Fig S2 Efficiencies of primers used in the taxon-specific qpcr assay. CT: threshold value (A) Universal: 907F R efficiency: 99.
|
|
- Suzanna Miller
- 5 years ago
- Views:
Transcription
1
2 Fig S2 Efficiencies of primers used in the taxon-specific qpcr assay. CT: threshold value (A) Universal: 907F R efficiency: 99.1% (B) Bacteroidetes: Bac960F+Bac1100R efficiency: 98.5% (C) Firmicutes: Firm934F+Firm1060R efficiency: 94.6% (D) Tenericutes: Ten662F+Ten862R efficiency: 96.5% (E) Deferribacteres: Defer1115F+Defer1265R efficiency: 92.6% (F) : Sac1031F+Sac1218R efficiency: 94.6% (G) -Proteobacteria: Beta979F+Beta1130R efficiency: 94.2% (H) -Proteobacteria: Gamma877F+Gamma1066R efficiency: 96.1% (I) -Proteobacteria:Epslion940F+Epsloin1129R efficiency: 92.1%
3 Fig S3 Specificity of each primer pairs analyzed by QPCR with target and non-target 16S rrna s as templates. a, target 16S rrna (5ng); b, non-target 16S rrna 1 (5ng); c, non-target 16S rrna 2 (5ng) 2; d, non-target 16S rrna 3 (5ng); e, ddh2o as template. (A)Primer pair: Sac1031F/Sac1218R. (B)Primer pair: Ten662F/Ten862R. (C)Primer pair: Epslion940F/Epsloin1129R. (D)Primer pair: Gamma877F/Gamma1066R. (E)Primer pair: Firm934F/Firm1060R. (F)Primer pair: Defer1115F/Defer1265R. (G)Primer pair: Beta979F/Beta1130R. (H)Primer pair: Bac960F/Bac1100R. (I)Primer pair: Act664F/Act941R. (J)Primer pair: Ver1165F/Ver1263R. It must be emphasized that each primer pair with least mismatches to the of the non-targets from Fig S3.
4 Table S1. Taxa dominating the bacterial microbiota of the mouse feces Phylum Class Family Genus Actinobacteria Actinobacteria Bifidobacteriales Bifidobacterium Actinobacteria Actinobacteria Coriobacteriaceae Asaccharobacter Actinobacteria Actinobacteria Coriobacteriaceae Enterorhabdus Actinobacteria Actinobacteria Coriobacteriaceae Olsenella Bacteroidetes Bacteroidia Porphyromonadaceae Barnesiella Bacteroidetes Bacteroidia Porphyromonadaceae Odoribacter Bacteroidetes Bacteroidia Porphyromonadaceae Parabacteroides Bacteroidetes Bacteroidia Prevotellaceae Paraprevotella Bacteroidetes Bacteroidia Prevotellaceae Prevotella Bacteroidetes Bacteroidia Rikenellaceae Alistipes Bacteroidetes Bacteroidia Bacteroidaceae Bacteroides Deferribacteres Deferribacteres Deferribacteraceae Mucispirillum Proteobacteria Betaproteobacteria Sutterellaceae Parasutterella Proteobacteria Betaproteobacteria Neisseriaceae Neisseria Proteobacteria Deltaproteobacteria Bdellovibrionaceae Vampirovibrio Proteobacteria Deltaproteobacteria Desulfovibrionaceae Desulfovibrio Proteobacteria Epsilonproteobacteria Helicobacteraceae Helicobacter Proteobacteria Gammaproteobacteria Enterobacteriaceae Klebsiella Proteobacteria Gammaproteobacteria Pasteurellaceae Haemophilus Tenericutes Mollicutes Anaeroplasmataceae Anaeroplasma Tenericutes Mollicutes Mycoplasmataceae Mycoplasma Tenericutes Mollicutes Mycoplasmataceae Ureaplasma Verrucomicrobia Verrucomicrobiae Verrucomicrobiaceae Akkermansia Firmicutes Bacilli Lactobacillaceae Lactobacillus Firmicutes Clostridia Lachnospiraceae Clostridium_XlVa Firmicutes Clostridia Lachnospiraceae Clostridium_XlVb Firmicutes Clostridia Lachnospiraceae Lachnospiracea Firmicutes Clostridia Ruminococcaceae Butyricicoccus Firmicutes Clostridia Ruminococcaceae Flavonifractor Firmicutes Clostridia Ruminococcaceae Oscillibacter Firmicutes Erysipelotrichia Erysipelotrichaceae Allobaculum Firmicutes Erysipelotrichia Erysipelotrichaceae Turicibacter _class_incertae_sedis _family_incertae_sedis _genera_incertae_sedis
5 Table S2. NCBI BLAST search results and Ribosomal Database Project-II (RDP-II) database classification of 38 clones Clone NCBI Sequence Name Match Description Clone 1 Papyrosolvens strain DSM S ribosomal RNA gene, partial Clone 2 Straminisolvens strain CSK1 16S ribosomal RNA gene, partial Clone 3 Cavendishii strain BL-28 16S ribosomal RNA gene, partial Clone 4 Parasutterella excrementihominis strain YIT S ribosomal RNA gene, Clone 5 Sutterella parvirubra strain YIT S ribosomal RNA gene, Clone 6 Parasutterella secunda strain JCM S ribosomal RNA gene, Clone 7 Mucispirillum schaedleri strain HRI I17 16S ribosomal RNA gene, Clone 8 Calditerrivibrio nitroreducens strain Yu S ribosomal RNA gene, Clone 9 Calditerrivibrio nitroreducens strain DSM S ribosomal RNA gene, complete Clone 10 Desulfovibrio desulfuricans strain Essex 6 16S ribosomal RNA gene, complete Clone 11 Desulfovibrio desulfuricans 16S ribosomal RNA, complete Clone 12 Desulfovibrio vulgaris strain DSM S ribosomal RNA gene, Clone 13 Helicobacter aurati strain MIT c 16S ribosomal RNA gene, GenBank Max Identity Bacterial group Accession Numbers 88% Firmicutes KP % Firmicutes KP % Firmicutes KP % Betaproteobacteria KP % Betaproteobacteria KP % Betaproteobacteria KP % Deferribacteres KP % Deferribacteres KP % Deferribacteres KP % Deltaproteobacteria KP % Deltaproteobacteria KP % Deltaproteobacteria KP % Epsilonproteobacteria KP713730
6 Clone 14 Clone 15 Clone 16 Clone 17 Clone 18 Clone 19 Clone 20 Clone 21 Clone 22 Clone 23 Clone 24 Clone 25 Clone 26 Clone 27 Clone 28 Helicobacter cinaedi PAGU611 strain PAGU611 16S ribosomal RNA, complete Helicobacter muridarum strain ST1 16S ribosomal RNA gene, Anaeroplasma abactoclasticum strain S ribosomal RNA gene, Anaeroplasma varium strain A2-T 16S ribosomal RNA gene, Glaciimonas immobilis strain Cr S ribosomal RNA gene, Parasutterella secunda strain JCM S ribosomal RNA gene, Glaciimonas immobilis strain Cr S ribosomal RNA gene, Akkermansia muciniphila strain ATCC BAA S ribosomal RNA gene, complete Akkermansia muciniphila strain Muc 16S ribosomal RNA gene, complete Cavendishii strain BL-28 16S ribosomal RNA gene, partial Sporosalibacterium faouarense strain SOL3F37 16S ribosomal RNA gene, Mogibacterium neglectum strain P9a-h 16S ribosomal RNA gene, Bifidobacterium pseudolongum strain PNC-2-9G 16S ribosomal RNA gene, Olsenella profusa strain DSM S ribosomal RNA gene, Saccharolyticum strain WM1 16S ribosomal RNA gene, complete 97% Epsilonproteobacteria KP % Epsilonproteobacteria KP % Tenericutes KP % Tenericutes KP % Betaproteobacteria KP % Betaproteobacteria KP % Betaproteobacteria KP % Verrucomicrobia KP % Verrucomicrobia KP % Firmicutes KP % 79% KP KP % Actinobacteria KP % Actinobacteria KP % Firmicutes KP713745
7 Clone 29 Clone 30 Clone 31 Clone 32 Clone 33 Clone 34 Clone 35 Clone 36 Clone 37 Clone 38 Barnesiella viscericola 16S ribosomal RNA, complete Helicobacter aurati strain MIT c 16S ribosomal RNA gene, Clostridium formicaceticum strain DSM 92 16S ribosomal RNA gene, Christensenella minuta strain YIT S ribosomal RNA gene, Coprobacter fastidiosus strain NSB1 16S ribosomal RNA gene, Alistipes senegalensis strain JC50 16S ribosomal RNA gene, partial Paraprevotella xylaniphila strain JCM S ribosomal RNA gene, Anaeroplasma abactoclasticum strain S ribosomal RNA gene, Helicobacter equorum strain EqF1 16S ribosomal RNA gene, complete Helicobacter hepaticus strain Hh-2 16S ribosomal RNA gene, 85% Bacteroidetes KP % Epsilonproteobacteria KP % Firmicutes KP % Firmicutes KP % Bacteroidetes KP % Bacteroidetes KP % Bacteroidetes KP % Tenericutes KP % Epsilonproteobacteria KP % Epsilonproteobacteria KP713755
8 Table S3. Representative of qpcr products amplified by group target primers with mouse total fecal DNA as template Classified by Primer pair Sequence(5'to3')* RDP-II Bac960F Bac1100R GTTTAATTCGATGATACGCGAGGAACCTT ACCCGGGCTTGAAATGTGCAGGACTCAA GCAGAGACGCCTGTTTCTTCGGACCTGCA TGTAGGTGCTGCATGGTTGTCGTCAGCTC GTGCCGTGAGGTGTCGGCTTAA Bacteroidetes Firm934F Firm1060R Act664F Act941R Sac1031F Sac1218R Defer1115F Defer1265R Ver1165F Ver1263R Ten662F Ten862R GGAGTATGTGGTTTAATTCGAAGCAACGC GAAGAACCTTACCAAGACTTGACATCGTA TGACCGCCATAGAGATATGGAATTCCCTTT TGGGACATATAGACAGGTGGTGCATGGTT GTCGTCAGCT TGTAGCGGTGGAATGCGCAGATATTGGGA AGAACACCGGCGGCGAAGGCGGCCTTCT GGGCCACGACTGACGCTGAGGCGCGAAA GCTAGGGGAGCGAACAGGATTAGATACCC TGGTAGTCCTAGCCGTAAACGATGGATGC TAGGTGTGGGAGCCAAATGGCTTCCGTGC CGCAGCTAACGCATTAAGCATCCCGCCTG GGGAGTACGGCCGCAAGGCTAAAACTCA AAGGAATTGACGGGGACCCGCACAAGCA GCGGAGCATGTGGCTTAATT AAGAGAACTGTGCCTTCGGGAACCTCGA GACAGGTGATGCATGGCCGTCGTCAGCTC GTGTCGTGAGATGTTTGGTTAAGTCCATC AACGAGCGCAACCCTTGCAACCAGTTGTA TTTTTCTGGTAGGACTGCCCCGGTAACGG GGAGGAAGGAGGGGATGATGTCAGGTCA GTATTTCCCTTACGC CTATTTCCAGTTGCTAACGGGTTAAGCTG AGCACTCTGGAGGGACTGCCAGCGATAA GCTGGAGGAAGGTGGGGACGACGTCAAG TCATCATGGCCCTTATGTCCAGGGCTACAC ACGTGCTACAATGGCATAATCAGAGGGAA GCAGCTC TCAGGTCAGTATGGCCCTTATGCCCAGGG CTGCACACGTACTACAATGCCCAGTACAG AGGGGGCCGAAGCCGCGAGGCGGAGGA AATCCTAAAAACTGGGCGGAGGAAATCCT GAAAACTG ATGTGTAGCGGTAAAATGCGTAAATATATG TAAGAACACCGGTGGCGAAGGCGGCTTG Firmicutes Actinobacteria Deferribacteres Verrucomicrobia Tenericutes
9 Beta979F Beta1130R Epslion940F Epsloin1129R Gamma877F Gamma1066R CTGGGCCTGTACTGACATTGAGGCACGAA AGCGTGGGGAGCAAACAGGATTAGATAC CCTGGTAGTCCACGCCCTAAACGACGAGT ACTAAGTGTTGCCGATAGGCAGTGCTGAA GTTAACGCATTAAGTACTCCGCCTGAGTA GTACGTACGCAAGTAGG AACGCGAAAAACCTTACCTACCCTTGACA TGTCAGAGAAGCTTTTGTAATGAGAGTGT GCCCGCAAGGGCGTCTGAACACAGGTGC TGCATGGCTGTCGTCAGCTCGTGTCGTGA GATGTTGGGTTAAGTCCCGCAACGAGCGC AACCCTTGTCACTAGTTGCTACGAAAGGG CA TAGGCTTGACATTGATAGAATCCTATAGAG ATATGGGAGTGCCCTTTTAGGGAGCTTGA AAACAGGTGCTGCACGGCTGTCGTCAGC TCGTGCCGTGAGATGTTGGGTTAAGTCCC GCAACGAGCGCAACCCTCGTCCTTAGTTG CTAGCAGTTCGGCTGAGCACTCTAAGGAG ACTGCCTTCGTAAG GCTAACGCATTAAGTGTCCCGCCTGGGGA GTACGGTCGCAAGGCTGAAACTCAAAGA AATTGACGGGGGCCCGCACAAGCGGTGG AGTATGTGGTTTAATTCGATGCAACGCGA AGAACCTTACCCAGGCTTGACATCTAGGG AACCTAACAGAGATGTTGGGGTGCTCTTC GGAGAACCCTAAGACAGGTGCTGCATGG C * Base pairs in red are s of primer pairs -proteobacteria -proteobacteria -proteobacteria
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Intestinal epithelial MyD88 deletion decreases fat mass under HFD. (a) Final fat mass expressed as a percentage of final body weight (n=25). (b)
More informationStructural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment
Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment Lin Wang, Peicheng Li, Zhaosheng Tang, Xinfeng Yan, Bo Feng
More informationFigure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1,
Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, additional measures of diversity are shown: Figure S2, SDC
More informationActive and secreted IgA-coated bacterial fractions from the human gut reveal an under-represented
Supplemental information Title. Active and secreted IgA-coated bacterial fractions from the human gut reveal an under-represented microbiota core. Authors. Giuseppe D'Auria, Francesc Peris-Bondia, Mária
More informationBenakis et al. Supplementary Figure 1
Benakis et al. Supplementary Figure a flora Naive C7BL/ d AC weeks d S rrna sequencing Antibiotic in drinking water Stool pellet collection riginal seeder flora flora Naive C7BL/ d AC weeks d S rrna sequencing
More informationResearch Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-180 Tumor-bearing Mice
OPEN ACCESS International Journal of Pharmacology ISSN 1811-7775 DOI: 1.3923/ijp.218.46.47 Research Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-18 Tumor-bearing
More informationSUPPLEMENTARY FIGURES & TABLES
SUPPLEMENTARY FIGURES & TABLES Figures S1-S6 Tables S1-S5 A 6 Bacteroidetes/Firmicutes B 1.0 Prevotellaceae/Bacteroidetes Ratio 5 4 3 2 Ratio 0.8 0.6 0.4 1 0.2 0 1 2 3 4 5 6 BSS 0.0 1 2 3 4 5 6 BSS Supplementary
More informationModulation of Gut Microbiota during Probiotics-Mediated. Attenuation of Metabolic Syndrome in High Fat Diet-Fed Mice
Modulation of Gut Microbiota during Probiotics-Mediated Attenuation of Metabolic Syndrome in High Fat Diet-Fed Mice 1 2 3 Jingjing Wang 1,2, Huang Tang 2, Chenhong Zhang 2, Yufeng Zhao 1, Muriel Derrien
More informationMicrobiota-gut-brain-axis and Autism Spectrum disorders
Review Microbiota-gut-brain-axis and Autism Spectrum disorders Piranavie Srikantha, M. Hasan Mohajeri * Department of medicine, University of Zurich, Winterthurerstrasse 190, 8057 Zürich, Switzerland.
More informationMicrobiome and liver diseases
Klinik und Poliklinik für Innere Medizin I Microbiome and liver diseases Bernd Schnabl, M.D. Department of Medicine I have no financial relationship relevant to my presentation AND my presentation does
More informationtraits and fasdng TMAO concentradons..6
FIGURE S1: Variability of gut microbiota composidon in Metsim samples 2 FIGURE S2: AssociaDon of bacterial diversity and richness measures with traits.3 FIGURE S3: AssociaDons of OTUs with fasdng blood
More informationResearch Article Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Gut Dysbiosis
BioMed Research International Volume 216, Article ID 9462571, 11 pages http://dx.doi.org/1.1155/216/9462571 Research Article Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced
More informationTime of day and eating behaviors are associated with the composition and function of the human gastrointestinal microbiota
Time of day and eating behaviors are associated with the composition and function of the human gastrointestinal microbiota Jennifer L Kaczmarek, 1 Salma MA Musaad, 2 and Hannah D Holscher 1 3 1 Division
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16220 DOI: 10.1038/NMICROBIOL.2016.220 Dual-specificity phosphatase 6 deficiency regulates gut microbiome and
More informationObserved # of species (normalized) Chao 1 (richness) Nonsmoker 21 Male 2418 (337) 67 (33)
Additional Files The human laryngeal microbiome: effects of cigarette smoke and reflux Marie E. Jetté, Kimberly A. Dill-McFarland, Alissa S. Hanshew, Garret Suen, Susan L. Thibeault Table S1. Detailed
More informationMICROBIAL PATTERNS IN PATIENTS WITH HISTAMINE INTOLERANCE
journal OF PHYSIOLOGY AND PHARMACOLOGY 2018, 69, 4, 579-593 www.jpp.krakow.pl DOI: 10.26402/jpp.2018.4.09 M. SCHINK 1, P.C. KONTUREK 2, E. TIETZ 1, W. DIETERICH 1, T.C. PINZER 3, S. WIRTZ 3, M.F. NEURATH
More informationManuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs
Journal name: Applied Microbiology and Biotechnology Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs The names of the authors: Yu-heng
More informationPREBIOTIC MECHANISMS OF ACTION
PREBIOTIC MECHANISMS OF ACTION Seema Hooda, Kelly S. Swanson, George C. Fahey, Jr. Department t of Animal Sciences Division of Nutritional Sciences University of Illinois at Urbana-Champaign Institute
More informationMicrobe-Host Interactions in Inflammatory Bowel Diseases. Hera Vlamakis Oct 3, 2018
Microbe-Host Interactions in Inflammatory Bowel Diseases Hera Vlamakis Oct 3, 2018 Most of the bacteria in your body are in your gut HEALTH BENEFITS Breakdown of polysaccharides Synthesis of vitamins Colonization
More informationDevelopment of OTU Analysis in NutriGen
Development of OTU Analysis in NutriGen Integrating OTU data with other NutriGen Data Mateen Shaikh and Joseph Beyene McMaster University December 19 2014 Mateen and Joseph (McMaster) Development of OTU
More informationUniversity of Groningen
University of Groningen Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition and gene expression of suckling mouse pups Steegenga, Wilma T.; Mischke, Mona;
More informationSupplementary Figure 1
Supplementary Figure 1. (A C) Comparison of Shannon evenness between children who became anti islet autoantibody positive (anti islet aab+) and children who remained autoantibody negative (anti islet aab
More informationInvestigation of bacterial diversity in the feces of cattle fed different diets
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in Food Science and Technology Food Science and Technology Department 2014 Investigation of bacterial
More informationDiet, microbiota and the immune system: A gut feeling about type 1 diabetes. Dr. Eliana Mariño Monash University Melbourne, Australia
Diet, microbiota and the immune system: A gut feeling about type 1 diabetes Dr. Eliana Mariño Monash University Melbourne, Australia Diet, gut microbiota and Western lifestyle diseases Asthma Fatty liver
More informationFecal bacterial microbiome diversity in chronic HIV-infected patients in China
OPEN (2016) 5, e31; doi:10.1038/emi.2016.25 www.nature.com/emi ORIGINAL ARTICLE Fecal bacterial microbiome diversity in chronic HIV-infected patients in China Yang Sun 1,2,3, *, Yingfei Ma 4, *, Ping Lin
More informationSupplemental Information. Commensal Microbes Induce Serum IgA. Responses that Protect against Polymicrobial Sepsis
Cell Host & Microbe, Volume 23 Supplemental Information Commensal Microbes Induce Serum Ig Responses that Protect against Polymicrobial Sepsis Joel R. Wilmore, rian T. Gaudette, Daniela Gomez tria, Tina
More informationPrevention and treatment of acute exacerbations of COPD
Prevention and treatment of acute exacerbations of COPD Prof. Laurent P Nicod Service de pneumologie CHUV-Lausanne-CH SSP-SSC: 15.06.2016 COPD EXACERBATION is an event in the natural course of the disease
More informationMaternal exposure to a Western-style diet causes differences in intestinal microbiota composition and gene expression of suckling mouse pups
1600141 (1 of 17) Mol. Nutr. Food Res. 61, 1, 2017, 1600141 DOI 10.1002/mnfr.201600141 RESEARCH ARTICLE Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition
More informationMicrobial nitrogen limitation in the mammalian large intestine
SUPPLEMENTARY INFORMATION Articles https://doi.org/.38/s16-18-267-7 In the format provided by the authors and unedited. Microbial nitrogen limitation in the mammalian large intestine Aspen T. Reese 1,2,
More informationRole of the Gut Microbiota in Autoimmunity
Role of the Gut Microbiota in Autoimmunity Pavan Bhargava, MD - Neuroimmunology Fellow Division of Neuroimmunology and Neurological Infections Johns Hopkins University, Baltimore, MD. May, 2015 None Disclosures
More informationDynamics of the human gut microbiome in inflammatory bowel disease
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 174 Dynamics of the human gut microbiome in inflammatory bowel disease Jonas Halfvarson, Colin J.
More informationmicroorganisms ISSN Review
Microorganisms 2015, 3, 759-791; doi:10.3390/microorganisms3040759 OPEN ACCESS microorganisms ISSN 2076-2607 www.mdpi.com/journal/microorganisms Review Gut Microbiota and Host Reaction in Liver Diseases
More information2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance
P: 1300 688 522 E: info@nutripath.com.au A: PO Box 442 Ashburton VIC 3142 TEST PATIENT Sample Test Name Sex : F Date Collected : 00-00-0000 111 TEST ROAD TEST SUBURB LAB ID: 00000000 UR#:0000000 TEST PHYSICIAN
More informationStool Testing for the Microbiome - Ready for Primetime?
Stool Testing for the Microbiome - Ready for Primetime? Gillian M. Barlow, PhD Project Scientist, Medically Associated Science and Technology (MAST) Program Cedars-Sinai Medical Center Take Charge of
More informationGut Pathogens. Open Access RESEARCH. Janelle A. Jiminez 1,2, Trina C. Uwiera 3, D. Wade Abbott 1, Richard R. E. Uwiera 2* and G.
DOI 10.1186/s13099-016-0149-6 Gut Pathogens RESEARCH Impacts of resistant starch and wheat bran consumption on enteric inflammation in relation to colonic bacterial community structures and short chain
More informationMicrobial Population Differentials between Mucosal and Submucosal Intestinal Tissues in Advanced Crohn's Disease of the Ileum
RESEARCH ARTICLE Microbial Population Differentials between Mucosal and Submucosal Intestinal Tissues in Advanced Crohn's Disease of the Ileum Rodrick J. Chiodini 1,2 *, Scot E. Dowd 3, William M. Chamberlin
More informationRunning Title: Microbial Ecology Network in Diverticulitis
Running Title: Microbial Ecology Network in Diverticulitis The Microbial Ecosystem Distinguishes Chronically Diseased Tissue from Adjacent Tissue in the Sigmoid Colon of Chronic, Recurrent Diverticulitis
More informationDiet-induced extinction in the gut microbiota compounds over generations
Diet-induced extinction in the gut microbiota compounds over generations The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation
More informationAsthma and the Airway Microbiome: New Insights and Hypotheses
Asthma and the Airway Microbiome: New Insights and Hypotheses Yvonne J. Huang, MD Division of Pulmonary and Critical Care Medicine Department of Internal Medicine University of Michigan, Ann Arbor 3 rd
More informationStructural changes of gut microbiota in mice with chronic constipation and intestinal tumor.
Biomedical Research 017; 8 (): 1006-10067 ISSN 0970-938X www.biomedres.info Structural changes of gut microbiota in mice with chronic constipation and intestinal tumor. Yunpeng Luan 1,*, Dechang Mao, Min
More informationPaul Cotter Teagasc Food Research Centre & APC
http://apc.ucc.ie Research into the relationship between digestive bacteria, nutrition and health Paul Cotter Teagasc Food Research Centre & APC paul.cotter@teagasc.ie Our microbes - Some impressive facts
More informationMary D. Boudreau,*,1 Greg R. Olson, Volodymyr P. Tryndyak,* Matthew S. Bryant,* Robert P. Felton, and Frederick A.
TOXICOLOGICAL SCIENCES, 158(2), 2017, 302 318 doi: 10.1093/toxsci/kfx105 Advance Access Publication Date: May 19, 2017 Research Article Aloin, a Component of the Aloe Vera Plant Leaf, Induces Pathological
More informationIntermittent hypoxia alters gut microbiota diversity in a mouse model of sleep apnoea
ORIGINAL ARTICLE SLEEP alters gut microbiota diversity in a mouse model of sleep apnoea Isabel Moreno-Indias 1,2,9, Marta Torres 3,4,9, Josep M. Montserrat 3,4,, Lidia Sanchez-Alcoholado 1,2, Fernando
More informationIndividual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps
Individual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps Yohei Yamazaki 1#, Pedro Milet Meirelles 2#, Sayaka Mino 1, Wataru Suda 3,4, Kenshiro
More informationHigh-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity
GASTROENTEROLOGY 2009;137:1716 1724 BASIC High-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity MARIE A. HILDEBRANDT,* CHRISTIAN HOFFMANN, SCOTT A. SHERRILL MIX,
More informationGUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH?
GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH? Corrie Whisner, PhD School of Nutrition and Health Promotion Arizona State University Center for Research on Ingredient Safety Annual Meeting
More informationThe Gut Microbiome: Our Misunderstood Friend and Foe
The Gut Microbiome: Our Misunderstood Friend and Foe Impact of the Gut Microbiome on Nutrients and non-nutrients Metabolism and Energy Availability. Dr Jean-Michel Antoine With the Functional Food, & the
More informationCharacterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis
Open Access Asian-Australas J Anim Sci Vol. 30, No. 1:100-110 January 2017 https://doi.org/10.5713/ajas.16.0166 pissn 1011-2367 eissn 1976-5517 Characterization of the microbial communities along the gastrointestinal
More informationFood & Function PAPER. 1. Introduction. Shan Li, a Junhui Li, a Guizhu Mao, a Tiantian Wu, Ding Tian, a Robert J. Linhardt
Food & Function PAPER View Journal View Issue Cite this: Food Funct., 2018,9, 5371 Received 12th June 2018, Accepted 21st August 2018 DOI: 10.1039/c8fo01174e rsc.li/food-function 1. Introduction A fucoidan
More informationResearch Article Microflora Disturbance during Progression of Glucose Intolerance and Effect of Sitagliptin: An Animal Study
Journal of Diabetes Research Volume 2016, Article ID 2093171, 10 pages http://dx.doi.org/10.1155/2016/2093171 Research Article Microflora Disturbance during Progression of Glucose Intolerance and Effect
More informationShifts on gut microbiota composition in an APP/PSS1 transgenic mouse model of Alzheimer s disease during lifespan
Shifts on gut microbiota composition in an APP/PSS1 transgenic mouse model of Alzheimer s disease during lifespan Journal: Applied Microbiology Manuscript ID Draft Journal Name: Letters in Applied Microbiology
More informationPrebiotics and food allergies
Prebiotics and food allergies Cathryn Nagler, Ph.D. Committee on Immunology University of Chicago Workshop: Prebiotics Quantifying impact on host health Probiota Americas, Chicago, IL May 31, 2016 Oral
More informationTHE EFFECTS OF EXERCISE AND ESTROGEN ON GUT MICROBIOTA IN FEMALE MICE REBECCA MELVIN. A thesis submitted to the. Graduate School-New Brunswick
THE EFFECTS OF EXERCISE AND ESTROGEN ON GUT MICROBIOTA IN FEMALE MICE By REBECCA MELVIN A thesis submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey In partial fulfillment
More informationMicrobial DNA qpcr Array Metabolic Disorders
Microbial DNA qpcr Array Metabolic Disorders Cat. no. 330261 BAID-1406ZRA For real-time PCR-based, application-specific microbial identification or profiling The Metabolic Disorders Microbial DNA qpcr
More informationThe gut microbiota in conventional and serrated precursors of colorectal cancer
Peters et al. Microbiome (2016) 4:69 DOI 10.1186/s40168-016-0218-6 RESEARCH The gut microbiota in conventional and serrated precursors of colorectal cancer Open Access Brandilyn A. Peters 1, Christine
More informationCharacterisation of Gut Microbiota in Ossabaw and Göttingen Minipigs as Models of Obesity and Metabolic Syndrome
Downloaded from orbit.dtu.dk on: Dec 12, 2018 Characterisation of Gut Microbiota in Ossabaw and Göttingen Minipigs as Models of Obesity and Metabolic Syndrome Pedersen, Rebecca; Ingerslev, Hans-Christian;
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12198 1. Supplementary results 1.1. Associations between gut microbiota, glucose control and medication Women with T2D who used metformin had increased levels of Enterobacteriaceae (i.e.
More informationInterpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE. GI Effects Comprehensive Profile - Stool. Patient: SAMPLE PATIENT
3425 Corporate Way Duluth, GA 30096 Patient: AMPLE PATIENT GI Effects Comprehensive Profile - tool Interpretation At-a-Glance INFECTION INFLAMMATION INUFFICIENCY Calprotectin Pancreatic Elastase 1 Fecal
More informationGestational diabetes is associated with change in the gut microbiota composition in third trimester of pregnancy and postpartum
Crusell et al. Microbiome (2018) 6:89 https://doi.org/10.1186/s40168-018-0472-x RESEARCH Open Access Gestational diabetes is associated with change in the gut microbiota composition in third trimester
More informationHigh-throughput sequencing identifies distinct fecal and mucosal gut microbiota correlating with different mucosal proteins
High-throughput sequencing identifies distinct fecal and mucosal gut microbiota correlating with different mucosal proteins Li-na Dong 1, Jun-ping Wang Corresp., 2, Ping Liu 3, Yun-feng Yang 2, Jing Feng
More informationPhysiology of the Weaner Pig
Physiology of the Weaner Pig Microbiota,, Gut Immunity and Performance Denise Kelly, Rowett Institute of Nutrition & Health, University of Aberdeen, Scotland Gut surfaces and Epithelial cells Gut Bacteria
More informationLinks of gut microbiota composition with alcohol dependence syndrome and alcoholic liver disease
Dubinkina et al. Microbiome (2017) 5:141 DOI 10.1186/s40168-017-0359-2 RESEARCH Open Access Links of gut microbiota composition with alcohol dependence syndrome and alcoholic liver disease Veronika B.
More informationInflammatory bowel diseases (IBDs) including Crohn s
Imaging and Advanced Technology A Pyrosequencing Study in Twins Shows That Gastrointestinal Microbial Profiles Vary With Inflammatory Bowel Disease Phenotypes BEN P. WILLING,* JOHAN DICKSVED,* JONAS HALFVARSON,
More informationIntestinal colonization in premature and very low birth weight infants: Influencing factors and necrotizing enterocolitis (NEC)
Wageningen University Utrecht MASTER THESIS Intestinal colonization in premature and very low birth weight infants: Influencing factors and necrotizing enterocolitis (NEC) M.A.M. Lohuis, BSc Master Infection
More informationInterpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE RELATIVE ABUNDANCE GI Effects Comprehensive Profile - Stool.
3425 Corporate Way Duluth, GA 30096 Patient: DOB: Sex: MRN: 2200 GI Effects Comprehensive Profile - Stool Interpretation At-a-Glance INFECTION INFAMMATION INSUFFICIENCY Pancreatic Elastase 1 IMBAANCE Beneficial
More informationSupplemental Information. Colonic Pro-inflammatory Macrophages. Cause Insulin Resistance in an Intestinal. Ccl2/Ccr2-Dependent Manner
Cell Metabolism, Volume Supplemental Information Colonic Pro-inflammatory Macrophages Cause Insulin Resistance in an Intestinal Ccl/Ccr-Dependent Manner Yoshinaga Kawano, Jun Nakae, Nobuyuki Watanabe,
More informationInterpretation At-a-Glance
3425 Corporate Way Duluth, GA 30096 Patient: AMPLE PATIENT DOB: ex: MRN: Order Number: Completed: Received: Collected: GI Effects Comprehensive Profile - tool Interpretation At-a-Glance INFECTION INFLAMMATION
More informationConsistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile
Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile Infection: Application of a Novel Diagnostic for Dysbiosis Courtney Jones, BS Rebiotix Inc. Roseville, MN USA
More informationISSN: (Print) (Online) Journal homepage:
Gut Microbes ISSN: 1949-0976 (Print) 1949-0984 (Online) Journal homepage: http://www.tandfonline.com/loi/kgmi20 The structures of the colonic mucosa-associated and luminal microbial communities are distinct
More informationExercise is More Effective at Producing Robust, Lasting Changes in Gut Microbial Composition in Juvenile than in Adult Male F344 Rats
University of Colorado, Boulder CU Scholar Integrative Physiology Graduate Theses & Dissertations Integrative Physiology Spring 1-1-2014 Exercise is More Effective at Producing Robust, Lasting Changes
More informationSupplementary Table 1. Identification of bacterial sequences in different manure samples.
Supplementary Table 1. Identification of bacterial sequences in different manure samples. NA, 0 day of incubation N= 39 (5%) 98-100% 95-97% 94% Lactobacillus sp. DJF_WC57 (EU728799) 3 (99-100%) Porcine
More informationResearch Article Gut Microbiome and Inflammation: A Study of Diabetic Inflammasome-Knockout Mice
Hindawi Diabetes Research Volume 217, Article ID 6519785, 5 pages https://doi.org/1.1155/217/6519785 Research Article Gut Microbiome and Inflammation: A Study of Diabetic Inflammasome-Knockout Mice Roma
More informationINFANT GUT MICROBIAL MARKERS OF FOOD SENSITIZATION AT AGE 1
INFANT GUT MICROBIAL MARKERS OF FOOD SENSITIZATION AT AGE 1 Anita Kozyrskyj, PhD, Professor Dept Pediatrics, Faculty of Medicine & Dentistry School of Public Health, University of Alberta kozyrsky@ualberta.ca
More informationA diet based on cured acorn ham with oleic acid content promotes anti-inflammatory gut
1 2 3 Article A diet based on cured acorn ham with oleic acid content promotes anti-inflammatory gut microbiota shifts and prevents ulcerative colitis in an animal model 4 5 6 J. Fernández, 1 V. García
More informationAnalysis of the effect of probiotics on shaping human gut microbiota
Analysis of the effect of probiotics on shaping human gut microbiota Masahira HATTORI Center for Omics and Bioinformatics, The University of Tokyo http://www.cb.k.u-tokyo.ac.jp/hattorilab
More informationINFECTION INFLAMMATION INSUFFICIENCY IMBALANCE
TEST NAME: GI Effects - Comprehensive Profile - Stool 2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE EPX Fecal Fats (Total) PP Bacteria
More informationTargeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressantlike Effects and Reverse the Impact of Chronic Stress in Mice
Archival Report Targeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressantlike Effects and Reverse the Impact of Chronic Stress in Mice Aurelijus Burokas, Silvia Arboleya, Rachel
More informationFecal metagenomic profiles in subgroups of patients with myalgic encephalomyelitis/chronic fatigue syndrome
Fecal metagenomic profiles in subgroups of patients with myalgic encephalomyelitis/chronic fatigue syndrome The Harvard community has made this article openly available. Please share how this access benefits
More informationAlthough the bacterial community in the oral cavity may comprise over 700 species
Exploring Bacterial Diversity of Endodontic Microbiota by Cloning and Sequencing 16S rrna Adriana C. Ribeiro, PhD,* Flavia Matarazzo, PhD,* Marcelo Faveri, PhD, Denise M. Zezell, PhD, and Marcia P.A. Mayer,
More informationEcology of bacteria in the human gastrointestinal tract identification of keystone and foundation taxa
Trosvik and Muinck Microbiome (2015) 3:44 DOI 10.1186/s40168-015-0107-4 RESEARCH Open Access Ecology of bacteria in the human gastrointestinal tract identification of keystone and foundation taxa Pål Trosvik
More informationGut microbiota in experimental murine model of Graves orbitopathy established in different environments may modulate clinical presentation of disease
Masetti et al. Microbiome (2018) 6:97 https://doi.org/10.1186/s40168-018-0478-4 RESEARCH Gut microbiota in experimental murine model of Graves orbitopathy established in different environments may modulate
More informationRole of colonic microbiota in the pathogenesis of ulcerative colitis
Pei et al. BMC Gastroenterology (2019) 19:10 https://doi.org/10.1186/s12876-019-0930-3 RESEARCH ARTICLE Role of colonic microbiota in the pathogenesis of ulcerative colitis Ling-yan Pei 1,2, Yu-shi Ke
More informationMICROBIOME ANALYSIS REPORT
MICROBIOME ANALYSIS REPORT Client name: N.E. Body Order No.: 6140 Report date: 2018-04-19 Sample Type: Gut Sample Barcode: 322672 Report Type: Single Hello Please find enclosed the results of your personalised
More informationINTRODUCTION. Ireland
Microbiology (215), 161, 182 193 DOI 1.199/mic..8261- Streptozotocin-induced type-1-diabetes disease onset in Sprague Dawley rats is associated with an altered intestinal microbiota composition and decreased
More informationModulation of Body Weight by Intestinal Flora in Orphan Nuclear Receptor SHP-/- Mice
The University of Akron IdeaExchange@UAkron Honors Research Projects The Dr. Gary B. and Pamela S. Williams Honors College Spring 2016 Modulation of Body Weight by Intestinal Flora in Orphan Nuclear Receptor
More information6/24/2014. How do you study microbial communities? Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1. Michael T. Bailey, Ph.D.
Interactions between Diet and the Intestinal Microbiota: Implications for Obesity The Body is Colonized by an Enormous Array of Bacteria Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1 Michael
More informationDifferent Flavonoids Can Shape Unique Gut Microbiota Profile In Vitro
Different Flavonoids Can Shape Unique Gut Microbiota Profile In Vitro Jiacheng Huang, Long Chen, Bin Xue, Qianyue Liu, Shiyi Ou, Yong Wang, and Xichun Peng Abstract: The impact of flavonoids has been discussed
More information1. Introduction. Correspondence should be addressed to Shujie Chen;
Gastroenterology Research and Practice, Article ID 696178, 9 pages https://doi.org/1.11/18/696178 Research Article Altered Intestinal Microbiota with Increased Abundance of Prevotella Is Associated with
More informationCordycepin reduces weight through regulating gut microbiota in high-fat dietinduced
An et al. Lipids in Health and Disease (2018) 17:276 https://doi.org/10.1186/s12944-018-0910-6 RESEARCH Cordycepin reduces weight through regulating gut microbiota in high-fat dietinduced obese rats Open
More informationSuper-organism. 2 kg microbes microbial cells (10 12 human cells) 10M microbial genes (25000 human genes)
Microbiology and NGS Henrik Bjørn Nielsen Center for Biological Sequence Analysis, Department of Systems Biology, Technical University of Denmark hbjorn@cbs.dtu.dk Microbiome Super-organism 2 kg microbes
More informationDO SWEETENERS AFFECT THE GUT MICROBIOME?
DO SWEETENERS AFFECT THE GUT MICROBIOME? What does the science and evidence tell us? Alexandra Lobach, M.Sc., Ph.D. Manager, Toxicology, Chemistry & Regulatory Affairs Food & Nutrition Health, Environmental
More informationHIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation
HIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation The Harvard community has made this article openly available. Please
More information- B [6] (TAC) [DOI] /j.issn
88 216 1 1 41 1 [ ] (TAC) 12 C57BL/6 (N ) ( ) 6 N 22d 16S rdna N [ ] [ ] R543.1 [ ] A [ ] 577-742(216)1-88-5 [DOI] 1.11855/j.issn.577-742.216.1.4 Intestinal flora changes in a mouse model of transverse
More informationMeta-Omic Platforms to Assist in the Understanding of NAFLD Gut Microbiota Alterations: Tools and Applications
Int. J. Mol. Sci. 2014, 15, 684-711; doi:10.3390/ijms15010684 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Meta-Omic Platforms to Assist in the
More informationGut microbiota, diet, and obesity-related disorders The good, the bad, and the future challenges
Mol. Nutr. Food Res. 61, 1, 2017, 1600252 (1 of 17) 1600252 DOI 10.1002/mnfr.201600252 REVIEW Gut microbiota, diet, and obesity-related disorders The good, the bad, and the future challenges Kevin J. Portune,
More informationPurified rutin and rutin-rich asparagus attenuates disease severity and tissue damage following dextran sodium sulfate-induced colitis
2396 Mol. Nutr. Food Res. 2016, 60, 2396 2412 DOI 10.1002/mnfr.201500890 RESEARCH ARTICLE Purified rutin and rutin-rich asparagus attenuates disease severity and tissue damage following dextran sodium
More informationResearch Article Colonic Mucosal Microbiota in Colorectal Cancer: A Single-Center Metagenomic Study in Saudi Arabia
Gastroenterology Research and Practice, Article ID 5284754, 9 pages https://doi.org/10.1155/2018/5284754 Research Article Colonic Mucosal Microbiota in Colorectal Cancer: A Single-Center Metagenomic Study
More informationLipid hydrolysis products affect the composition of infant gut microbial communities in vitro
, page 1 of 1 q The Authors 15 doi:1.117/s711515811 Lipid hydrolysis products affect the composition of infant gut microbial communities in vitro Rikke G. Nejrup 1,, Martin I. Bahl, Louise K. Vigsnæs,
More informationTHE EFFECTS OF ORAL PROBIOTIC SUPPLEMENTS ON THE HUMAN GUT MICROBIOME. By Erin Kyle Hudnall. Oxford May 2016
THE EFFECTS OF ORAL PROBIOTIC SUPPLEMENTS ON THE HUMAN GUT MICROBIOME By Erin Kyle Hudnall A thesis submitted to the faculty of The University of Mississippi in partial fulfillment of the requirements
More information