marshall
- 6 years ago
- Views:
Transcription
1 Rapid detection of Mycobacterium tuberculosis complex from sputum samples using novel Loop-Mediated Isothermal Amplification Tetsu Hase, Ph.D. EIKEN CHEMICAL Co.,LTD. 1
2 Basic principle of LAMP method 2
3 Mechanism of LAMP reaction FIP 5' F1c F2 3' F3 5' F3 3' primer F3c F2c F1c Target DNA B1 B2 B3 3' 5' 5' 3' F3 F2 F1 B1c B2c B3c 3' B3 5' B3 3' primer B2B1c 5' DNA polymerase (with strand displacement activity) dntps Mg ++ Incubate at 60 ~65 BIP F1c F2 F2c FIP F1 F1c B1 B1c B2 FIP BIP F2 F1 F1c (11) B1c B2c B2 B1 BIP B1c 3
4 Products of LAMP reaction HBV (copies/reaction) M Ear I EarI cutting site 500 bp 85bp 100 bp 90bp 85bp 85bp 85bp 85bp 90bp 90bp 90bp 2% agarose gel electrophoresis 4
5 Procedure Procedure of of the LAMP LAMP method method Target DNA Primers (FIP, F3, BIP, B3) DNA Polymerase with strand displacement activity dntps Buffer solution 60 65C min. Detection Simple Rapid (high efficiency) Specific (high specificity) Cost effective 5
6 Detection -Turbidity - dntps DNA Polymerase DNA DNA-(dNMP) n + np 2 O 7 4- Mg 2+ Mg 2 P 2 O 7 ( White precipitate) Real-time turbidimeter LA200 <Real time monitoring> Turbidity Turbidity Time (min) Time (min) copies/reaction Purified HBV genomic DNA was used as a template. 6
7 Detection - visible fluorescence - UV UV fluorescence quenching Calcein Mn 2+ dntps LAMP amplification Calcein PPi + Mn 2+ Mn 2 P 2 O 7 <Instrument for the detection> - + ( TB ) 7
8 Development of LAMP assay for detection of Mycobacterium tuberculosis complex (TB-LAMP) 8
9 Multiple alignment of LAMP primer region of Mycobacterium gyrb gene F3 F2 Loop F F1c B1c Loop B B2 B3 TB complex non TB KPM KY741 KPM KY721 KPM KY715 KPM KY713 KPM KY709 KPM KY708 KPM KY699 KPM KY698 KPM KY697 KPM KY686 KPM KY682 KPM KY679 KPM KY678 KPM KY677 KPM KY673 KPM KY643 KPM KY631 KPM KY590 T 021 H37Ra M. bovis M. africanum M. microtii M. kansasii M. marinum M. simsiae M. scrofulaceum M. szulgai M. gordonae M. intracellulare M. avium TCGGACGCGTATGCGATATCTGGTGGTCTGCACGGCGTCGGCGTGTCGGTGGTTAACGCGCTATCCACCCGGCTCGAAGTCGAGATCAAGCGCGACGGGTACGAGTGGTCTCAGGTTTATGAGAAGTCGGAACCCCTGGGCCTCAAGCAAGGGGCGCCGACCAAGAAGACGGGGTCAACGGTGCGGTTCTGGGCCGACCCCGCTGTTTTCGAAACCACGGAATACGACTTCGAAACCGTCGCCCGCCGGCT A T C-----C--C G--C--G T--G--T--C C-----A--G G--G--G CC-T G C-----A--C--G--GA----A C T C--CA-G T---AA------T--G-----C--G A--A---T- AACAGT-GT--CAACG-CAG G--T C G A--G C A G---T-C--C--CCGCG-CC-G--GGGCAC------A--G--C-A-G-A C--AA-C--CA-C T-G-ACA-C--T--G-----C G--G--G--G--G--C-- AACAGT-GC--CA-CG-CAGC--C--GT G-----A C-----C--G C--G------A-CG T-----C--T TC---TAC--C--CCG-G---TG---GGCAC C-A-G C--CA-C---A-C T--T-AGA-C CC-G G--G--G--G------T- AACAG--GC--CA-CG-CAGC-----GT A--G C G C--G--G---ACC C T----TAC--C--CCGCG-C-TG---GGAAC G--C-A-G-C C--AA-C---A-CA G AAA-C AC-G G-----G--G--G----- AACAGT-GC--CAACG-CAG G G G--G G-----C T-----CC--A G---T-C--CA-C---G-C-TG--GGGCACG-----A--G--T-AAG-C--T-----A--C--AA-G--AA-TA G-ACA-C-----G-----C G-----G--A AACAG--GC--CA--G-CAGC-----GT G T-G--G--G---T-G C-----A C G---TA---CA--CGCG---TG--GGGCAC G--T-A-A-----CGC-----C--CA-C--AA-C G--T--G-AGA-C-----G-----CC G--G--G--G AACAG--GT--CAACG-CAGC-----C G-----C C G--G G--G--C---GCC-----T--C-----A-----G---T-C--C--CC-CG-C-T----GGAACG-----A--G--T-A-G-C------CG------CA-C---A-CA ACA-C-----G-----C--G G--G--G--G AACAG--GC--CAACG-CAGC--C C C G-----T G---A-C---GCC C G---TAC--C--CC-CG-C-TG---GGCAC G--C-A-G-C------CGC--C--CA-C--CA-C ACA-C-----G-----C--G G--G-----G
10 Analytical specificity of TB-LAMP NC Turbidity M.tuberculosis M.avium M.intracellulare M.kansasii M.simiae M.fortuitum M.gordonae M.xenopi Time (min) M.scrofulaceum M.szulage M.marinum M.chelonae Template: purified genomic DNA (10 6 copies/ reaction) 10
11 Analytical sensitivity of TB-LAMP Turbidity copies/reaction Time (min) copies/reaction Template: purified genomic DNA 11
12 Sample preparation Whole Procedure of TB-LAMP Decontamination Decontamination of of sputum sputum sample sample with with NALC-NaOH NALC-NaOH Boiling of the sample to lyse bacteria Extraction device Purification of DNA using Extraction device Amplification Detach Detach the the DNA-trapped DNA-trapped Microweb Microwebtip tip into into the the reaction reaction mixture mixture containing containing Calcein Calceinreagent LAMP reaction at 65C for 40min Detection Detection Detection of of visible visible fluorescent fluorescent signal signal Microweb tip 12
13 TB-positive specimens Specimen Smear Amplicor LAMP No. result result result 1 - TB TB + 3 G1 TB TB TB + 6 G3 TB + 7 G8 TB TB TB + 10 G1 TB + 11 G1 TB + 12 G1 TB TB + 14 G1 TB + 15 G1 TB + 16 G2 TB TB + 18 G2 TB + 19 G1 TB + 20 G5 TB + NC - PC + * * N N P P (No.3*,4*:Sputum samples in small volumes were used) 13
14 TB-negative specimens Specimen Smear Amplicor LAMP No. result result result 1 G3 M. avium M. avium M. avium M. avium - 5 G1 M. avium M. avium M. avium - 8 G1 M. intraceluurae M. intraceluurae - 10 G6 M. intraceluurae NC PC - + N N P P
15 Summary of Preliminary Data of TB-LAMP TB-LAMP + - Amplicor a) Results of TB-LAMP showed good correlation with the Amplicor s results. b) Concordance rate of TB-LAMP indicating TB-positive was 90% (18/20; with Amplicore positive samples). c) Results of TB-LAMP gave good agreement with the results of Amplicor (25/25; in case of smear negative samples). 15
16 Direct Method from Sputum Sample (1) AFB NALC-NaOH Direct method Fluoresent visual Turbidity detection Tt (min) Fluorescent visual detection Sample ID Culture (score) Turbidity Tt (min) Comments N.D./- - N.D./ N.D./- - N.D./- ± N.D./- - N.D./ N.D./- - N.D./ N.D./- - N.D./ N.D./- - N.D./ N.D./- - N.D./ N.D./- ± N.D./ N.D./- - N.D./- ± N.D./- - N.D./- ± / / / / / / / / / / / / / / / / N.D./- - N.D./- - not homogenious /+ + N.D./- - not homogenious 16
17 AFB Sample ID Culture (s core) Direct Assay from Sputum Sample (2) Turbidity Tt (min) NALC-NaOH Direct method Fluorescent visual detection Turbidity Tt (min) Fluorescent visual detection / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / /+ + Comments / /+ ± bloody sputum / / / / / / / / / / N.D./- - N.D./- - not homogenious 17
18 Evaluation of Direct method with sputum specimens NALC-NaOH Direct method + +/- +/ Culture Culture a) In general, Direct method showed good correlation with the NALC method. b) There were a few samples, which showed discrepant results which could have been due to the following reasons. - interference with the fluorescence signal by Haeme - non-homogeneous samples and insufficient samples - false labeling of the samples c) Eiken shall investigate further samples. 18
19 Conclusion TB-LAMP assay provides: Rapid: Results can be obtained within two hours including DNA extraction. Simple: Whole assay procedure is very simple and easy to operate. It does not require any sophisticated equipments. Specific: It detects TB complex specifically (no cross reaction with NTB). Sensitive: 10 copies of TB DNA can be detected. 19
20 EIKEN will contribute to the global health through LAMP based diagnostic tools. Acknowledgment: We would like to express great appreciation to FIND for providing us precious samples and valuable advise. 20
M.kansasii M.marinum M.avium M.simiae M.szulgai M.gordonae M.xenopi M.intermedium M.intracellulare M.scrofulaceum M.avium sp.
Molecular-genetic methods for species identification of mycobacteria Smirnova T.G., Chernousova L.N., Vorobyeva A.V., Larionova E.E., Andreevskaya S.N. Central TB Research Institute of RAMS, Moscow 2010
A Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB).
A Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB). Wanyuan Ao, Steve Aldous, Evelyn Woodruff, Brian Hicke,
TB Updates for the Physician Rochester, Minnesota June 19, 2009
TB Updates for the Physician Rochester, Minnesota June 19, 2009 Mycobacterial Laboratory Science Update Nancy L. Wengenack, Ph.D. Associate Professor of Laboratory Medicine and Pathology Division of Clinical
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
AFB Identification Texas Approach
AFB Identification Texas Approach Ken Jost Texas Department of State Health Services 6th National Conference on Laboratory Aspects of TB June 21, 2010 DSHS-Austin TB Lab Customers & Samples Year 2009 175
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
Rapid differentiation of mycobacterium tuberculosis and mycobacterium leprae from sputum by polymerase chain reaction
Original Article Nepal Medical College Journal 27; 9(1): Rapid differentiation of mycobacterium tuberculosis and mycobacterium leprae from sputum by polymerase chain reaction Bishwa Raj Sapkota, Chaman
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
Mycobacterial cell wall. Cell Cycle Lengths. Outline of Laboratory Methods. Laboratory Methods
Laboratory Methods Cell Cycle Lengths Generation time (hrs) Days needed for 26 generations (colony) E. coli 0.33 0.36 Nancy Connell, PhD Professor, nfectious Disease Department of Medicine Center for Emerging
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis
Product Manual HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis For research use only. Not for use in diagnostic procedures for clinical purposes Catalog
Hepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
Human Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment
Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:
A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently
Anti-tuberculosis drug resistance in the world and rapid diagnosis of tuberculosis
Anti-tuberculosis drug resistance in the world and rapid diagnosis of tuberculosis Chiyoji ABE acquired drug resistance primary drug resistance 10 10 HIV 1 3 INHRFP MDR-TB DOTSDirectly Observed Treatment,
Harmonizing the Use of Molecular & Culture-based DST of Mycobacterium tuberculosis
Harmonizing the Use of Molecular & Culture-based DST of Mycobacterium tuberculosis Grace Lin, MS. Research Scientist grace.lin@cdph.ca.gov APHL 8 th TB Lab Conference San Diego 8-19-13 Harmonizing? There
Update on LAMP Project. OFFLU Technical Meeting, 4-5 April 2012 Royal Holloway, UK Sasan Fereidouni, Anja Globig
Update on LAMP Project OFFLU Technical Meeting, 4-5 April 2012 Royal Holloway, UK Sasan Fereidouni, Anja Globig Early and Rapid Diagnosis of Influenza Need for (rapid) tests with the following properties:
Case Study 2016 Wisconsin Mycobacteriology Laboratory Network Annual Conference November 17, 2016
Case Study 2016 Wisconsin Mycobacteriology Laboratory Network Annual Conference November 17, 2016 Raymond P. Podzorski, Ph.D, D(ABMM) St. Mary s Hospital Laboratory and Wisconsin Region SSMHealth 608-258-6393
TB Laboratory for Nurses
TB Laboratory for Nurses Shea Rabley, RN, MN Consultant Mayo Clinic Center for Tuberculosis 2014 MFMER slide-1 Disclosures None 2014 MFMER slide-2 Objectives Participants will be able to: 1. Name 2 safety
MYCOBACTERIOLOGY SERVICE MANUAL
MYCOBACTERIOLOGY SERVICE MANUAL The Office of Laboratory Services (OLS) provides primary isolation and identification of Mycobacterium species in human diagnostic specimens. Reference specimens of AFB
A Rapid Colorimetric Peptide Nucleic Acid Loop- Mediated Isothermal Amplification Assay for the Detection of the IDH1 Mutation in Glioblastoma
Northern Michigan University NMU Commons All NMU Master's Theses Student Works 7-2017 A Rapid Colorimetric Peptide Nucleic Acid Loop- Mediated Isothermal Amplification Assay for the Detection of the IDH1
Xpert MTB/RIF Training. Indira Soundiram 2012
Xpert MTB/RIF Training Indira Soundiram 2012 A Better Way to Platform Design GeneXpert Infinity-48 GeneXpert Module GX-I GX-II GX-IV GX-XVI 2 Defining Molecular Diagnostics Any Test Any Time Any Sample
IDENTIFICATION OF M. tuberculosis
Rev. 1 Pag. 1 di 7 Destinatari: Personale del Settore Diagnosi Microbiologica Avanzata e Settore Ricerca Micobatteri CONTENT 1. SCOPE 2. APPLICATION 3. DEFINITIONS AND ABBREVIATIONS 4. RESPONSIBILITIES
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
NEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM
Any standards not addressed here remain in effect. (changes are underlined) Sustaining Standard of Practice 8 (TB S8): Laboratories testing only Smears- Specimen Submission and Result Notification Laboratories
PCR-Based Method To Differentiate the Subspecies of the Mycobacterium tuberculosis Complex on the Basis of Genomic Deletions
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2003, p. 1637 1650 Vol. 41, No. 4 0095-1137/03/$08.00 0 DOI: 10.1128/JCM.41.4.1637 1650.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.
Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
MOLECULAR DIAGNOSTICS OF INFECTIOUS DISEASES: STABILITY OF SPECIMENS DURING PREANALYTICS
MOLECULAR DIAGNOSTICS OF INFECTIOUS DISEASES: STABILITY OF SPECIMENS DURING PREANALYTICS OVERVIEW (1) Background (2) Sample collection vials useful for different types of specimens (3) Stability of nucleic
Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
Evaluation of the Analytical Performance of the PURE-TB-LAMP Assay for Tuberculosis Detection. Authors
Evaluation of the Analytical Performance of the PURE-TB-LAMP Assay for Tuberculosis Detection Authors Yasutaka Yuki, Yasuyoshi Mori, Hidetoshi Kanda, and Tsugunori Notomi Biochemical Research Laboratory
Microscopic Morphology in Smears Prepared from MGIT Broth Medium for Rapid Presumptive Identification of Mycobacterium tuberculosis
Annals of Clinical & Laboratory Science, vol. 33, no. 2, 2003 179 Microscopic Morphology in Smears Prepared from MGIT Broth Medium for Rapid Presumptive Identification of Mycobacterium tuberculosis complex,
Product # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Nucleic Acid Amplification Testing for the Diagnosis of TB
Roche Nucleic Acid Amplification Testing for the Diagnosis of TB David Warshauer, PhD Deputy Director, Communicable Diseases Wisconsin State Laboratory of Hygiene 19 th /20 th Century Traditional Algorithm
TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
MYCOBACTERIA. Pulmonary T.B. (infect bird)
MYCOBACTERIA SPP. Reservoir Clinical Manifestation Mycobacterium tuberculosis Human Pulmonary and dissem. T.B. M. lepra Human Leprosy M. bovis Human & cattle T.B. like infection M. avium Soil, water, birds,
Role of the Laboratory in TB Diagnosis and Management
Role of the Laboratory in TB Diagnosis and Management Michael Pentella, Ph.D., D(ABMM), CIC Associate Director University Hygienic Lab Clinical Associate Professor, College of Public Health, University
Nontuberculous Mycobacteria (NTM)
Nontuberculous Mycobacteria (NTM) Bacteria, like plants and animals, have been classified into similar groups. The groups are called "families." One such family of bacteria is known as the Mycobacteriaceae.
TB NAAT testing at the Los Angeles County Public Health Laboratory
TB NAAT testing at the Los Angeles County Public Health Laboratory Hector Rivas Public Health Microbiology Supervisor II Los Angeles County Public Health Laboratory hrivas@ph.lacounty.gov April 2012 1
Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
Multi-Site Performance Summary of. AEROSPRAY TB SLIDE STAINER/CYTOCENTRIFUGE (Model 7722)
Multi-Site Performance Summary of AEROSPRAY TB SLIDE STAINER/CYTOCENTRIFUGE (Model 7722) Abstract The new Aerospray TB Slide Stainer/Cytocentrifuge - Model 7722 (ELITechGroup Inc., www.elitechgroup.com)
RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as
in the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares
Influence of Probiotics on Microflora in the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares Katie Barnhart Research Advisors: Dr. Kimberly Cole and Dr. John Mark Reddish Department of
Detect TB. Accurately. Easily.
Detect TB. Accurately. Easily. Fast and robust test results with TB-LAMP Molecular DX Smear microscopy misses nearly every second positive TB case We need new tests to rapidly diagnose people with TB;
The diagnostic value of gyrb RFLP PCR. Mycobacteria in patients with clinical. in Mazandaran
Mazandaran University of Medical Sciences The diagnostic value of gyrb RFLP PCR test t in differentiation between pathogenic Mycobacteria in patients with clinical suspicions spicions of tuberculosis in
TB Nurse Case Management Davenport, Iowa September 27 28, 2011
TB Nurse Case Management Davenport, Iowa September 27 28, 2011 Role of the Laboratory in the TB Diagnosis and Management Michael Pentella, PhD, MS, SM(ASCP), CIC, D(ABMM) September 27, 2011 Michael Pentella,
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Evaluation of the Rapid MGIT TBc Identification Test for Culture Confirmation of Mycobacterium tuberculosis Complex Strain Detection
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2011, p. 802 807 Vol. 49, No. 3 0095-1137/11/$12.00 doi:10.1128/jcm.02243-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Evaluation of
Appendix C. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)
Appendix C Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997) Since publication of the Recommendations for Counting Reported Tuberculosis Cases 1 in January 1977, numerous changes
The MycoDDR Product Line is Essential for Mycobacteria Survival and Recovery
The MycoDDR Product Line is Essential for Mycobacteria Survival and Recovery Crider, B.J., Neary, B.P., Bauman, S.K. Abstract Tuberculosis (TB) is a serious disease that affects a significant portion of
Molecular Detection of Mycobacterium bovis and Other Mycobacteria in Soil
Part 2 Molecular detection techniques and problems of quantification Molecular Detection of Mycobacterium bovis and Other Mycobacteria in Soil Pathogen reservoirs Case study 1: Detection of enteric bacteria.
Principles of laboratory diagnosis of M. tuberculosis. Anne-Marie Demers, MD, FRCPC 11 September 2017
Principles of laboratory diagnosis of M. tuberculosis Anne-Marie Demers, MD, FRCPC 11 September 2017 QUESTION Which statement is false? 1) A smear can only be on a concentrated specimen 2) It is normal
ISOTHERMAL AMPLIFICATION IN MOLECULAR DIAGNOSIS OF SLEEPING SICKNESS
Molecular Diagnostics Symposium 2014 Zurich, 27 February 2014 ISOTHERMAL AMPLIFICATION IN MOLECULAR DIAGNOSIS OF SLEEPING SICKNESS Stijn Deborggraeve Parasite Diagnostics Unit, Institute of Tropical Medicine
Detection of Marek s disease virus meq gene in Feather follicle by Loop-mediated Isothermal Amplification
IOSR Journal of Agriculture and Veterinary Science (IOSR-JAVS) e-issn: 2319-2380, p-issn: 2319-2372. Volume 7, Issue 3 Ver. I (Apr. 2014), PP 19-24 Detection of Marek s disease virus meq gene in Feather
Nucleic Acid Amplification Test for Tuberculosis. Heidi Behm, RN, MPH Acting TB Controller HIV/STD/TB Program Oregon, Department of Health Services
Nucleic Acid Amplification Test for Tuberculosis Heidi Behm, RN, MPH Acting TB Controller HIV/STD/TB Program Oregon, Department of Health Services What is this test? Nucleic Acid Amplification Test (NAAT)
2008/7/21. An Overview. National Taiwan University College of Medicine 西元前 年. 木乃伊 (Nesperhan, priest of Amun)
Rapid Diagnosis of Tuberculosis An Overview Po-Ren Hsueh National Taiwan University College of Medicine 埃及時代 西元前 3700-1000 年 土偶 木乃伊 (Nesperhan, priest of Amun) 1 Dixon B. Lancet Infect Dis 2007;7:444-5.
Receipt within 1 day of specimen collection. Report AFB b smear result within 1 day from receipt of specimen
Recommendation Promote rapid delivery of specimens to the laboratory Use fluorescent acid-fast staining and promptly transmit results by phone, FAX, or electronically Identify growth as acid-fast and use
Molecular diagnosis of infectious disease - Method validation and environmental setting 傳染病的分子診斷 - 方法確認與環境背景. WC Yam 任永昌
Molecular diagnosis of infectious disease - Method validation and environmental setting 傳染病的分子診斷 - 方法確認與環境背景 WC Yam 任永昌 Dept of Microbiology Queen Mary Hospital The University of Hong Kong Clinical and
RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer www.sysmex-europe.com RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy
Appendix B. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)
Appendix B Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997) Since publication of the Recommendations for Counting Reported Tuberculosis Cases 1 in January 1977, numerous changes
Appendix B. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)
Appendix B Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997) Since publication of the Recommendations for Counting Reported Tuberculosis Cases 1 in January 1977, numerous changes
Mycobacterial Infections: What the Primary Provider Should Know about Tuberculosis
Mycobacterial Infections: What the Primary Provider Should Know about Tuberculosis Henry F. Chambers, M.D Professor of Medicine, UCSF Topics for Discussion Epidemiology Diagnosis of active TB Screening
Kit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
Making the Diagnosis of Tuberculosis
Making the Diagnosis of Tuberculosis Alfred Lardizabal, MD NJMS Global Tuberculosis Institute Testing for TB Infection Targeted Testing: Key Points Test only if plan for ensuring treatment De-emphasizes
NEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM
Crosswalk of Proposed Revision to Standards Any standards not addressed here remain in effect. (changes are underlined) Practice 8 (TB S8): Smears Only Permit Category - Specimen Submission and Result
Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
Received 25 February 2009/Returned for modification 28 July 2009/Accepted 20 September 2009
JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2009, p. 3635 3639 Vol. 47, No. 11 0095-1137/09/$12.00 doi:10.1128/jcm.00411-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Direct Detection
M. tuberculosis as seen from M. avium.
M. tuberculosis as seen from M. avium Marcel A. Behr marcel.behr@mcgill.ca www.molepi.mcgill.ca Overview Classic view of M. tuberculosis Reductive genomics M. avium work Evidence for horizontal gene transfer
Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
Mycobacteriology William H. Benjamin, Jr.
Mycobacteriology William H. Benjamin, Jr. William H. Benjamin, PhD Department of Pathology UAB 1 Mycobacteria sp. Acid Fast Bacilli (AFB) Mycolic acids (C78-91) Waxes Obligate aerobes Slow growing days
Research Article Factors Associated with Missed Detection of Mycobacterium tuberculosis by Automated BACTEC MGIT 960 System
BioMed Research International Volume 2016, Article ID 5972021, 4 pages http://dx.doi.org/10.1155/2016/5972021 Research Article Factors Associated with Missed Detection of Mycobacterium tuberculosis by
Development and evaluation of user-developed protocols for bacterial respiratory pathogens leveraging the snap-load-go workflow of BD MAX TM
PAMM FOUNDATION LABORATORY FOR PATHOLOGY AND MEDICAL MICROBIOLOGY Development and evaluation of user-developed protocols for bacterial respiratory pathogens leveraging the snap-load-go workflow of BD MAX
imedpub Journals
Research Article imedpub Journals www.imedpub.com DOI: 10.21767/2386-5180.100267 Rapid Identification of Mycobacterium Species in Human Formalin-Fixed Paraffin Embedded Tissues by REBA Myco-ID Assay Using
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
TB 101 Disease, Clinical Assessment and Lab Testing
TB 101 Disease, Clinical Assessment and Lab Testing Pacific Islands Tuberculosis Controllers Association Conference (PITCA) Clinical Laboratory Breakout None Disclosure Objectives Be able to list and explain
WSLH Testing and Surveillance Updates
WSLH Testing and Surveillance Updates Wisconsin Mycobacteriology Laboratory Network annual conference November 4, 2015, Madison, WI Updates Outline Collection and Transport Smear and Culture Nucleic Acid
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
To test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
Amplified Mycobacterium Tuberculosis Direct Test
Amplified Mycobacterium Tuberculosis Direct Test For In Vitro Diagnostic Use (50 Test Kit) (biomérieux ref. 39006 / Hologic Cat. No. 301001) Intended Use... 2 Warnings... 2 Precautions... 2 Summary and
A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Award Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. Rajvir Dahiya, Ph.D. CONTRACTING ORGANIZATION:
M. avium M. tuberculosis. number of vials Days
252 BJID 2001; 5 (August) Detection of Mycobacteria in the Bloodstream of Patients With Acquired Immunodeficiency Syndrome in a University Hospital in Brazil Carmen Paz Oplustil, Olavo H.M. Leite, Marilia
Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product
Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
DRUG RESISTANCE IN TUBERCULOSIS
DRUG RESISTANCE IN TUBERCULOSIS INTRODUCTION Up to 50 million people may be infected with drug-resistant resistant TB.* Hot zones of MDR-TB such as Russia, Latvia, Estonia, Argentina and the Dominican
How best to structure a laboratory network with new technologies
How best to structure a laboratory network with new technologies Cristina Gutierrez, MD, PhD Uniting to scale up TB care in Central Asia 14 and 15 April 2011 Tashkent, Uzbekistan New laboratory diagnostics
ExiPrep TM Dx Fully Automated Nucleic Acid Extraction
20150629 Ver.1(EN) ExiPrep TM Dx Fully Automated Nucleic Acid Extraction 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: +82-42-930-8777 Fax: +82-42-930-8688 E-mail: sales@bioneer.com
Retrospective Study of Porcine Circovirus Type 2a and 2b Between 1999 and 2016 in Taiwan
Animal and Veterinary Sciences 2017; 5(6): 126-130 http://www.sciencepublishinggroup.com/j/avs doi: 10.11648/j.avs.20170506.15 ISSN: 2328-5842 (Print); ISSN: 2328-5850 (Online) Retrospective Study of Porcine
Comparison of recoveries of Mycobacterium tuberculosis using the automated BACTEC MGIT 960 System and Lowenstein Jensen medium
Comparison of recoveries of Mycobacterium tuberculosis using the automated System and Lowenstein Jensen medium Mo. A.AL-Mazini T. Bukeet A. Abdul Kareem Coll. of Sci./ Unive Basrah Abstract We examined
NON-TUBERCULOUS MYCOBACTERIAL (NTM) INFECTIONS ISOLATED FROM BIRMINGHAM HEARTLANDS HOSPITAL: A CASE NOTES REVIEW.
NON-TUBERCULOUS MYCOBACTERIAL (NTM) INFECTIONS ISOLATED FROM BIRMINGHAM HEARTLANDS HOSPITAL: A CASE NOTES REVIEW. K. Clay 1, K. Bhatt 1, D. Burns 1, J. Evans 2, S. Gardiner 2, EG. Smith 2, P. Hawkey 2,