Supplemental Information. Colonic Pro-inflammatory Macrophages. Cause Insulin Resistance in an Intestinal. Ccl2/Ccr2-Dependent Manner
|
|
- Rodney Lucas
- 5 years ago
- Views:
Transcription
1 Cell Metabolism, Volume Supplemental Information Colonic Pro-inflammatory Macrophages Cause Insulin Resistance in an Intestinal Ccl/Ccr-Dependent Manner Yoshinaga Kawano, Jun Nakae, Nobuyuki Watanabe, Tetsuhiro Kikuchi, Sanshiro Tateya, Yoshikazu Tamori, Mari Kaneko, Takaya Abe, Masafumi Onodera, and Hiroshi Itoh
2 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Generation of Tissue-specific Ccr Knockout Mice The mouse genomic DNA clone containing exons,, and of the Ccr gene locus was obtained from a BAC clone CH-O8 (BACPAC Resource) derived from the C7BL/6 mouse strain. The Ccr targeting construct consisted of 9. kb of the genomic sequence that was immediately of the first exon, followed by exon, intron, exon, a.-kb Neo-cassette, a frt-flanked Neo-resistance gene, and exon. A 76-bp of genomic sequence containing the open reading frame in exon of the Ccr gene was flanked by the loxp sequence. The SalI-linearized targeting vector was electroporated into TT embryonic stem (ES) cells (Yagi et al., 99) as described previously. G8-resistant clones were isolated and screened by PCR and Southern blotting. Seven out of 9 G8-resistant clones had undergone the desired homologous recombination. Positive clones were injected into CD- 8-cell stage embryos, and the chimeric male offspring were mated to C7BL/6 females, obtaining Ccr conditional knockout mice (Accession No. CDB6K: Primers for detection of the wild-type allele ( bp) and the loxp allele (6 bp) are: - GCCTATTCTCTTCTGTATCTC- and - TGGATGAACTGAGGTAACAT- (Figure SA-SD). Immunohistochemistry, Immunofluorescence and Histological Analysis For histological analysis, we removed the white adipose tissue and colon from mice, fixed the specimens in % paraformaldehyde and embedded them in paraffin. After rehydration and permeabilization, we stained the specimens with hematoxylin and eosin. Immunofluorescence was performed as described previously (Kawano et al., ) using anti-cd68 (Dako Denmark A/S), anti-claudin- (Invitrogen), or anti-asc (Santa-Cruz) antibodies. After washing with PBS, the sections were sequentially
3 incubated with secondary antibody and visualized using the Liquid DAB Substrate Chromogen System (DakoCytomation) for CD68 single-staining in white adipose tissue and colon. Crypt depth, the number of goblet cells in the colon, and the size and number of adipocytes in white adipose tissue were determined using a fluorescence microscope (BZ-8, 9, KEYENCE) by manually tracing at least more than adipocytes for each genotype. Isolation of Liver Macrophages The liver was removed and cut into small pieces with scissors, and then filtered through μm nylon mesh. The cells were collected in a new ml tube and incubated with mm EDTA and Collagenase B (Roche) with gentle shaking. After incubation with collagenase, the supernatants were centrifuged at 7 rpm and washed twice with PBS. The cell pellets were re-suspended in % Percoll, overlaid on 8% Percoll, and centrifuged at rpm for min at room temperature. The white interphase was collected in a new tube, and centrifuged, and analyzed by FACS immediately. Isolation of the Stromal Vascular Fraction The epididymal fat was removed, transferred to a ml tube containing KRHAG buffer (M KCl, M CaCl, M KH PO, M MgSO, % BSA, mm HEPES (ph 7.8), mm glucose), and cut into small pieces. The pieces were incubated with Collagenase type Ⅰ (Wako) in KRHAG buffer (.mg/.ml) for min at 7 o C with gentle shaking. After filtering through μm nylon, the supernatant was centrifuged at rpm for min at and washed twice in Pharm Lyse (BD Bioscience) buffer. After hemolytic incubation with lysing solution (BD Bioscience), the cells were washed twice again and analyzed by FACS immediately. RNA Isolation and Real-time PCR Isolation of total RNA was performed using the SV Total RNA Isolation System
4 (Promega) according to the manufacturer s protocol. We performed reverse transcription using the PrimeScript TM RT Reagent Kit, and real-time PCR using the SYBR GREEN detection protocol by STRATAGENE (An Agilent Technologies division, Germany). All primer sequences are available upon request. Western Blotting For Western blotting, we homogenized tissues as described previously (Nakae et al., ). After centrifugation to remove insoluble material, the proteins in μg of lysate were separated using 8% SDS-PAGE for detection of p-akt and Akt (Cell signal) or % SDS-PAGE for detection of Claudin- and procaspase- p (sc-, Santa Cruz), and immunized using the indicated antibodies. H O Production The colon and epididymal fat were dissected from age-matched male C7BL/6J mice fed either a NCD or a HFD for or weeks. We measured peroxidase activity in the colon and epididymal fat using with the Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit (Invitrogen) according to the manufacturer's protocol. Intracellular Staining of TNF-α Intracellular staining of TNF-α was performed using the Fix and Permeabilization Kit (ebioscience). First, cells were stimulated with μg/ml LPS for h with BFA added to the cell suspension for the final hours. Next, the cells were stained with surface marker antibodies, including F/8(BM8, APC, BioLegend), CDb (M/7, APC-Cy7, BioLegend), and CDc (N8, FITC, BioLegend), washed with PBS, and fixed in formaldehyde. The cells were permeabilized in PBS containing.% saponin and.% BSA (Sigma-Aldrich), stained with antibody for intracellular TNFα marker (MP-6XT, PerCP-Cy., BD Biosciences), and analyzed by flow cytometry.
5 Metagenomic analysis of 6S rrna To analyze the microbial population from NCD, HFD, M-CcrKO, Vil-CclKO mice in this study, metagenomics analysis using 6S rrna sequencing was performed. DNA sample for assessment of the microbial community was extracted from lyophilized cecal content using the QIAamp DNA Stool Mini Kit (Qiagen). Illumina Miseq was used to sequence complex microbial populations. Sequence data was processed and filtered by the quantitative insights into microbial ecology (QIIME, Ver.8..) Chimeric sequences were removed. We used a Cut-adapt (Ver.) to trim any over-read, and paired-end sequences from DNA sequencing reads. A total of, reads were generated per sample from these mice after filtering. Taxonomy is assigned to each OTU based on the 6S rdna database Greengenes (Ver.8) in the closed-reference manner. We excluded sequences that were not between and nucleotides in length and clustered into Operational Taxonomic Units (OTUs). OTU analyses were performed by clustering at the similarity 97% level with UCLUST. Beta diversity was measured using the weighted/ unweighted UniFrac analysis. UniFrac distance matrics, which was were used to compute average distances within and between various groups of samples, were generated using by QIIME s BaseSpace. Weighted UniFrac PCoA plots were used to visualize the similarities or dissimilarities of variables. Hierarchical clustering method was used to produce UPGMA (Unweighted Pair Group Method with Arithmetic Mean) tree in genus level. Endotoxin Measurement The concentration of endotoxin in the portal vein was measured using the endotoxin assay kit (ToxinSensor TM Chromogenic LAL Endotoxin Assay kit) according to the manufacturer's protocol. Measurement of Cytokines in the Portal Vein Serum levels of IL8 and ILβ in the portal vein were measured using the mouse ELISA
6 kits (R&D SYSTEM for IL8 and mouse ELISA kit Quantikine, R&D SYSTEM for ILβ). Isolation of Intestinal Epithelial Cell for Real-time PCR The pieces of the colon and small intestine dissected from each mouse were incubated in mm DTT and.m EDTA in.% FBS-HANKS at 7 o C for minutes. The supernatant was then collected and filtered through μm nylon mesh and centrifuged to pellet. The pellets were washed four times and resuspended in the RNA lysis buffer of the SV Total RNA Isolation System (Promega) Magnetic Activated Cell Sorting Mononuclear cells were isolated from the colon and incubated with CDb magnetic beads (Miltenyi Biotec) for positive selection. The CDb + cells were cultured with ( 6 cells/ml) in HANKs Balanced Salt solution supplemented with.% FCS and % penicillin/streptomycin. Intestinal Permeability Fluorescein-isothiocyanate-conjugated dextran (FD: Sigma-Aldrich, Gillingham, UK) was administered to each mouse at. mg/g body weight by oral gavage. After h, blood was collected from the portal vein and diluted with an equal volume of PBS. The concentration of FD dextran was measured at 8 nm using a spectrophoto microplate reader. Co-culture of Caco- and CDb + Cell Caco- cells were cultured with DMEM supplemented with.% FBS and % penicillin/streptomycin for days. Differentiated Caco- cells at 8% confluence were seeded on the basal side of the Nunc TM CC insert -well plate (polycarbonate membrane, <.7 6 pores/cm ). CDb + cells sorted from the colons of mice fed a 6
7 NCD stimulated with a mixture of IL-β, IL-8, and LPS were added to polycarbonate membrane inserts. After 6 hours, Caco- cells were harvested and centrifuged and the cell pellets suspended in RIPA lysis buffer. SUPPLEMENTAL REFERENCES Kawano, Y., Nakae, J., Watanabe, N., Fujisaka, S., Iskandar, K., Sekioka, R., Hayashi, Y., Tobe, K., Kasuga, M., Noda, T., et al. (). Loss of Pdk-Foxo signaling in myeloid cells predisposes to adipose tissue inflammation and insulin resistance. Diabetes 6, Nakae, J., Cao, Y., Hakuno, F., Takemori, H., Kawano, Y., Sekioka, R., Abe, T., Kiyonari, H., Tanaka, T., Sakai, J., et al. (). Novel repressor regulates insulin sensitivity through interaction with Foxo. EMBO J, 7-9. Sakaue, H., Ogawa, W., Matsumoto, M., Kuroda, S., Takata, M., Sugimoto, T., Spiegelman, B.M., and Kasuga, M. (998). Posttranscriptional control of adipocyte differentiation through activation of phosphoinositide -kinase. J Biol Chem 7, Yagi, T., Tokunaga, T., Furuta, Y., Nada, S., Yoshida, M., Tsukada, T., Saga, Y., Takeda, N., Ikawa, Y., and Aizawa, S. (99). A novel ES cell line, TT, with high germline-differentiating potency. Anal Biochem,
8 A Normal chow W High fat diet HFW HF6W HFW HF8W HFW NC B Length of small intestine NC HFW C Length (cm) p=. D Emr... Ly6c Cxcr Ccl... Tnf.. Ilb.. Il8.. Foxp.. E Epididymal fat F Mesenteric fat A Emr Emr Mesentery fat Ccl Ccl Tnf... Tnf.. Ilb.. Ilb... NC HFW HF8W HFW HF6W HFW G Liver Emr.. Ccl 6 Tnf.... Ilb.. Figure S
9 Figure S. Related to Figure. HFD analysis of small intestine. (A) The protocol for evaluating sequential change of intestinal immune state during HFD for weeks. (B)Representative image of the small intestine from NCD and HFD for weeks (C)The length of the small intestine from age-matched C7Bl6/J mice (n=6) fed with HFD compared with NCD. Data are expressed as mean + SEM. P-value by one-way ANOVA. (D) Normalized gene expression of inflammatory related genes in the small intestine of age-matched C7Bl6/J mice fed with HFD compared with NCD. Data are normalized to β-actin expression and represent means + SEM from 8- mice in each group. P<. by one-way ANOVA. (E, F and G) Related to Figure. HFD-induced Pro-inflammatory Changes in Adipose Tissue and Liver. Normalized expression of inflammation-related genes (Emr, Ccl, Tnf, Ilb) in epididiymal fat (E), mesenteric fat (F) and liver (G) from age-matched C7Bl6/J mice fed with HFD compared with NCD. Data represent as the ratio to control in each gene. Data are means + SEM. P<. by one-way ANOVA.
10 A B Ly6c NC 8.% 87.7% 8.% Ly6c CXCR SiglecF HFW 98.9% %.68% Ly6c CXCR SiglecF 6 CXCR SiglecF(Eosinophil).. C D TNFα NC HFW SSC-A NC HFw.76%.7% CDb TNFα E F Number of F/8 + CDb + CDc - TNFα high (in living F/8 + cell cell) Number of F/8 + CDb + CDc - TNFα + cell TNFα ( pg/ml ) TNFα in cell culture supernatants NC CDb+ MACS cell HFW CDb+ MACS cell Figure S
11 Figure S. Related to Figure. HFD-induced Changes of Ly6c, Cxcr, and Siglecf Expression in Colon and FACS Analysis of F/8 + CDb + CDc - TNFα high from the Colon of NCD and HFD Mice. (A) Representative FACS analysis of Ly6c, CXCR, SiglecF among F/8 + CDb + CDc - cells in colonic LP from mice fed with NCD (the left panel) and HFD for weeks (the right panel). (B) Normalized expression of Ly6c, Cxcr, and Siglecf in colon from age-matched C7Bl6/J mice fed with HFD compared with NCD. Data represent as the ratio to control in each gene. Data are means + SEM. P<. by one-way ANOVA. (C and D) Representative FACS analysis of F/8 + CDb + CDc - TNFα high cell in colonic LP from mice fed with a NCD and with a HFD for weeks (C), and from mice fed with a NCD and a HFD for weeks (D). (E) Absolute number of F/8 + CDb + CDc - TNFα high cell in living F/8 positive cell. Data are means + SEM. P<. by one-way ANOVA. (F) Measurement of TNFα production by ELISA in culture supernatants of MACS sorted CD + cells from NCD and HFD for weeks. Data are expressed as mean + SEM. by one-way ANOVA.
12 A D g / BW Body weight (g)..... Body weight W W 6W 7W 8W 9W W W W W W Age (week) B Blood glucose (mg/dl) HF Control HF M-CcrKO E g/bw IPGTT 6 9 Time (min) Fat fat free free mass Control HF control C F M-CcrKO HF M-CcrKO % of Blood glucose ( min ) Insulin (ng/ml) 8 6 ITT 6 9 Time (min)... Insulin Time (min) cont HF control CcrLysM HF M-CcrKO Blood glucose ( mg/dl ) G OGTT HF control HF M-CcrKO 6 9 Time (min) Insulin (ng/ml) H I Insulin HF control HF M-CcrKO Time ( min ) Liver TG (mg/g tissue) Liver TG J Cell number of Epididymal fat F/8 + CDb + CD + CD6 - cell in epididymal fat 8 6 K Mesenteric fat Relative gene expression 8 6 NC HF Control HF M-CcrKO Emr Ccr Ccl Tnfa Ilb Il8 Ifng Il7 Foxp Il Il Siglecf L M-CcrKO MACS-sorted CDb + adipose tissue macrophage Relative gene expression... HF control HF M-CcrKO Emr Itgax Tnfa Ilb Il8 Arg Cd6 Il RelaBve gene expression M Skeletal Muscle control HF control CcrLysM HF M-CcrKO Figure S
13 Figure S. Related to Figure. Metabolic Phenotypes, FACS Analysis, and Gene Expression Analysis of M-CcrKO. (A) Body weight. (B) IPGTT. (C) ITT in M-CcrKO fed with a NCD. The black rhombus and green square indicate control and M-CcrKO, respectively. Data represent means + SEM of mice in each genotype. (D) Fat composition of epididymal fat, subcutaneous fat, mesentery fat, perirenal fat and brown adipose tissue from NC, HF control and M-CcrKO. Data are % of body weight and expressed as mean + SEM. (E) Fat free mass. Data are defined as total body mass except for epididymal fat, subcutaneous fat, mesentery fat, perirenal fat and brown adipose tissue and are expressed as mean + SEM. (F) Insulin secretion of control and M-CcrKO mice fed with a HFD for weeks during IPGTT. Data are means + SEM of 8- mice in each genotype. (G) Oral glucose tolerance test (ogtt) of control and M-CcrKO mice fed with HFD for weeks (n=). Data are means + SEM. P<. by two-way ANOVA with Fisher's test. (H) Insulin secretion of control and M-CcrKO mice fed with HFD for weeks during ogtt. Data are means + SEM of 8- mice in each genotype. (I) Hepatic triglyceride content of control and M-CcrKO mice fed with HFD for weeks. (II) Data are means + SEM of 6-8 mice. by one-way ANOVA. (J) Absolute number of F/8 + CDb + CDc + CD6 - cell in whole epididymal fat. Data are means + SEM. by one-way ANOVA. (K) Normalized expression of inflammation-related genes in mesentery fat from NC control, HF control, and M-CcrKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of 6 mice in each genotype. P<. by one-way ANOVA. (L) Normalized expression of inflammation-related genes in CDb + cell in stromal vascular fraction of epididymal fat from control and M-CcrKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of mice in each genotype. P<. by one-way ANOVA. (M) Normalized expression of inflammation-related genes in skeletal muscle from control and M-CcrKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of - mice in each genotype. P<. by one-way ANOVA.
14 Weight (g).. C NC HF control HF HF M-CcrKO M-CcrKO... Emr Tnf Tnfa Ccl Ilb Il8 Ifng Il7 Foxp Il Il Siglecf D HFD Control NCD Ccr HFD M-CcrKO Firmicutes Bacteroidetes Firmicutes Proteobacteria 8 6 Actinobacteria Deferribacteres Bacteroidetes..6 Small intestine B Cecum A Proteobacteria E F 8% 7% 6% % % % % % % G Bacteroidaceae 8 6 Deferribacteraceae Others Deferribacteraceae Dehalobacteriaceae Alcaligenaceae Peptostreptococcaceae Rhodothermaceae Odoribacteraceae Sphingobacteriaceae Prevotellaceae Verrucomicrobiaceae Flavobacteriaceae Lactobacillaceae Coriobacteriaceae Clostridiaceae Helicobacteraceae Erysipelotrichaceae Porphyromonadaceae Bacteroidaceae Desulfovibrionaceae Ruminococcaceae Lachnospiraceae 9% % H PC(.9%) PC(.8%) NCD HFD control HFD M-CcrKO Figure S
15 Figure S. Related to Figure. Analysis of Cecum and Small Intestine of M-CcrKO (A) The weight of the cecum from NC control, HF control, and M-CcrKO mice fed with a HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of mice in each genotype. P <. by one-way ANOVA. (B) Normalized expression of inflammation-related genes in the small intestine from NC control, HF control, and M-CcrKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of 6 mice in each genotype. P<. by one-way ANOVA. (C, D, E and F) The 6S rrna Sequencing Analysis of Microbiota at the Phylum and Family Level in M-CcrKO (C) Pie charts showing relative abundances of bacterial phyla in the cecum microbiota of control mice fed a NCD (n=), fed a HFD (n=), and M-CcrKO fed a HFD (n=). (D) The 6S rrna sequencing analysis of the cecum microbiota at the phylum level with Illumina MiSeq in Paired-End mode ( bp) of cecal DNA product from control fed with a NCD, HFD, M-CcrKO fed with a HFD. These data were expressed as a percentage of total DNA sequence from each Phylum of microbiota and mean + SEM. P<. by one-way ANOVA. (E) Bar plot analysis on family taxon. (F) The 6S rrna sequencing analysis of the cecum microbiota at the family level. These data were expressed as a percentage of total DNA sequence from each Family of microbiota and mean + SEM. P<. by one-way ANOVA. (G) Principal Coordinate Analysis (PCoA) of weighted UniFrac distances from the cecum microbiota of control mice fed a NCD (n=), fed a HFD (n=8), and M-CcrKO fed a HFD (n=) (H) Hierarchical clustering dendrogram of the cecum microbiota based on genus-level classifications.
16 A 8W HF start B Ccl HFW Tamoxifen mg/day i.p. days HF6W Tamoxifen mg/day i.p. days HFW IPGTT, ITT analysis exon exon exon RFP loxp Functional C-C domain loxp C Control Control PCR Ccl-Ex-S - Ccl-Ex-AS recombination PCR Ccl-Ex-S - Ccl-6AS Vil-CclKO Recombination PCR bp Control PCR bp D g / BW..... NC control HF control HF Vil-Ccl HF Vil-CclKO g/bw E NC control HF control HF Vil-Ccl HF Vil-CclKO Fat free mass Insulin (ng/ml) F Insulin (IPGTT) control HF control. Cclvillin HF Vil-CclKO.. Time (min) G H I J OGTT Insulin(OGTT) Blood glucose (mg/dl) HF control Vil-CclKO HF Vil-CclKO 6 9 Time (min) Insulin (ng/ml).. HF control. HF Vil-CclKO Time min ) Liver TG (mg/g tissue) Weight (g).... Cecum Figure S
17 Figure S. Related to Figure. Generation and Analysis of Vil-CclKO (A) Protocol of HFD analysis of Vil-CclKO. (B and C) Recombination of conditional Ccl-targeted allele (Ccl-RFP flox/flox ) by intestine-specific tamoxifen-inducible Cre transgenic mice (Vil-Cre-ER T ). (B) Construct of Ccl-targeted allele and primers for control and recombination PCR. (C) Representative data for recombination PCR on genomic DNA isolated from various tissues of Vil-CclKO compared with control mice. (D) Analysis of fat composition of epididymal fat, subcutaneous fat, mesentery fat, perirenal fat and brown adipose tissue from NC control, HF control, and Vil-CclKO. Data are expressed as mean + SEM. P<. by one-way ANOVA. (E) Fat free mass. Data are defined as total body mass except for epididymal fat, subcutaneous fat, mesentery fat, perirenal fat and brown adipose tissue from NC, HF control and Vil-CclKO and are expressed as mean + SEM. (F) Insulin secretion of control and Vil-CclKO mice during IPGTT. Data represent means + SEM of 8 mice in each genotype. (G) OGTT of control and Vil-CclKO mice fed with HFD for weeks (n=). Data are means + SEM. P<. by two-way ANOVA with Fisher's test. (H) Insulin secretion of control and Vil-CclKO mice fed with HFD for weeks during ogtt. Data are means + SEM of 8- mice in each genotype. (I) Hepatic triglyceride content of NC control, HF control, and Vil-CclKO mice fed with HFD for weeks. Data are means + SEM of 8 mice. P<. by one-way ANOVA. (J) The weight of the cecum from NC control, HF control and Vil-Ccl KO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of mice in each genotype. P <. by one-way ANOVA.
18 A... Small intestine NC HF control HF Vil-CclKO B Colon.. Arg Mr Cd6 NC HF control HF Vil-CclKO C F 8 6 Liver Emr Ccr Ccl Tnfa Ilb Il8 Ifng Il7 Foxp Il Il Siglecf Bacteroidetes Firmicutes Proteobacteria Deferribacteres D Concentration In portal vein (pg/ml) Tenericutes ILβ Synergistetes E HFD Control HFD Vil-CclKO Firmicutes Bacteroidetes Proteobacter G % 8% 6% % % % H Desulfovibrionaceae Helicobacteraceae Others Deferribacteraceae Dehalobacteriaceae Alcaligenaceae Peptostreptococcaceae Rhodothermaceae Odoribacteraceae Sphingobacteriaceae Prevotellaceae Verrucomicrobiaceae Flavobacteriaceae Lactobacillaceae Coriobacteriaceae Clostridiaceae Helicobacteraceae Erysipelotrichaceae Porphyromonadaceae Bacteroidaceae Desulfovibrionaceae Ruminococcaceae Lachnospiraceae Deferribacteraceae I PC((8.%) PC(.%) NCD HFD control HFD Vil-CclKO Figure S6
19 Figure S6. Related to Figure 6. Analysis of Inflammation Related Gene Expression of Intestine and Liver in Vil-CclKO (A) Normalized expression of inflammation-related genes in the small intestine from NC. Control, HF control, and Vil-CclKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of 6 mice in each genotype. P<. by one-way ANOVA. (B) Normalized expression of anti-inflammatory macrophage-related genes in the colon from NC control, HF control, and Vil-CclKO mice fed with HFD for weeks. Data represent as the ratio to control in each gene and are means + SEM of -6 mice in each genotype. (C) Normalized expression of inflammation-related genes in liver from NC control, HF control, and Vil-CclKO fed with HFD for weeks. Data are normalized to b-actin expression level and represent as the ratio to control in each gene and are means + SEM of 6 mice in each genotype. P<. by one-way ANOVA. (D) The concentration of ILb in the portal vein from control and Vil-CclKO fed with HFD for weeks. Data are means + SEM of -6 mice in each genotype. n.s by one-way ANOVA. (E) The 6S rrna Sequencing Analysis of Microbiota at the Phylum and Family Level in Vil-CclKO. Pie charts showing relative abundances of bacterial phyla in the cecum microbiota of control (n=) and Vil-CclKO fed a HFD (n=). (F) The 6S rrna sequencing analysis of the cecum microbiota at the phylum level with Illumina MiSeq in Paired-End mode ( bp) of cecal DNA product from control fed with a NCD (n=), HFD (n=), Vil-CclKO fed with a HFD (n=). These data were expressed as a percentage of total DNA sequence from each Phylum of microbiota and mean + SEM. P<. by one-way ANOVA. (G) Bar plot analysis on family taxon. (H) The 6S rrna sequencing analysis of the cecum microbiota at the family level. These data were expressed as a percentage of total DNA sequence from each Family of microbiota and mean + SEM. P<. by one-way ANOVA. (I)Principal Coordinate Analysis (PCoA) of weighted UniFrac distances from the cecum microbiota of control mice fed a NCD (n=), fed a HFD (n=), and Vil-CclKO fed a HFD (n=).
20 A B Adipocyte number Number of F/8 + CDb + CDc + CD6 - cell ( / SVF total cell) Adipocyte size (µm) Adipocyte size (μmm ) C Serum Ccl Serum Ccl (pg/ml) 8 6 D Ccr Blood HF control.% E Blood Ly6c + Ccr + cell F Blood Ly6c + Ccr + cell P Ccr Blood HF Vil-CclKO.6% Ly6c % of P Number (/ living blood cells) Ly6c Figure S7
21 Figure S7. Related to Figure 6. Adipocyte Size, FACS Analysis, and Serum Ccl Concentration of Vil-CclKO (A) Histogram of adipocyte size and number of control (blue bar) and Vil-CclKO (yellow bar) fed with HFD for weeks. (B) Absolute number of F/8 + CDb + CDc + CD6 - cell among 6 SVF total cell from control and Vil-CclKO fed with HFD for weeks. Data are means + SEM. P<. by one-way ANOVA. (C) Serum Ccl concentration of control and Vil-CclKO fed with HFD for weeks. by one-way ANOVA. (D) Representative FACS analysis of blood monocyte, expressed as Ly6c + Ccr + cell in blood from mice fed with control (the upper panel) and Vil-CclKO (the bottom panel) fed with HFD. (E and F) Percentage (E) and Absolute number (/ living blood cell) (F) of blood monocyte from mice fed with control and Vil-CclKO fed with HFD
22 Supplemental table. Related to Figure,, and. The composition of HFD used in this study HFD-6 (Oriental, g / g) Milk Casein L-cystein Corn starch Maltodextrin Sucrose Soybean oil Powdered cellulose AIN-9G Mineral mixture AIN-9 Vitamin mixture Choline bitartrate Butterfat Tert-butylhydroquinone Total calorie ( kcal/g)
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Intestinal epithelial MyD88 deletion decreases fat mass under HFD. (a) Final fat mass expressed as a percentage of final body weight (n=25). (b)
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSupplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationLoss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance
ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationBenakis et al. Supplementary Figure 1
Benakis et al. Supplementary Figure a flora Naive C7BL/ d AC weeks d S rrna sequencing Antibiotic in drinking water Stool pellet collection riginal seeder flora flora Naive C7BL/ d AC weeks d S rrna sequencing
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationProtein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationTitle. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16220 DOI: 10.1038/NMICROBIOL.2016.220 Dual-specificity phosphatase 6 deficiency regulates gut microbiome and
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationResearch Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-180 Tumor-bearing Mice
OPEN ACCESS International Journal of Pharmacology ISSN 1811-7775 DOI: 1.3923/ijp.218.46.47 Research Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-18 Tumor-bearing
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationBalancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationGut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationFigure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationDetailed step-by-step operating procedures for NK cell and CTL degranulation assays
Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationData Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationL-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity
Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationFigure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1,
Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, additional measures of diversity are shown: Figure S2, SDC
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationSupplemental Data Tamoxifen administration to Vil-Scap- mice.
Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric
More informationSUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationGut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
More informationIL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More information