ORIGINAL ARTICLE GENOME-WIDE ANALYSIS OF GENETIC CHANGES IN INTESTINAL-TYPE SINONASAL ADENOCARCINOMA
|
|
- Marcus Greer
- 5 years ago
- Views:
Transcription
1 ORIGINAL ARTICLE GENOME-WIDE ANALYSIS OF GENETIC CHANGES IN INTESTINAL-TYPE SINONASAL ADENOCARCINOMA Mario A. Hermsen, PhD, 1 José Luis Llorente, MD, PhD, 1 Jhudit Pérez-Escuredo, MSc, 1 Fernando López, MSc, 1 Bauke Ylstra, PhD, 2 César Álvarez-Marcos, MD, PhD, 3 Carlos Suárez, MD, PhD 1 1 Department of Otorhinolaryngology, IUOPA, Hospital Universitario Central de Asturias, Oviedo, Asturias, Spain. mhermsen@hca.es 2 Microarray Facility, VUmc Medical Center, Amsterdam, The Netherlands 3 Department of Otorhinolaryngology, Hospital Valle del Nalón, Riaño, Asturias, Spain Accepted 18 July 2008 Published online 15 December 2008 in Wiley InterScience ( DOI: /hed Abstract: Background. Intestinal-type sinonasal adenocarcinomas are rare tumors related to professional exposure to wood dust. Little is known about the genetic changes in these tumors. Methods. Twenty-two tumors were analyzed by microarray comparative genomic hybridization (CGH). In addition, DNA ploidy was measured by flow cytometry and microsatellite instability (MSI) by multiplex PCR. Results. The most frequent gains were, in descending order, as follows: 5p15, 20q13, and 8q24. Losses occurred most frequently at 4q31-qter, 18q12-22, 8p12-pter, and 5q11-qter. MSI was not detected. Seven cases that harbored very few changes were mostly DNA diploid and had more favorable clinicopathological features, such as lack of intracranial invasion, less metastases, and longer overall survival. Conclusion. The microarray CGH results enabled to better define hotspots of chromosomal gains and losses for further investigation of genes involved in the tumorigenesis of sinonasal adenocarcinoma. In addition, the data allowed classification of a group of patients with better clinical outcome. VC 2008 Wiley Periodicals, Inc. Head Neck 31: , 2009 Keywords: ethmoid sinus; sinonasal adenocarcinoma; DNA ploidy; microarray CGH; microsatellite instability Correspondence to: M. A. Hermsen Contract grant sponsor: Fondos de Investigación Sanitaria (FIS), Spain; Contract grant numbers: CP30083, PI VC 2008 Wiley Periodicals, Inc. Intestinal-type sinonasal adenocarcinomas (ITACs) are epithelial tumors of the nasal cavities and paranasal sinuses, often related to professional exposure to wood dust. It is a rare neoplasm, representing 8% to 25% of all malignant sinonasal cancer. The incidence is less than 1 case per 100,000 inhabitants per year, 1 3 occurring predominately among men with a mean age of presentation of 60 to 65 years. 3 It is located most frequently (85%) in the ethmoid sinus and the upper part of the nasal cavity. It only exceptionally arises in the other sites of the nasal cavity (maxillary sinus in 10%), and these cases are usually not related to wood dust exposure. Local recurrence (30% to 60%) and invasion of the duramater constitute the main causes of death among patients, 4 whereas distant and lymph node metastasis are exceptional (5% to 10%). Standard therapeutic modalities include surgery followed by radiotherapy in advanced stages, sometimes with chemotherapy treatment. Five pathological types of sinonasal ITAC are distinguished as follows: papillary, colonic, solid, mucinous (alveolar goblet and signet ring), and 290 Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March 2009
2 mixed (transitional). The most frequent type is colonic (40%), followed by solid (20%), papillary (18%), and mucinous and mixed type (together 22%). 5 ITACs are not known to arise from a clearly defined precursor lesion; however, squamous metaplasia and dysplasia in the vincinity of the tumor have been described. 6 The strong relation of ITAC to exposure to wood dust makes it a disease almost exclusive to carpenters and furniture makers. Despite this clear etiology, it is still unknown by what molecular mechanism sinonasal adenocarcinomas develop. Because wood dust does not have mutagenic properties, it is hypothesized that prolonged exposure to and irritation by wood dust particles stimulate cellular turn-over by inflammatory pathways. 7 Little is known about the genetic changes in ITAC. Because of its histopathological resemblance, 8,9 most studies so far have focused on a limited number of genes and proteins known to be involved in colorectal adenocarcinoma, however, with conflicting results. K-ras mutations varied in frequency between 0% and to 15% One study reported 50%, as the same as in colorectal adenocarcinoma. 15 Mutations in p53 ranged between 18% and 57%, 12,16 and 50% of loss of heterozygosity (LOH) was detected at 17p13, the chromosomal locus of p Further attempts to find genetic alterations as described in colorectal adenocarcinoma concerned APC, b-catenin, and various mismatch repair genes gave negative results. 10,15,17 These results indicate that ITAC and colorectal adenocarcinoma have different genetic pathways of development and progression. Aiming for a genome-wide view of recurrent genetic abnormalities, comparative genomic hybridization (CGH) analysis has been performed and revealed frequent gains on chromosome arms 5p, 7q, 8q, 12p, and 20q and losses on 4, 5q, 8p, 17p, and 18q. 18,19 In this study, we analyzed 22 ITAC using a 30,000-oligonucleotide microarray CGH, a method with better resolution and sensitivity than chromosome CGH. 20 In addition, we investigated the DNA ploidy status and the possible occurrence of microsatellite instability (MSI). Our aim was to correlate the genetic results to pathological characteristics and clinical outcome. PATIENTS AND METHODS Tissue Samples. The 22 cases analyzed in this study arose in the ethmoid sinus region and were obtained from previously untreated male patients. Informed consent was obtained from all patients, and the study was approved by the ethical committee of our institute. Primary tumor samples were obtained prospectively from surgical resection specimens avoiding necrotic areas and stored in liquid nitrogen. All patients underwent radical surgery, and in all cases resection margins were free of tumor. Twenty-one patients have had occupational exposure to wood dust, with a mean of 26 years (range, 0 60 years) and 9 had tobacco and alcohol abuse. The mean age was 67 years (range, years). Three tumors were stage I, 3 stage II, 8 stage III, and 8 stage IV. No patient had metastases at the time of diagnosis. According to the World Health Organization (WHO) histological classification, 5 our series comprised 4 papillary type or PTCC-I (papillary tubular cylinder cell-i), 7 colonic (PTCC-II), 5 solid (PTCC-III), and 6 mucinous type tumors. An example of each histological type is given in Figure 1. Follow-up information was available with a median of 15 months (range, 1 163). The median survival was 16 months (range, 1 163). Thirteen patients received radiotherapy after surgery. Four patients developed metastases in the brain and 15 had local recurrence. Flow Cytometry. DNA ploidy was measured by flow cytometry as described earlier. 21 In short, fresh tissue was disaggregated mechanically, suspended in citrate-phosphate-buffered solution, and then stained with propidium iodide. Specimens were measured with the Cytoron flow cytometer (Ortho Diagnostic Systems, Raritan, NJ), and the results were analyzed according to the guidelines for implementation of clinical DNA cytometry. Microarray Comparative Genomic Hybridization. Tumor DNA as well as normal reference DNA from blood of female donors was extracted using a Qiagen extraction kit (Qiagen GmbH Hilden, Germany). Microarray CGH was performed as described previously. 22 Briefly, sample DNA and reference DNA (pooled from 10 different healthy female donors) were differently labeled by random priming. Three hundred nanograms test and 300 ng reference DNA were hybridized to a 30,000-oligonucleotide array printed on Codelink activated slides (Amersham Biosciences, Barcelona, Spain). This array contained 29,134 oligos covering 28,830 unique genes. Hybridization and washing took place for 2 nights in a specialized hybridiza- Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March
3 FIGURE 1. Photomicrographs of the 4 histopathological types of intestinal-type sinonasal adenocarcinomas (ITAC) studied in this article. Papillary type or PTCC-I. A simple papillary pattern with a thin villous stromal support covered by a layer of tall columnar cells (A). Colonic type or PTCC-II. A complex mixed tubulopapillary pattern; the papillae are covered by an intricate meshwork of tubules (B). Solid type or PTCC-III. A solid growth pattern without hardly any tubules; nuclei are highly hyperchromatic (C). Mucinous type. A diffuse pattern formed by signet ring cells and mucin lakes. Occasionally, the mucinous cells form tubular aggregates (D). tion chamber (GeneTAC/HybArray12 hybstation [Genomic Solutions/Perkin Elmer, Waltham, MA]). Images were acquired using a Microarray Scanner G2505B (Agilent Technologies, Amstelveen, The Netherlands). Analysis and data extraction were quantified by BlueFuse (BlueGnome, Cambridge, UK). The pooled female reference DNA served as an internal control of quality; because all tumors were from male patients, the chromosome X clones normally showed loss, whereas the chromosome Y clones always showed gains. Normalization of the calculated ratios was done against the mode of all ratios. Graphics were plotted using a moving average of log2 ratios of 5 neighboring clones. Gains and losses were defined as at least in 2 neighboring clones with deviations of 0.2 or more from log2 ratio High-level amplification was considered when at least 2 neighboring clones reached a log2 ratio of 1.0 or higher. Microsatellite Instability Analysis. Approximately 2 ng tumor DNA was amplified according to the manufacturer s recommendations in a multiplex PCR using a MSI analysis kit (Promega Biotech Iberica, Barcelona, Spain), consisting of primers nearly for 5 monomorphic mononucleotide markers (BAT-25, BAT-26, NR-21, NR-24, and MONO-27), buffers, and reagents. The PCR products were analyzed by capillary electrophoresis using an ABI 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK). Data analysis was done by GeneScan software (Applied Biosystems). A shift in allele size of >3 bp was scored as MSI positive. Statistical Analysis. The statistical analyses were carried out using Fisher s exact and Pearson s chisquare and Student s t test statistics using SPSS p values <.05 were considered significant. Genetic findings were tested for correlations with clinical stage, histopathological type, intracranial invasion, recurrence, metastasis, and overall survival. RESULTS Six of 22 tumors were found to be DNA diploid and 16 were DNA aneuploid (DNA index ranging from 292 Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March 2009
4 FIGURE 2. Two examples of microarray comparative genomic hybridization (CGH) results. Top: A DNA diploid, stage III, papillary type intestinal-type sinonasal adenocarcinomas (ITAC) showing only gain of whole chromosome 20, indicated by the arrow. Bottom: A DNA aneuploid, stage III, solid type ITAC tumor with alterations affecting almost all chromosomes (copy number alterations [CNA] high). Chromosomes X and Y (numbered as 23 and 24) show loss and gain, respectively, because of sex mismatch in the hybridization. Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March
5 FIGURE 3. Overview of all copy number changes as detected by microarray comparative genomic hybridization (CGH). To the right of the pictogram of each chromosome, a scale is placed expressing the number of megabasepairs (Mpb) counting from pter to qter. Copy number losses are presented as bars left to the Mbp-scale and copy number gains to the right. 1.2 to 2.3). Three DNA aneuploid tumors had 2 populations of cells with different DNA ploidy. Microarray CGH revealed DNA gains and losses in all 22 investigated tumors. DNA diploid cases showed few copy number changes when compared with DNA aneuploid cases. Figure 2 shows the genome-wide copy number changes of a diploid (papillary type) and an aneuploid (solid type) ITAC. An overview of all gains and losses observed in the 22 cases is given in Figure 3. Gains were more frequent than losses. The major recurrent gains were detected at chromosome bands 5p15 (18 cases, 82%), 20q13, and 8q24 (15 cases, 68%), 20q11 (12 cases, 55%), 8q21 (11 cases, 50%), 3q28-qter (10 cases, 45%), and 1q21-23, 7p11-21, 12p13, and 13q21 (9 cases, 41%). Frequent losses were detected at 4q31-qter (10 cases, 45%), 18q12-22 (9 cases, 41%), 8p12- pter, 5q11-qter, 10q22-23, and 17p13 (8 cases, 36%), and 16q22 and 19p13 (7 cases, 32%). Three tumors showed regions with high-level amplification at 11p11, 11q13, 11q22, 12p12, and 13q12.1. Whole arm gains or losses were infrequent and seen almost only at chromosomes 5, 8, and 20. Because of the high resolution of the genetic data, small regions of overlapping gains and losses, as well as the exact size of amplified regions, could be identified and expressed in Mbp (Table 1). Seven of 22 ITAC had very few genetic alterations. They were defined by having less than 3 copy number alterations (CNA) and termed CNA low. Five CNA low tumors were DNA diploid and 2 aneuploid. All 15 tumors with multiple abnormalities, termed CNA high, were DNA aneuploid. All 4 papillary type ITACs were CNA low. The subset of CNA low tumors showed more favorable clinicopathological features when compared with CNA high cases as follows: 0/7 versus 8/ Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March 2009
6 Table 1. Minimum regions of overlapping DNA copy number changes. Chromosome band Gains number (%) From To (Mbp) 5p /22 (82) q /22 (68) q /22 (68) q11 12/22 (55) q /22 (45) p36 9/22 (41) q /22 (41) p13.3 9/22 (41) q21 9/22 (41) p13 9/22 (41) p22 8/22 (36) q34 8/22 (36) Xq28 7/22 (32) Amps number (%) 11p11.2 1/22 (5) q13.3 1/22 (5) q22.3 1/22 (5) p12.3 1/22 (5) p12.1 1/22 (5) q12.1 1/22 (5) Losses number (%) 8p23 10/22 (45) q22 8/22 (36) q21 7/22 (32) q22 7/22 (32) p13 7/22 (32) Abbreviations: Mbp, megabasepairs; Amps, amplificaction. Note: Only regions with less than 10 Mbp are listed. Positioning of oligos is according to NCBI Build 36.1, March stage IV tumors, 0/7 versus 7/15 intracranial invasion, and 73 versus 16 months overall survival (Table 2). Finally, MSI analysis showed all ITACs, both CNA low and CNA high, to be without signs of MSI. DISCUSSION To date, few studies have been published on the genetics of ITAC, tumors that are rare and related to the professional exposure to wood dust. To our knowledge, this article is the first to apply oligonucleotide microarray CGH to obtain a detailed map of DNA copy number abnormalities. The results obtained by microarray CGH demonstrate its power to provide a genome-wide overview of DNA copy number changes and at the same time produce high resolution data that allow to zoom in into a limited number of candidates genes possibly involved in ITAC. Table 1 lists those chromosomal regions that showed a minimum region of overlap of 10 Mbp or less. The gains at 5p as detected by chromosome CGH were now refined to a small region of 5 Mbp in 5p15.3. Gains at 8q appeared to be most consistent for a 1 Mbp region in 8q24.3, harboring PTP4A3 but not cancer-related genes in 8q24 as cmyc or FAK. Interestingly, PTP4A3 (also named PRL3) overexpression has also been found in colorectal adenocarcinoma, in which it was related to distant metastasis. 23,24 Our series could not confirm this relation, probably, because of the low number of cases. Chromosome 20q showed 2 regions with recurring gains, 20q11 and 20q13.3. Both these regions have also been implicated in colorectal adenocarcinomas Recurrent losses mostly concerned large chromosomal regions or even whole chromosome arms, such as 4q, 5q, 8p, or 18q, making it difficult to discuss the possible genes implicated. Deletions of smaller regions at 10q23, 16q22, and 17p13 may point to known tumor suppressor genes, such as PTEN, Table 2. DNA ploidy and clinical differences between CNA low and CNA high ITAC. CNA low (n 5 7) CNA high (n 5 15) p value Diploid 5 1 p Aneuploid 2 14 (Fisher s exact Stage I 2 1 Compare all stages: Stage II 1 2 p (Pearson s chi-square Stage III 4 4 Compare I 1 II 1 III vs IV: Stage IVa1b 8 p 5.02 (Fisher s exact Papillary 4 p Colonic 2 5 (Pearson s Solid 5 chi-square Mucinous 1 5 Intracranial invasion No 7 8 p Yes 7 (Fisher s exact Recurrence No 3 4 p Yes 4 11 (Fisher s exact Metastasis No 6 12 p Yes 1 3 (Fisher s exact Mean overall survival 73 months 16 months p (Student s t Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March
7 E-cadherin (CDH1), or TP53, respectively. Only 1 tumor was unrelated to wood dust exposure, but did not differ in its pattern of chromosomal changes. The overall pattern of gains and losses in ITAC is not very unlike that of colorectal adenocarcinoma, a tumor with histological resemblance 8,9 ; although the gains concerning chromosomes 3, 5, and 11q13 in this series of ITAC are infrequent in colorectal adenocarcinoma Another possible similarity between ITAC and colorectal adenocarcinoma is the finding of diploid tumors with almost no DNA copy number abnormalities (CNA low cases). It may be speculated that tumor progression in these cases is propelled by MSI, as occurs in approximately 10% of colorectal adenocarcinomas that are usually DNA diploid and harbor few chromosomal abnormalities. 29,30 However, the results of the MSI analysis in this study suggest that this mechanism is not involved in ITAC, a finding that is confirmed by previously reported immunohistochemical studies. 15,17 There was no single specific chromosomal gain or loss related to clinical outcome. However, the presence of a subset of ITAC with favorable clinical behavior (ie, absence of intracranial invasion, lesser recurrence, and metastasis and longer overall survival) may be of importance in the clinic. This subset carries few CNA, which is mostly diploid and have mainly papillary and colonic histopathology (Table 2), and features that it can be easily evaluated and used for prognostication. It remains to be clarified if these tumors represent another class of ITAC with a distinct genetic pathway of tumorigenesis leading to less aggressive tumors. Acknowledgments. The authors thank Dr. Aurora Astudillo-González, Department of Pathology, Hospital Universitario Central de Asturias, for the histopathological classification and the photomicrographs. REFERENCES 1. Alessi DM, Trapp TK, Fu YS, Calcaterra TC. Nonsalivary sinonasal adenocarcinoma. Arch Otolaryngol Head Neck Surg 1998;114: Núñez F, Suárez C, Alvarez I, Losa JL, Barthe P, Fresno M. Sino-nasal adenocarcinoma: epidemiological and clinico-pathological study of 34 cases. J Otolaryngol 1993; 22: Kleinsasser O, Schroeder HG. Adenocarcinomas of the inner nose after exposure to wood dust. Morphological findings and relationships between histopathology and clinical behavior in 79 cases. Arch Otorhinolaringol 1988; 245: Suarez C, Llorente JL, Fernandez de Leon R, Cabanillas R, Suarez V, Lopez A. Anterior craniofacial resection: oncologic outcome and complications in a series of 111 cases. Acta Otorrinolaringol Esp 2004;55: Franchi A, Santucci M, Wenig B. Adenocarcinoma. In: Barnes L, Eveson JW, Reichart P, Sidransky D, editors. World Health Organization classification of tumors. Pathology and genetics of head and neck tumors. Lyon: IARC; pp Valente G, Ferrari L, Kerim S, et al. Evidence of p53 immunohistochemical overexpression in ethmoidal mucosa of woodworkers. Cancer Detect Prev 2004;28: Holmila R, Cyr D, Luce D, et al. COX-2 and p53 in human sinonasal cancer: COX-2 expression is associated with adenocarcinoma histology and wood-dust exposure. Int J Cancer 2008;122: McKinney CD, Mills SE, Franquemont DW. Sinonasal intestinal-type adenocarcinoma: immunohistochemical profile and comparison with colonic adenocarcinoma. Mod Pathol 1995;8: Mills SE, Fechner RE, Cantrell RW. Aggressive sinonasal lesion resembling normal intestinal mucosa. Am J Surg Pathol 1982;6: Wu TT, Barnes L, Bakker A, Swalsky PA, Finkelstein SD. K-ras-2 and P53 genotyping of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Mod Pathol 1996;9: Perrone F, Oggionni M, Birindelli S, et al. TP53, p14arf, p16ink4a and H-ras gene molecular analysis in intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Int J Cancer 2003;105: Yom SS, Rashid A, Rosenthal DI, et al. Genetic analysis of sinonasal adenocarcinoma phenotypes: distinct alterations of histogenetic significance. Mod Pathol 2005;18: Saber AT, Nielsen LR, Dictor M, Hagmar L, Mikoczy Z, Wallin H. K-ras mutations in sinonasal adenocarcinomas in patients occupationally exposed to wood dust or leather dust. Cancer Lett 1998;126: Pérez P, Domínguez O, González S, Triviño A, Suárez C. Ras gene mutations in ethmoid sinus adenocarcinoma: prognostic implications. Cancer 1999;86: Frattini M, Perrone F, Suardi S, et al. Phenotype-genotype correlation: challenge of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Head Neck 2006;28: Licitra L, Suardi S, Bossi P, et al. Prediction of TP53 status for primary cisplatin, fluorouracil, and leucovorin chemotherapy in ethmoid sinus intestinal-type adenocarcinoma. J Clin Oncol. 2004;22: Perez-Ordonez B, Huynh NN, Berean KW, Jordan RCK. Expression of mismatch repair proteins, b-catenin, and E-cadherin in intestinal-type sinonasal adenocarcinoma. J Clin Pathol 2005;57: Ariza M, Llorente JL, Alvarez-Marcos C, et al. Comparative genomic hybridization in primary sinonasal adenocarcinomas. Cancer 2004;100: Korinth D, Pacyna-Gengelbach M, Deutschmann N, et al. Chromosomal imbalances in wood dust-related adenocarcinomas of the inner nose and their associations with pathological parameters. J Pathol 2005;207: Ylstra B, van den Ijssel P, Carvalho B, Brakenhoff RH, Meijer GA. BAC to the future! or oligonucleotides: a perspective for micro array comparative genomic hybridization (array CGH). Nucleic Acids Res 2006;34: Hermsen M, Alonso Guervos M, Meijer G, et al. Chromosomal changes in relation to clinical outcome in larynx and pharynx squamous cell carcinoma. Cell Oncol 2005; 27: Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March 2009
8 22. van den Ijssel P, Tijssen M, Chin SF, et al. Human and mouse oligonucleotide-based array CGH. Nucleic Acids Res 2005;33:e Kato H, Semba S, Miskad UA, Seo Y, Kasuga M, Yokozaki H. High expression of PRL-3 promotes cancer cell motility and liver metastasis in human colorectal cancer: a predictive molecular marker of metachronous liver and lung metastases. Clin Cancer Res 2004;10: Saha S, Bardelli A, Buckhaults P, et al. A phosphatase associated with metastasis of colorectal cancer. Science 2000;294: Hermsen MAJA, Postma C, Baak JPA, et al. Colorectal adenoma to carcinoma progression follows multiple pathways of chromosomal instability. Gastroenterology 2002; 123: Douglas EJ, Fiegler H, Rowan A, et al. Array comparative genomic hybridization analysis of colorectal cancer cell lines and primary carcinomas. Cancer Res 2004;64: Nakao K, Mehta KR, Fridlyand J, et al. High-resolution analysis of DNA copy number alterations in colorectal cancer by array-based comparative genomic hybridization. Carcinogenesis 2004;25: Postma C, Terwischa S, Hermsen MA, van der Sijp JR, Meijer GA. Gain of chromosome 20q is an indicator of poor prognosis in colorectal cancer. Cell Oncol 2007;29: Eshleman JR, Casey G, Kochera ME, et al. Chromosome number and structure both are markedly stable in rer colorectal cancers and are not destabilized by mutation of p53. Oncogene 1998;17: Vauhkonen H, Vauhkonen M, Sajantila A, Sipponen P, Knuutila S. Characterizing genetically stable and unstable gastric cancers by microsatellites and array comparative genomic hybridization. Cancer Genet Cytogenet 2006;170: Genetic Analysis of Sinonasal Adenocarcinoma HEAD & NECK DOI /hed March
Genomic profiling of intestinal-type sinonasal adenocarcinoma reveals subgroups of patients with distinct clinical outcomes
Received: 24 January 2017 Revised: 19 July 2017 Accepted: 28 July 2017 DOI: 10.1002/hed.24941 ORIGINAL ARTICLE Genomic profiling of intestinal-type sinonasal adenocarcinoma reveals subgroups of patients
More informationGENOMIC PROFILING OF SINONASAL SQUAMOUS CELL CARCINOMA
ORIGINAL ARTICLE GENOMIC PROFILING OF SINONASAL SQUAMOUS CELL CARCINOMA Fernando López, MSc, 1 José L. Llorente, MD, PhD, 1 Cristina García-Inclán, MSc, 1 Marta Alonso-Guervós, PhD, 1 Mari Paz Cuesta-Albalad,
More informationI ntestinal-type adenocarcinomas (ITACs) of the nasal cavity
932 ORIGINAL ARTICLE Expression pattern of CK7, CK20, CDX-2, and villin in intestinal-type sinonasal adenocarcinoma M T Kennedy, R C K Jordan, K W Berean, B Perez-Ordoñez... See end of article for authors
More informationThe diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M.
UvA-DARE (Digital Academic Repository) The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. Link to publication Citation for published version (APA):
More informationClinical analysis of 29 cases of nasal mucosal malignant melanoma
1166 Clinical analysis of 29 cases of nasal mucosal malignant melanoma HUANXIN YU and GANG LIU Department of Otorhinolaryngology Head and Neck Surgery, Tianjin Huanhu Hospital, Tianjin 300060, P.R. China
More informationADENOCARCINOMA OF THE NOSE AND PARANASAL SINUSES: A RETROSPECTIVE STUDY OF DIAGNOSIS, HISTOLOGIC CHARACTERISTICS, AND OUTCOMES IN 24 PATIENTS
ADENOCARCINOMA OF THE NOSE AND PARANASAL SINUSES: A RETROSPECTIVE STUDY OF DIAGNOSIS, HISTOLOGIC CHARACTERISTICS, AND OUTCOMES IN 24 PATIENTS Laura J. Orvidas, MD, 1 Jean E. Lewis, MD, 2 Amy L. Weaver,
More informationMicrosatellite Instability and Mismatch Repair Protein (hmlh1, hmsh2) Expression in Intrahepatic Cholangiocarcinoma
The Korean Journal of Pathology 2005; 39: 9-14 Microsatellite Instability and Mismatch Repair Protein (hmlh1, hmsh2) Expression in Intrahepatic Cholangiocarcinoma Yun Kyung Kang Woo Ho Kim 1 Department
More informationClonal evolution of human cancers
Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio
More informationMolecular markers in colorectal cancer. Wolfram Jochum
Molecular markers in colorectal cancer Wolfram Jochum Biomarkers in cancer Patient characteristics Tumor tissue Normal cells Serum Body fluids Predisposition Diagnostic marker Specific diagnosis Prognostic
More informationClinical Study Mucosal Melanoma in the Head and Neck Region: Different Clinical Features and Same Outcome to Cutaneous Melanoma
ISRN Dermatology Volume 2013, Article ID 586915, 5 pages http://dx.doi.org/10.1155/2013/586915 Clinical Study Mucosal Melanoma in the Head and Neck Region: Different Clinical Features and Same Outcome
More informationColorectal cancer Chapelle, J Clin Oncol, 2010
Colorectal cancer Chapelle, J Clin Oncol, 2010 Early-Stage Colorectal cancer: Microsatellite instability, multigene assay & emerging molecular strategy Asit Paul, MD, PhD 11/24/15 Mr. X: A 50 yo asymptomatic
More informationGENETIC PROFILE OF SECOND PRIMARY TUMORS AND RECURRENCES IN HEAD AND NECK SQUAMOUS CELL CARCINOMAS
ORIGINAL ARTICLE GENETIC PROFILE OF SECOND PRIMARY TUMORS AND RECURRENCES IN HEAD AND NECK SQUAMOUS CELL CARCINOMAS Virginia Franco Gutiérrez, PhD, MD, 1,2 César Álvarez Marcos, PhD, MD, 1,2 José Luis
More informationDetection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell lung Cancer (NSCLC) By CISH Technique
Cancer and Clinical Oncology; Vol. 7, No. 1; 2018 ISSN 1927-4858 E-ISSN 1927-4866 Published by Canadian Center of Science and Education Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell
More informationp53 expression in invasive pancreatic adenocarcinoma and precursor lesions
Malaysian J Pathol 2011; 33(2) : 89 94 ORIGINAL ARTICLE p53 expression in invasive pancreatic adenocarcinoma and precursor lesions NORFADZILAH MY MBBCH,* Jayalakshmi PAILOOR MPath, FRCPath,* RETNESWARI
More informationCOLORECTAL PATHWAY GROUP, MANCHESTER CANCER. Guidelines for the assessment of mismatch. Colorectal Cancer
COLORECTAL PATHWAY GROUP, MANCHESTER CANCER Guidelines for the assessment of mismatch repair (MMR) status in Colorectal Cancer March 2017 1 Background Mismatch repair (MMR) deficiency is seen in approximately
More informationColorectal adenocarcinoma leading cancer in developed countries In US, annual deaths due to colorectal adenocarcinoma 57,000.
Colonic Neoplasia Remotti Colorectal adenocarcinoma leading cancer in developed countries In US, annual incidence of colorectal adenocarcinoma 150,000. In US, annual deaths due to colorectal adenocarcinoma
More informationSEROUS TUMORS. Dr. Jaime Prat. Hospital de la Santa Creu i Sant Pau. Universitat Autònoma de Barcelona
SEROUS TUMORS Dr. Jaime Prat Hospital de la Santa Creu i Sant Pau Universitat Autònoma de Barcelona Serous Borderline Tumors (SBTs) Somatic genetics Clonality studies have attempted to dilucidate whether
More informationI n day to day routine work, pathologists are faced with cases
522 ORIGINAL ARTICLE Comparative genomic hybridisation as a supportive tool in diagnostic pathology M M Weiss, E J Kuipers, SGMMeuwissen, P J van Diest, G A Meijer... See end of article for authors affiliations...
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationResearch Article Trail Overexpression Inversely Correlates with Histological Differentiation in Intestinal-Type Sinonasal Adenocarcinoma
International Surgical Oncology Volume 2013, Article ID 203873, 6 pages http://dx.doi.org/10.1155/2013/203873 Research Article Trail Overexpression Inversely Correlates with Histological Differentiation
More informationCOLORECTAL PATHWAY GROUP, MANCHESTER CANCER. Guidelines for the assessment of mismatch. Colorectal Cancer
COLORECTAL PATHWAY GROUP, MANCHESTER CANCER Guidelines for the assessment of mismatch repair (MMR) status in Colorectal Cancer January 2015 1 Background Mismatch repair (MMR) deficiency is seen in approximately
More informationHigh risk stage II colon cancer
High risk stage II colon cancer Joel Gingerich, MD, FRCPC Assistant Professor Medical Oncologist University of Manitoba CancerCare Manitoba Disclaimer No conflict of interests 16 October 2010 Overview
More informationMuco-epidermoid tumours of the anal canal
J. clin. Path. (1963), 16, 200 Muco-epidermoid tumours of the anal canal B. C. MORSON AND H. VOLKSTADT From the Research Department, St. Mark's Hospital, London SYNOPSIS The pathology of 21 cases of muco-epidermoid
More informationBasement membrane in lobule.
Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.
More informationFINALIZED SEER SINQ QUESTIONS
0076 Source 1: WHO Class CNS Tumors pgs: 33 MP/H Rules/Histology--Brain and CNS: What is the histology code for a tumor originating in the cerebellum and extending into the fourth ventricle described as
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationSerrated Polyps and a Classification of Colorectal Cancer
Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram
More informationPancreatic Cytopathology: The Solid Neoplasms
Pancreatic Cytopathology: The Solid Neoplasms Syed Z. Ali, M.D. Professor of Pathology and Radiology Director of Cytopathology The Johns Hopkins Hospital Baltimore, Maryland Pancreatic Cytopathology: Past,
More informationHistological Type. Morphological and Molecular Typing of breast Cancer. Nottingham Tenovus Primary Breast Cancer Study. Survival (%) Ian Ellis
Morphological and Molecular Typing of breast Cancer Ian Ellis Molecular Medical Sciences, University of Nottingham Department of Histopathology, Nottingham University Hospitals NHS Trust Histological Type
More informationTest Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download: http://testbankair.com/download/test-bank-for-robbins-cotran-pathologic-basis-of-disease-9th-edition-bykumar-abbas-and-aster Test Bank for Robbins and Cotran Pathologic Basis of Disease
More informationPeritoneal Involvement in Stage II Colon Cancer
Anatomic Pathology / PERITONEAL INVOLVEMENT IN STAGE II COLON CANCER Peritoneal Involvement in Stage II Colon Cancer A.M. Lennon, MB, MRCPI, H.E. Mulcahy, MD, MRCPI, J.M.P. Hyland, MCh, FRCS, FRCSI, C.
More informationDeletions of N33, STK11 and TP53 are involved in the development of lymph node metastasis in larynx and pharynx carcinomas
Cellular Oncology 29 (2007) 327 334 327 IOS Press Deletions of N33, STK11 and TP53 are involved in the development of lymph node metastasis in larynx and pharynx carcinomas Marta Alonso Guervós a,, César
More informationCitation for published version (APA): Bleeker, W. A. (2001). Therapeutic considerations in Dukes C colon cancer s.n.
University of Groningen Therapeutic considerations in Dukes C colon cancer Bleeker, Willem Aldert IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationInvited Re vie W. Molecular genetics of ovarian carcinomas. Histology and Histo pathology
Histol Histopathol (1 999) 14: 269-277 http://www.ehu.es/histol-histopathol Histology and Histo pathology Invited Re vie W Molecular genetics of ovarian carcinomas J. Diebold Pathological Institute, Ludwig-Maximilians-University
More informationQIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
More informationClinicopathological and prognostic differences between mucinous gastric carcinoma and signet-ring cell carcinoma
Original Article Clinicopathological and prognostic differences between mucinous gastric carcinoma and signet-ring cell carcinoma Zhaode Bu, Zhixue Zheng, Ziyu Li, Xiaojiang Wu, Lianhai Zhang, Aiwen Wu,
More informationPSA. HMCK, p63, Racemase. HMCK, p63, Racemase
Case 1 67 year old male presented with gross hematuria H/o acute prostatitis & BPH Urethroscopy: small, polypoid growth with a broad base emanating from the left side of the verumontanum Serum PSA :7 ng/ml
More informationThe molecular genetics of endometrial cancer
The molecular genetics of endometrial cancer Lora Hedrick Ellenson, M.D. Department of Pathology and Laboratory Medicine Weill Medical College of Cornell University Introduction Classification of endometrial
More informationTest Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download:https://getbooksolutions.com/download/test-bank-for-robbinsand-cotran-pathologic-basis-of-disease-9th-edition-by-kumar Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th
More informationInternational Society of Gynecological Pathologists Symposium 2007
International Society of Gynecological Pathologists Symposium 2007 Anais Malpica, M.D. Department of Pathology The University of Texas M.D. Anderson Cancer Center Grading of Ovarian Cancer Histologic grade
More informationCarcinoma mammario: le istologie non frequenti. Valentina Guarneri Università di Padova IOV-IRCCS
Carcinoma mammario: le istologie non frequenti Valentina Guarneri Università di Padova IOV-IRCCS Histological diversity of breast adenocarcinomas Different histological types are defined according to specific
More informationOral Cavity. 1. Introduction. 1.1 General Information and Aetiology. 1.2 Diagnosis and Treatment
Oral Cavity 1. Introduction 1.1 General Information and Aetiology The oral cavity extends from the lips to the palatoglossal folds and consists of the anterior two thirds of the tongue, floor of the mouth,
More informationHuman Papillomavirus and Head and Neck Cancer. Ed Stelow, MD
Human Papillomavirus and Head and Neck Cancer Ed Stelow, MD No conflict of interest Declaration Cancer 1974 Lancet Oncol 2016; 17: e477-8 JAMA 1984; 252: 1857 JAMA 1988;259(13):1943-1944 Clin Cancer Res
More informationالطلاوة = Leukoplakia LEUKOPLAKIA
LEUKOPLAKIA Leukoplakia is a clinical term that refers to a predominantly white lesion of the oral mucosa that cannot be rubbed off or characterized by any other definable lesion or known disease. 130
More informationRare Presentation Of Adenoidcystic Carcinoma Of External Auditory Canal With Subcutaneous Metastasis In Temporal Region
ISPUB.COM The Internet Journal of Otorhinolaryngology Volume 13 Number 2 Rare Presentation Of Adenoidcystic Carcinoma Of External Auditory Canal With Subcutaneous Metastasis In Temporal Region S Kaushik,
More informationSarcomatoid (spindle cell) carcinoma of the cricopharynx presenting as dysphagia
Case Report Sarcomatoid (spindle cell) carcinoma of the cricopharynx presenting as dysphagia Jagtap Sunil V. 1, Shukla Dhirajkumar B. 2, Jagtap Swati S. 3, Havle Abhay D. 4 1 Associate Professor, Department
More informationSignet-Ring Cell Carcinoma of the Colon: A Case Report and Review of the Literature
Published online: November 4, 2015 2015 The Author(s) Published by S. Karger AG, Basel 1662 6575/15/0083 0466$39.50/0 This article is licensed under the Creative Commons Attribution-NonCommercial 4.0 International
More informationA916: rectum: adenocarcinoma
General facts of colorectal cancer The colon has cecum, ascending, transverse, descending and sigmoid colon sections. Cancer can start in any of the r sections or in the rectum. The wall of each of these
More informationEpithelial tumors. Dr. F.F. Khuzin, PhD Dr. M.O. Mavlikeev
Epithelial tumors Dr. F.F. Khuzin, PhD Dr. M.O. Mavlikeev Epithelial tumors Tumors from the epithelium are the most frequent among tumors. There are 2 group features of these tumors: The presence in most
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationGuidelines for the assessment of mismatch repair (MMR) status in Colorectal Cancer
Guidelines for the assessment of mismatch repair (MMR) status in Colorectal Cancer Start date: May 2015 Review date: April 2018 1 Background Mismatch repair (MMR) deficiency is seen in approximately 15%
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationp53 Expression Immuno-histochemistry Index in Stage III Giant Cell Tumor of the Bone
IBIMA Publishing JMED Research http://www.ibimapublishing.com/journals/jmed/jmed.html Vol. 2014 (2014), Article ID 675393, 7 pages DOI: 10.5171/2014.675393 Research Article p53 Expression Immuno-histochemistry
More informationMucinous Adenocarcinoma of the Stomach Clinicopathological
THE KURUME MEDICAL JOURNAL Vo1. 43, p. 289-294, 1996 ORIGINAL ARTICLE Mucinous Adenocarcinoma of the Stomach Clinicopathological Studies KIKUO KOUFUJI, JINRYO TAKEDA, ATSUSHI TOYONAGA, ISSEI KODAMA, KEISHIRO
More informationcolorectal cancer Colorectal cancer hereditary sporadic Familial 1/12/2018
colorectal cancer Adenocarcinoma of the colon and rectum is the third most common site of new cancer cases and deaths in men (following prostate and lung or bronchus cancer) and women (following breast
More informationCharacterization of the 11q13.3 amplicon in head and neck squamous cell carcinoma Gibcus, Johan Harmen
University of Groningen Characterization of the 11q13.3 amplicon in head and neck squamous cell carcinoma Gibcus, Johan Harmen IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's
More informationMolecular Testing Updates. Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine
Molecular Testing Updates Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine Keeping Up with Predictive Molecular Testing in Oncology: Technical
More informationDOCTORAL THESIS SUMMARY
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA DOCTORAL THESIS HISTOPATHOLOGICAL AND IMMUNOHISTOCHEMICAL STUDY OF GASTRIC CARCINOMAS SUMMARY Scientific Coordinator: Univ. Prof. Dr. SIMIONESCU CRISTIANA EUGENIA
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationUSCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest
USCAP 2012: Companion Meeting of the AAOOP Vancouver BC, Canada, March 17, 2012 Update on lacrimal gland neoplasms: Molecular pathology of interest Valerie A. White MD, MHSc, FRCPC Department of Pathology
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationHypopharynx. 1. Introduction. 1.1 General Information and Aetiology
Hypopharynx 1. Introduction 1.1 General Information and Aetiology The human pharynx is the part of the throat situated between the nasal cavity and the esophagus and can be divided into three parts: the
More informationCHAPTER 2. Cancer Res Nov 15; 65(22):
RELIABLE HIGH-THROUPHGPUT GENOTYPING AND LOSS OF HETEROZYGOSITY DETECTION IN FORMALIN- FIXED, PARAFFIN-EMBEDDED TUMORS USING SINGLE NUCLEOTIDE POLYMORPHISM ARRAYS CHAPTER 2 Reliable high-throughput genotyping
More informationMultiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer
Multiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer A Kuijper SS Preisler-Adams FD Rahusen JJP Gille E van der Wall PJ van Diest J Clin Pathol
More informationMolecular Subtyping of Endometrial Cancer: A ProMisE ing Change
Molecular Subtyping of Endometrial Cancer: A ProMisE ing Change Charles Matthew Quick, M.D. Associate Professor of Pathology Director of Gynecologic Pathology University of Arkansas for Medical Sciences
More informationThe Pathology of Neoplasia Part II
The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology
More informationFigure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing
Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align
More informationMorphologic Criteria of Invasive Colonic Adenocarcinoma on Biopsy Specimens
ISPUB.COM The Internet Journal of Pathology Volume 12 Number 1 Morphologic Criteria of Invasive Colonic Adenocarcinoma on Biopsy Specimens C Rose, H Wu Citation C Rose, H Wu.. The Internet Journal of Pathology.
More informationNasal mucosal melanosis may act as a harbinger of melanoma: A case report
Nasal mucosal melanosis may act as a harbinger of melanoma: A case report The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation
More informationGOBLET CELL CARCINOID. Hanlin L. Wang, MD, PhD University of California Los Angeles
GOBLET CELL CARCINOID Hanlin L. Wang, MD, PhD University of California Los Angeles Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to
More informationGOBLET CELL CARCINOID
GOBLET CELL CARCINOID Hanlin L. Wang, MD, PhD University of California Los Angeles Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to
More informationDetermination of Genomic Imbalances by Genome-wide Screening Approaches
Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome
More informationSalivary duct carcinoma: A clinopathological report of 11 cases
ONCOLOGY LETTERS 10: 337-341, 2015 Salivary duct carcinoma: A clinopathological report of 11 cases XIAOFENG HUANG 1, JING HAO 2, SHENG CHEN 1 and RUNZHI DENG 3 1 Department of Pathology, 2 Central Laboratory,
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationJoseph Misdraji, M.D. GI pathology Unit Massachusetts General Hospital
Joseph Misdraji, M.D. GI pathology Unit Massachusetts General Hospital jmisdraji@partners.org Low-grade appendiceal mucinous neoplasm (LAMN) High-grade appendiceal mucinous neoplasm (HAMN) Adenocarcinoma
More informationUniversity Journal of Pre and Para Clinical Sciences
ISSN 2455 2879 Volume 2 Issue 1 2016 Metaplastic carcinoma breast a rare case report Abstract : Metaplastic carcinoma of the breast is a rare malignancy with two distinct cell lines described as a breast
More informationGastric Adenocarcinoma: Study of the Immunophenotypic Profile in View of the Latest Molecular Knowledge on Carcinogenesis
Human Journals Research Article March 2018 Vol.:11, Issue:4 All rights are reserved by Stefania Erra et al. Gastric Adenocarcinoma: Study of the Immunophenotypic Profile in View of the Latest Molecular
More informationATLAS OF HEAD AND NECK PATHOLOGY METAPLASIA
Metaplasia is the conversion of one adult differentiated cell type to another. Generally it is the result of persistent cellular trauma and serves as a protective mechanism. Thus anteriorly along the nasal
More informationColonic Polyp. Najmeh Aletaha. MD
Colonic Polyp Najmeh Aletaha. MD 1 Polyps & classification 2 Colorectal cancer risk factors 3 Pathogenesis 4 Surveillance polyp of the colon refers to a protuberance into the lumen above the surrounding
More informationDisclosure. Relevant Financial Relationship(s) None. Off Label Usage None MFMER slide-1
Disclosure Relevant Financial Relationship(s) None Off Label Usage None 2013 MFMER slide-1 Case Presentation A 43 year old male, with partial nephrectomy for a right kidney mass 2013 MFMER slide-2 2013
More informationA CONTRIBUTION TO THE ETIOPATHOGENESIS, DIAGNOSIS AND MANAGEMENT OF SINONASAL INVERTED PAPILLOMAS
UNIVERSITY OF MEDICINE AND PHARMACY OF TÂRGU MUREȘ ROMANIA A CONTRIBUTION TO THE ETIOPATHOGENESIS, DIAGNOSIS AND MANAGEMENT OF SINONASAL INVERTED PAPILLOMAS PhD THESIS ABSTRACT PhD Student Viorel Emanoil
More informationTriple Negative Breast Cancer
Triple Negative Breast Cancer Prof. Dr. Pornchai O-charoenrat Division of Head-Neck & Breast Surgery Department of Surgery Faculty of Medicine Siriraj Hospital Breast Cancer Classification Traditional
More informationLarge Colorectal Adenomas An Approach to Pathologic Evaluation
Anatomic Pathology / LARGE COLORECTAL ADENOMAS AND PATHOLOGIC EVALUATION Large Colorectal Adenomas An Approach to Pathologic Evaluation Elizabeth D. Euscher, MD, 1 Theodore H. Niemann, MD, 1 Joel G. Lucas,
More informationComparative genomic hybridization of primary skeletal Ewing's sarcoma
Turkish Journal of Cancer Vol.31/ No. 1/2001 Comparative genomic hybridization of primary skeletal Ewing's sarcoma İBRAHİM KESER 1, ELISABETH BURCKHARDT 2, NURDAN TUNALI 3, MUALLA ALKAN 2 1 Department
More informationDr Rodney Itaki Lecturer Anatomical Pathology Discipline. University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology
Neoplasia Dr Rodney Itaki Lecturer Anatomical Pathology Discipline University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology General Considerations Overview: Neoplasia uncontrolled,
More informationDisclosures. Outline. What IS tumor budding?? Tumor Budding in Colorectal Carcinoma: What, Why, and How. I have nothing to disclose
Tumor Budding in Colorectal Carcinoma: What, Why, and How Disclosures I have nothing to disclose Soo-Jin Cho, MD, PhD Assistant Professor UCSF Dept of Pathology Current Issues in Anatomic Pathology 2017
More informationAssessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,
More informationTime series analysis of TP53 gene mutations in recurrent HPV-negative vulvar squamous cell carcinoma
Time series analysis of TP53 gene mutations in recurrent HPV-negative vulvar squamous cell carcinoma Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz Disclosures Member of Clinical
More informationCase Report Aggressive invasive micropapillary salivary duct carcinoma of the parotid gland
Pathology International 2008; 58: 322 326 doi:10.1111/j.1440-1827.2008.02231.x Case Report Aggressive invasive micropapillary salivary duct carcinoma of the parotid gland Hidetaka Yamamoto, 1 Hideoki Uryu,
More informationSerotonin- and Somatostatin-Positive Goblet Cell Carcinoid of the Duodenum
2012 66 4 351 356 Serotonin- and Somatostatin-Positive Goblet Cell Carcinoid of the Duodenum a b* c c c a a b d a c b d 352 Ohara et al. received remedies at another hospital. Hematemesis then recurred
More informationPresentation material is for education purposes only. All rights reserved URMC Radiology Page 1 of 98
Presentation material is for education purposes only. All rights reserved. 2011 URMC Radiology Page 1 of 98 Radiology / Pathology Conference February 2011 Brooke Koltz, Cytopathology Resident Presentation
More informationHead and Neck Squamous Subtypes
1 Head and Neck Squamous Subtypes Adel K. El-Naggar, M.D., Ph.D. The University of Texas MD Anderson Cancer Center, Houston, Texas HNSCC 5 th -6 th most common cancer 400,000/year 50% mortality Considerable
More informationPapillary Carcinomas of the Gallbladder. Analysis of Noninvasive and Invasive Types
Papillary Carcinomas of the Gallbladder Analysis of Noninvasive and Invasive Types Jorge Albores-Saavedra, MD; Matthew Tuck, BS; Bernadette K. McLaren, MD; Kelley S. Carrick, MD; Donald Earl Henson, MD
More informationImplications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers
日大医誌 75 (1): 10 15 (2016) 10 Original Article Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers Naotaka Uchida 1), Yasuki Matsui 1), Takeshi Notsu 1) and Manabu
More informationMDJ The Role of K-Ras and PI3Kcb Expression in Oral Vol.:10 No.:2 2013
MDJ The Role of K-Ras and PI3Kcb Expression in Oral Squamous Cell Carcinoma Dr. Asseel Mohammed ghazi. B.D.S Dr.Muna S. Merza. B.D.S, M.Sc. Ph.D Abstract Background: Oral squamous cell carcinoma is an
More informationSino-nasal Cancer in Denmark 1982 ± 1991
ORIGINAL ARTICLE Sino-nasal Cancer in Denmark 1982 ± 1991 A Nationwide Sur ey Cai Grau, Mikkel Holmelund Jakobsen, Grethe Harbo, Viggo Svane-Knudsen, Kim Wedervang, Susanne Kornum Larsen and Carsten Rytter
More informationReporting HPV related carcinomas of the head and neck. dr. Nina Zidar Institute of Pathology Faculty of Medicine University of Ljubljana Slovenia
Reporting HPV related carcinomas of the head and neck dr. Nina Zidar Institute of Pathology Faculty of Medicine University of Ljubljana Slovenia Conflict of interest/funding X None Company: Product royalties
More informationCharacterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma
Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department
More informationNasal and paranasal sinus carcinoma: are we making progress? A series of 220 patients and a systematic review. DULGUEROV, Pavel, et al.
Article Nasal and paranasal sinus carcinoma: are we making progress? A series of 220 patients and a systematic review DULGUEROV, Pavel, et al. Abstract The authors reviewed treatment results in patients
More information