MicroRNA-363 inhibits ovarian cancer progression by inhibiting NOB1

Size: px
Start display at page:

Download "MicroRNA-363 inhibits ovarian cancer progression by inhibiting NOB1"

Transcription

1 /, 2017, Vol. 8, (No. 60), pp: MicroRNA-363 inhibits ovarian cancer progression by inhibiting NOB1 Yang Lin 1, Tianmin Xu 1, Shunqing Zhou 1 and Manhua Cui 1 1 Department of Obstetrics and Gynecology, The Second Hospital, Jilin University, Nanguan District, Changchun , China Correspondence to: Manhua Cui, cuimanhua1326@163.com Keywords: micrornas; mir-363; ovarian cancer; NOB1 Received: May 11, 2017 Accepted: September 04, 2017 Published: September 30, 2017 Copyright: Lin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Research Paper In this study, we investigated the role of microrna-363(mir-363) in ovarian cancer (OC) progression. MiR-363expression was downregulated in OC patient tissues and four OC cell lines (SKOV3, A2780, OVCAR and HO-8910). Low mir-363 levels were associated with advanced stage, lymph node metastasis, and poor prognosis in OC. MiR-363 overexpression decreased growth, colony formation, migration and invasiveness of SKOV3 cells. In addition, mir-363 overexpression in SKOV3 cells also decreased xenograft tumor size and weight in nude mice. Bioinformatics and dual luciferase reporter assays revealed that mir-363 suppresses expression of NIN1/ RPN12 binding protein 1 homolog (NOB1) by binding to the 3 -UTR of its transcript. NOB1 expression inversely correlated with mir-363 levels in OC tissues. Thus mir- 363 appears to play a tumor suppressor role in OC by inhibiting NOB1. INTRODUCTION Ovarian cancer (OC) is the most common gynecological malignancy with poor overall survival [1]. The 5-year survival rate is 35 38% despite significant improvements in therapeutic strategies for OC during the past decade [2, 3]. The underlying mechanisms that promote OC are not fully known. Therefore, elucidating novel mechanisms of OC initiation and progression are critical to developing new and improved diagnostics and therapeutics. MicroRNAs (mirnas) are a class of evolutionarily conserved noncoding RNAs that regulate expression of their target genes at the post-transcriptional level by binding to their 3 untranslated region (3 UTRs) [4]. The role of mirnas in various biological processes such as cellular proliferation, apoptosis, invasion, metastasis, migration, and stemness has been well established [5, 6]. MiRNAs perform oncogenic or tumor suppressor functions in carcinogenesis based on the function of their target proteins [7, 8]. The role of many mirnas in the initiation, growth and metastasis of OC has already been identified [9, 10]. These mirnas are promising prognostic biomarkers and potential therapeutic targets for OC. MicroRNA-363 (mir-363) is a cancer-related mirna, which plays an oncogenic or tumor suppressor role in different cancers [11 18]. However, its role in OC has remained elusive so far. Therefore, in this study, we investigated the role of mir-363 in OC progression. RESULTS MiR-363 expression is decreased in OC tissues and cell lines We determined mir-363 expression in 50 paired OC and adjacent normal tissues by qrt-pcr. OC tissues showed lower mir-363 levels than adjacent normal tissues (p<0.01, Figure 1A). Next, we observed lower mir-363 expression in four ovarian cancer cell lines, namely, SKOV3, A2780, OVCAR and HO-8910 than in the normal ovarian surface epithelial cell line HOSEpiC (all p<.05; Figure 1B). Since SKVO3 cell line showed the lowest mir-363 expression, we selected it for further study

2 Low mir-363 levels correlate with poor prognosis of OC patients Next, we determined the prognostic significance of mir-363 in OC. We divided patients into mir-363 low and mir-363 high groups using the median value of 0.36 as a cut off value. As shown in Table 1, low mir- 363 expression was associated with advanced FIGO stage and lymph node metastasis (both p<0.01), but was not associated with patient age, histological grading, or tumor size (all p>0.05). Kaplan Meier analyses indicated that patients with low mir-363 expression were associated with reduced 5-year overall survival (p<0.001, Figure 1C). Thus, mir-363 demonstrates potential as a prognostic biomarker for OC patients. MiR-363 overexpression inhibits OC cell proliferation and xenograft tumor growth To investigate the biological function of mir-363 in OC, we generated control or mir-363 overexpressing SKOV3 cells with lentiviruses carrying hsa-mir-363 or has-mir-nc (Figure 2A). CCK8 assay demonstrated that mir-363 overexpression inhibited SKOV3 cell proliferation (p<0.05; Figure 2B). Moreover, mir-363 decreased the number of colonies (p<0.05; Figure 2C). To determine the significance of these findings in vivo, SKOV3 cells stable expressing mir-363 or mir- NC were subcutaneously injected into the flank region of nude mice. We observed decreased tumor growth in the mir-363 group than in the mir-nc group (p<0.05, Figure 2D). When the xenografted tumors were harvested on day 30, we observed decreased tumor size in mir-363 group than the mir-nc group (p<0.05, Figure 2E). These data demonstrate that mir-363 inhibits OC growth and progression. MiR-363 suppresses OC cell migration and invasion Next, we investigated the role of mir-363 in OS metastasis. MiR-363 overexpressing SKOV3 cells showed decreased migration and invasiveness than control cells (both p<0.01; Figure 3A-3B). NOB1 is a target of mir-363 in OC cells We explored Targetscan and miranda websites and identified NOB1 as the potential mir-363 target gene with a probable binding site at bases 217 to 223 (Figure 4A). We performed dual luciferase reporter assays in control or mir-363 overexpressing SKOV3 cells transfected with wild type or mutant NOB1-3 UTR. As shown in Figure 4B, mir-363 overexpressing SKOV3 cells transfected with the WT-NOB1-3 UTR construct showed decreased luciferase activity than mir-363 overexpressing SKOV3 cells transfected with the mutant NOB1-3 UTR construct. Moreover, mir- 363 ovexpression decreased NOB1 mrna and protein expression (Figure 4C-4D). NOB1 mediates the functional effects of mir-363 on OS cells We observed that co-transfection of SKOV3 cells with mir-363 mimics and NOB1 overexpressing plasmid restored NOB1 levels in SKOV3 cells (Figure 5A-5B). Increased NOB1 levels restored SKOV3 cell proliferation, colony formation, migration and invasion (Figure 5C-5F). These data demonstrated that mir-363 inhibits OC cell growth and metastasis by decreasing NOB1 expression. Figure 1: Low mir-363 levels correlate with OC progression. (A) qrt-pcr analysis of mir-363 in 50 paired OC and adjacent normal tissues. (B) qrt-pcr analysis of mir-363 in four human ovarian cancer cell lines, SKOV3, A2780, OVCAR and HO-8910 and a human ovarian surface epithelial cell line, HOSEpiC. (C) Kaplan-Meier survival curve analysis demonstrates decreased 5year survival in patients expressing low levels of mir-363. Note: * denotes p<0.05; ** denotes p<

3 Table 1: Association between mir-363 expression and clinicopathological features of human ovarian cancer Variables No. of cases mir-363 expression Low (n %) High (n %) p value Age(years) p>0.05 < (59.1) 9(40.9) (57.1) 12(42.9) Tumor size p>0.05 <5 cm 35 21(60.0) 14(40.0) 5 cm 15 8(53.3) 7(46.7) FIGO stage p<0.05 I-II 33 14(42.4) 19(57.6) III-IV 17 15(88.2) 2(11.8) Histological grading p> (54.8) 13(45.2) (63.2) 8(46.7) Lymph node metastasis No 39 19(48.7) 20(51.2) Yes 11 10(90.9) 1(9.1) p<0.01 NOB1 inversely correlates with mir-363 in OC tissues Next, we investigated the relative expression of NOB1 mrna and mir-363 in 50 pairs of OC and corresponding adjacent normal tissues by qrt-pcr. NOB1 mrna levels were higher in the OC tissues than the adjacent normal tissues (p<0.05; Figure 6A). Immunohistochemical analysis demonstrated higher NOB1 protein expression in OC tissues than the adjacent normal tissues (Figure 6B). Moreover, Spearman s rank test showed that NOB1 transcript levels inversely correlated with mir-363 expression (r=-0.659, p<0.001, Figure 6C). DISCUSSION MicroRNAs (mirnas) play crucial roles in ovarian cancer progression [19, 20]. In this study, we investigated the role of mir-363 in OC progression. We found significant downregulation of mir-363 in OC tissues and cell lines than normal ovarian tissues and cell line, respectively. Moreover, decreased mir- 363 levels correlated with poor prognosis of OC. MiR- 363 overexpression inhibited cellular proliferation, colony formation, migration and invasion. The mir-363 overexpressing OC cells decreased xenograft tumor growth resulting in smaller tumors in nude mice. MiR- 363 inhibited OC cell proliferation and progression by inhibiting NOB1 expression. The role of mir-363 has focused on cancer diagnosis and treatment. It acts as a tumor suppressor in thyroid [21], head and neck [12], colorectal [13], head and neck [17], breast [16], and renal [14] cancers. In contrast, mir-363 plays an oncogenic role in prostate [18], and gastric [12] cancers. This demonstrates conflicting roles of mir-363 in different cancers. However, the status and role of mir-363 in OC progression is not known. Our study demonstrates tumor suppressor function for mir-363 in OC. Bioinformatics analysis identified NOB1 as a potential target gene of mir-363 based on its role and expression in ovarian cancer. NOB1 is a 50 kda protein subunit of the 26S proteasome complex consisting of PIN and zinc ribbon domains [22]. It is necessary for the function of the 26S proteosomal function [23]. NOB1 expression is upregulated in cervical [24], gastric [25], laryngeal [26], lung [27] prostate [28], and thyroid [29]. NOB1 expression is upregulated in ovarian cancer tissues and its knockdown decreased cell proliferation, colony formation and induced G1-S cell cycle arrest [30].Moreover, it increased TRAIL sensitivity in ovarian cancer cells [31]. MiR-215 inhibited in vitro ovarian cancer cell proliferation, colony formation, migration and invasion, as well as in vivo tumor growth by targeting NOB1 [32]. These results suggested oncogenic

4 role for NOB1 in ovarian cancer. In this study, we identified NOB1 as a target of mir-363. Overexpression of NOB1 partially abrogated the suppression effect on proliferation, colony formation, migration and invasion of OC cells induced by mir-363. Moreover, OC patient samples demonstrated an inverse relationship between NOB1 and mir-363 expression. These data indicated that mir-363 performed tumor suppressor function in ovarian cancer cells by targeting NOB1. Figure 2: MiR-363 inhibits OC cell proliferation and reduces xenograft tumor growth in nude mice. (A) qrt-pcr analysis of mir-363 expression inmir-363 and mir-nc transfected SKOV3 cells. (B) CCK8 assay showing cell proliferation rates of mir-363 and mir-nc transfected SKOV3 cells. (C) Estimation of colonies in SKOV3 cells stable expressing mir-363 and mir-nc. (D) Xenograft tumor volumes in nude mice injected with SKOV3 cells stable expressing mir-363 and mir-nc. Tumor volumes were measured every 5 days until day 30 when mice were sacrificed. (E) Representative images of xenograft tumors derived from SKOV3 cells stable expressing mir-363 and mir-nc. Note: * denotes p<0.05; ** denotes p<

5 Figure 3: MiR-363 inhibitsovarian cancer cell migration and invasion. (A) Wound healing assay showing migration of control and mir-363 overexpressing SKOV3 cells. (B) Transwell assay showing invasiveness of control and mir-363 overexpressing SKOV3 cells. Note: * denotes p<0.05;** denotes p<0.01. Figure 4: NOB1 is the mir-363target in SKOV3ovarian cancer cells. (A) Sequence alignment of putative wild-type (WT) and mutant (MT) mir-363-binding sites in the 3 -UTR of NOB1. (B) Dual luciferase reporter assay showing decreased luciferase activity in SKOV3 cells overexpressing mir-363 in combination with wild type NOB1-3 UTR than in SKOV3 cells overexpressing mir-363 in combination with mutant NOB1-3 UTR. (C) qrt-pcr analysis of NOB1 mrna levels in control and mir-363 overexpressing SKOV3 cells. (D) Western blot analysis of NOB1 protein levels in control and mir-363 overexpressing SKOV3 cells. Note: * denotes p<0.05;** denotes p<

6 Figure 5: NOB1 expression regulates OS progression. (A) qrt-pcr analysis of NOB1 mrna levels in SKOV3 cells co-transfected with NOB1 plasmid without 3 UTR in combination with either mir-363 mimic or mir-nc. GAPDH was used as an internal control. (B) Western blot analysis of NOB1 protein levels in SKOV3 cells co-transfected with NOB1 plasmid without 3 UTR in combination with either mir-363 mimic or mir-nc. (C) CCK8 assay showing cell proliferation in SKOV3 cells co-transfected with NOB1 plasmid without 3 UTR in combination with either mir-363 mimic or mir-nc. (D) Estimation of number of colonies in SKOV3 cells stable expressing mir-363 or mir-nc transfected with NOB1 plasmid without 3 UTR. (E) Wound healing assay estimating migration of SKOV3 cells co-transfected with NOB1 plasmid without 3 UTR in combination with either mir-363 mimic or mir-nc. (F) Transwell assay estimating invasiveness of SKOV3 cells co-transfected with NOB1 plasmid without 3 UTR in combination with either mir-363 mimic or mir-nc. Note:* denotes p<0.05;** denotes p<0.01. Figure 6: NOB1 expression inversely correlates with mir-363 levels in patient OC tissues. (A) qrt-pcr analysis of NOB1 mrna expression in 50 paired OC and adjacent normal tissues. GAPDH was used as an internal control. (B) Immunohistochemical analysis of NOB1 protein expression in OC tissue samples. (C) Spearman s correlation analysis of the association between the NOB1 and mir-363 expression in human ovarian cancer (n=50). Note: * denotes p<0.05;** denotes p<

7 The main limitation of our study is that we analyzed fewer OC patient samples and cell types. Therefore, more elaborate studies are necessary for further explore the potential therapeutic and prognostic role of mir-363 in OC progression. In conclusion, our results demonstrate that mir-363 functions as a tumor suppressor in OC by targeting NOB1 in OC and represents a potential therapeutic target for OC treatment. MATERIALS AND METHODS Clinical samples Fifty pairs of cancer and adjacent normal tissues (>3 cm from cancer tissue) were obtained from 50 OC patients (Mean 61.7 years) that underwent surgical resection at the Department of Obstetrics and Gynecology, The Second Affiliated Hospital of Jilin University, Changchun, China. The tissue samples were snap frozen and stored in liquid nitrogen for further investigation. We excluded patients that received immunotherapy, chemotherapy or radiotherapy before surgical treatment. The disease stages were classified according to the International Federation of Obstetrics and Gynecology (FIGO) criteria. The demographic features and clinicopathological characteristics of all patients are listed in Table 1. Informed consent was signed by each patient before surgery. This study was approved by the Research Ethics Committee of our institute. Cell lines and cell culture The four human ovarian cancer cell lines, SKOV3, A2780, OVCAR and HO-8910, and the human ovarian surface epithelial cell line, HOSEpiC were obtained from Chinese Academy of Sciences, Shanghai, China. All cell lines were grown in RPMI-1640 medium (Gibco-BRL, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum ( FBS; HyClone, Logan, Utah, USA) and 1% penicillin/streptomycin at 37 C and 5% CO 2. Transfection studies Lentiviral vector pgreenpuro (System Biosciences, USA) with hsa-mir-363(mir-363) or hsa-mir-negative control (mir-nc) was packaged in 293T cells using the lentiviral packaging kit (GeneCopoeia, Shanghai, China) according to manufacturer s manual. Stable cell lines were established by infecting SKOV3 cells with lentiviruses encoding mir-363 or mir-nc followed by 2 mg/ml puromycin selection. The stable cell lines were cultured in RPMI-1640 medium containing 10% FBS and puromycin (0.5 mg/ml) for colony formation assay and in vivo experiments. The mir-363 mimic and the corresponding negative control, mir-nc was brought from GenePharma (Shanghai, China). The NOB1 overexpression vector (pcdna3.1-nob1) without 3 UTR was constructed as previously described [32]. mir-363 mimic, mir-nc, or pcdna3.1-nob1 plasmid were transfected into cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer s protocol. Quantitative real-time PCR Total RNA was prepared from the tissue samples and cultured cells with TRIzol reagent (Invitrogen) according to manufacturer s manual. The relative expression of mirna-363 was detected using a SYBR PrimeScript mirna RT PCR kit (Takara, Dalian, China) in accordance with the manufacturer s instructions. For detection of NOB1 mrna expression, first-strand cdna synthesis was performed with MMLV reverse transcriptase (Promega, USA) according to the manufacturer s instructions. Real time PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) in a ABI 7900 Fast system (Applied Biosystems, CA, USA). mir-363 and U6 primers were purchased from Applied Biosystems. The primers for NOB1 and GAPDH were as described in previous studies [29]. The relative expression of mir-363 and NOB1 were normalized to U6 and GAPDH levels, respectively using the 2 -ΔΔCT method. Cell proliferation We determined cell proliferation using the Cell Counting Kit-8(CCK8) assays. Briefly, 2 x 10 3 transfected cells were seeded into 96-well plates and cultured at 5% CO 2 and 37 C for h. At each time point, 10μl of CCK-8 solution(dojindo Laboratories, Kumamoto, Japan) was added and the cells were further incubated for 1 h. The absorbance was read at 450 nm was in a microplate reader (Bio-Tek Company, Winooski, VT, USA). Colony formation assay The SKOV3-miR-363 and SKOV3-miR-NC cells (500 cells/well) were cultured in six-well plates for 14 days. Then, the colonies were fixed in 20% methanol and stained with 0.5 % crystal violet for 15 min. The number of colonies were determined after imaging in a light microscope (Olympus, Tokyo, Japan). Cell migration and invasion assays To determine migratory ability of OC cells, wound healing assays were performed by growing transfected cells ( /well) to confluence in 6-well plates. Subsequently, the cells were scratched with a sterile plastic micropipette tip to generate an homogenous wound in the monolayer. The cells were washed with PBS and cultured under standard conditions for 24 h. Then, the cells were imaged at 0 and 24 h after the wounding with an inverted Nikon Eclipse TS100 phase-contrast microscope (Tokyo,

8 Japan). Wound closure was measured with the Nikon NIS- Element Basic Research v3.2 software (Tokyo, Japan). Cell invasiveness was determined using Transwell assay. Briefly, cells in serum-free media were seeded into the upper chamber that is coated with matrigel. In the lower chamber, RPMI 1640 medium with 20% FBS was added as a chemoattractant. After 24 h, the non-invading cells were gently removed with a cotton swab, whereas cells that invaded the lower surface of the filter were fixed with 70% ethanol for 30 min and stained with 0.1% crystal violet for 10 min. The cells were photographed with an inverted light microscope (Zeiss, Germany) at 200x magnification and the cell numbers were counted in five random fields of view. Dual-luciferase reporter assay The 3 -untranslated region (3 -UTR) of NOB1 with the potential binding sites of mir-363 (position ) was PCR amplified and subcloned into psicheck2 vector (Promega, Wisconsin, WI, USA). It is referred to as WT-NOB1-3 UTR. The mutant 3 -UTR of NOB1 was constructed with QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies; Santa Clara, CA) and subcloned into psicheck2 vector. It is referred to as MT-NOB1-3 UTR. For the luciferase reporter assay, SKOV3 cells were grown to 70-80% confluence and transfected with mir-363 mimic or mir-nc in combination with WT-NOB1-3 -UTR or MT-NOB1-3 - UTR. The firefly and renilla luciferase activities were determined using the Dual-Luciferase Reporter Assay System (Promega). The ratio of firefly to renilla luciferase activities were used to determine if mir-363 regulated NOB1 expression by binding to its 3 UTR. Western blotting Protein extraction and western blotting were performed as previously described [31]. Briefly, cultured cells or tissues were harvested and lysed with RIPA buffer (Beyotime, Jiangsu, China), following by quantification with BCA protein assay kit (Pierce, Bonn, Germany). Protein samples were fractionated by 10% SDS- PAGE, the proteins were blotted onto nitrocellulose membrane (Amersham BioSciences, Buckinghamshire, UK). The membranes were immunoblotted with antibodies against NOB1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and GAPDH (Santa Cruz Biotechnology), followed by HRP-linked secondary antibodies (Santa Cruz Biotechnology). The protein band were detected by SuperSignal West Pico Chemiluminescent Substrate kit (Pierce, Rockford, IL, USA). GAPDH was used as a control. Immunohistochemistry (IHC) Formalin-fixed and paraffin-embedded tumor tissues were cut into 4 μm sections. Then, paraffin sections were deparaffined in xylene and dehydrated in graded ethanol. Heat induced antigen retrieval were performed using Citrate buffer(invitrogen). Non-specific antibody binding were blocked by with 5% skimmed milk. Then, sections were incubated with the primary anti-nob1 antibody (1:400, Santa Cruz Biotechnology) overnight at 4 C. Thefollowing day, the slides were incubated with horseradish peroxidase conjugatedsecondary antibody (ZSGB BIO, Beijing China) for 90 min at room temperature, and aperoxidase-labeled polymer for 10 min at room temperature. The slides were developed with freshly prepared DAB solution for 5 min followed by hematoxylin counterstain. Then, after dehydration and mounting, they were photographed under a light microscope. The NOB1 positive cells were calculated as described previously [29]. In vivo xenograft study Animal study was approved by the Committee on the Use of Live Animals in Teaching and Research of the Animal Research Committee Jilin University, Changchun, China. Tumor xenograft model was established in 6 week old female BALB/c nu/nu mice (Experimental Animal Center of the Jilin University, Changchun, China) by subcutaneously injecting 2x10 6 SKOV3 cells expressing mir-363 or mir-nc into the flank region (n=10 per group). Tumor growth was monitored every 5 days with a fine digital caliper by measuring tumor length(l) and width(w). Tumor volume was calculated as (L W 2 )/2. After 30 days, mice were killed, and the tumors were harvested and weighed. Statistical analysis Statistical Package of the Social Sciences 17.0 for Windows (SPSS, Chicago, IL, USA) was used for statistical analyses. The data shown are presented as the mean ±SD (standard deviation) at least from three independent experiments. Differences between experimental groups were analyzed by Student s t test when only two groups were compared and Tukey s one-way ANOVA when more than two groups were compared. The relationship between mir-363 and NOB1 expression was assessed by Spearman s correlation analysis. A p value less than 0.05(p<0.05) was considered statistically significant. ACKNOWLEDGMENTS This work was supported by Norman Bethune Program of Jilin University ( ). CONFLICTS OF INTEREST The authors declare that they have no conflicts of interest

9 REFERENCES 1. Siegel R, Naishadham D, Jemal A. Cancer statistics, CA Cancer J Clin. 2013; 63: caac Bristow RE. Surgical standards in the management of ovarian cancer. Curr Opin Oncol. 2000; 12: doi.org/ / Harries M, Gore M. Part II: chemotherapy for epithelial ovarian cancer-treatment of recurrent disease. Lancet Oncol. 2002; 3: S (02) Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Microarray analysis shows that some micrornas downregulate large numbers of target mrnas. Nature. 2005; 433: Hobert O. Gene regulation by transcription factors and micrornas. Science. 2008; 319: org/ /science Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116: org/ /s (04) Iorio MV, Croce CM. MicroRNAs in cancer: small molecules with a huge impact. J Clin Oncol. 2009; 27: Garofalo M, Croce CM. micrornas: Master regulators as potential therapeutics in cancer. Annu Rev Pharmacol Toxicol. 2011; 51: annurev-pharmtox Kinose Y, Sawada K, Nakamura K, Kimura T. The role of micrornas in ovarian cancer. Biomed Res Int. 2014; 2014: Wang Y, Kim S, Kim IM. Regulation of Metastasis by micrornas in Ovarian Cancer. Front Oncol. 2014; 4: Wang SH, Zhang WJ, Wu XC, Weng MZ, Zhang MD, Cai Q, Zhou D, Wang JD, Quan ZW. The lncrna MALAT1 functions as a competing endogenous RNA to regulate MCL-1 expression by sponging mir-363-3p in gallbladder cancer. J Cell Mol Med. 2016; 20: org/ /jcmm Zhang PF, Sheng LL, Wang G, Tian M, Zhu LY, Zhang R, Zhang J, Zhu JS. mir-363 promotes proliferation and chemo-resistance of human gastric cancer via targeting of FBW7 ubiquitin ligase expression ; 7: Hu F, Min J, Cao X, Liu L, Ge Z, Hu J, Li X. MiR-363-3p inhibits the epithelial-to-mesenchymal transition and suppresses metastasis in colorectal cancer by targeting Sox4. Biochem Biophys Res Commun. 2016; 474: Li Y, Chen D, Li Y, Jin L, Liu J, Su Z, Qi Z, Shi M, Jiang Z, Ni L, Yang S, Gui Y, Mao X, et al. Oncogenic camp responsive element binding protein 1 is overexpressed upon loss of tumor suppressive mir-10b-5p and mir-363-3p in renal cancer. Oncol Rep. 2016; 35: org/ /or Song B, Yan J, Liu C, Zhou H, Zheng Y. Tumor Suppressor Role of mir-363-3p in Gastric Cancer. Med Sci Monit. 2015; 21: Zhang R, Li Y, Dong X, Peng L, Nie X. MiR-363 sensitizes cisplatin-induced apoptosis targeting in Mcl-1 in breast cancer. Med Oncol. 2014; 31: s Sun Q, Zhang J, Cao W, Wang X, Xu Q, Yan M, Wu X, Chen W. Dysregulated mir-363 affects head and neck cancer invasion and metastasis by targeting podoplanin. Int J Biochem Cell Biol. 2013; 45: org/ /j.biocel Chen Y, Lu X, Wu B, Su Y, Li J, Wang H. MicroRNA 363 mediated positive regulation of c-myc translation affect prostate cancer development and progress. Neoplasma. 2015; 62: Zhang L, Nadeem L, Connor K, Xu G. Mechanisms and Therapeutic Targets of microrna-associated Chemoresistance in Epithelial Ovarian Cancer. Curr Cancer Drug Targets. 2016; 16: Nagaraj AB, Joseph P, DiFeo A. mirnas as prognostic and therapeutic tools in epithelial ovarian cancer. Biomark Med. 2015; 9: Liu J, Li Q, Li R, Ren P, Dong S. MicroRNA-363-3p inhibits papillary thyroid carcinoma progression by targeting PIK3CA. Am J Cancer Res. 2017; 7: Liu K, Chen HL, Wang S, Gu MM, Chen XM, Zhang SL, Yu KJ, You QS. High Expression of RIOK2 and NOB1 Predict Human Non-small Cell Lung Cancer Outcomes. Sci Rep. 2016; 6: Lamanna AC, Karbstein K. Nob1 binds the single-stranded cleavage site D at the 3 -end of 18S rrna with its PIN domain. Proc Natl Acad Sci U S A. 2009; 106: Huang P, Xi J, Liu S. MiR-139-3p induces cell apoptosis and inhibits metastasis of cervical cancer by targeting NOB1. Biomed Pharmacother. 2016; 83: org/ /j.biopha Ji S, Zhang B, Kong Y, Ma F, Hua Y. mir-326 Inhibits Gastric Cancer Cell Growth Through Downregulating NOB1. Oncol Res. 2017; 25: / X Gao X, Wang J, Bai W, Ji W, Wang L. NOB1 silencing inhibits the growth and metastasis of laryngeal cancer cells through the regulation of JNK signaling pathway. Oncol Rep. 2016; 35: or Huang W, Zhong W, Xu J, Su B, Huang G, Du J, Liu Q. Lentivirus-mediated gene silencing of NOB1 suppresses

10 non-small cell lung cancer cell proliferation. Oncol Rep. 2015; 34: Zhang X, Zhang D, Qu F, Hong Y, Cao J, Pan X, Li L, Huang Y, Huang H, Yin L, Chen L, Ren J, Wang Z, et al. Knockdown of NOB1 expression inhibits the malignant transformation of human prostate cancer cells. Mol Cell Biochem. 2014; 396: s z. 29. Lin S, Meng W, Zhang W, Liu J, Wang P, Xue S, Chen G. Expression of the NOB1 gene and its clinical significance in papillary thyroid carcinoma. J Int Med Res. 2013; 41: Lin Y, Peng S, Yu H, Teng H, Cui M. RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells. Med Oncol. 2012; 29: s Lin Y, Xu T, Teng H, Cui M. Anticancer activity of NOB1-targeted shrna combination with TRAIL in epithelial ovarian cancer cells. Int J Clin Exp Pathol. 2015; 8: Lin Y, Jin Y, Xu T, Zhou S, Cui M. MicroRNA-215 targets NOB1 and inhibits growth and invasion of epithelial ovarian cancer. Am J Transl Res. 2017; 9:

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.

More information

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4 European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing

More information

Positive nin one binding protein expression predicts poor outcome in prostate cancer

Positive nin one binding protein expression predicts poor outcome in prostate cancer MOLECULAR MEDICINE REPORTS 11: 2671-2676, 2015 Positive nin one binding protein expression predicts poor outcome in prostate cancer JIE CHEN *, JUNKAI WANG *, XINGANG CUI, YUSHAN LIU, LEI YIN, YAO LI,

More information

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.

More information

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.

More information

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

More information

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.

More information

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Shen Wei 1,a, Chen Juan 2, Li Xiurong 1 and Yin Jie 1 1 Department of Obstetrics and Gynecology,

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4 Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis

More information

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG

More information

LncRNA LET function as a tumor suppressor in breast cancer development

LncRNA LET function as a tumor suppressor in breast cancer development European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.

More information

Long non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer

Long non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer European Review for Medical and Pharmacological Sciences 2017; 21: 3808-3812 Long non-coding RNA Loc344887 is a potential prognostic biomarker in non-small cell lung cancer B. WU 1, X.-J. ZHANG 2, X.-G.

More information

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.

More information

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.

More information

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.

More information

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

ONCOLOGY LETTERS 15: , 2018

ONCOLOGY LETTERS 15: , 2018 10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN

More information

The clinical significance of HPIP and the associated prognosis in cervical cancer

The clinical significance of HPIP and the associated prognosis in cervical cancer /, 2017, Vol. 8, (No. 41), pp: 70262-70270 The clinical significance of HPIP and the associated prognosis in cervical cancer Fanling Meng 1,*, Haixia Liu 1,*, Shuang Liu 1 and Rong Ma 1 1 Department of

More information

mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2

mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2 ONCOLOGY LETTERS mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2 LI YU 1, JUAN LU 1, BAO ZHANG 2, XIONG LIU 1, LU WANG 1, SI-YANG LI 1, XIAO-HONG PENG 1, XIA XU 1, WEN-DONG

More information

LncRNA AB promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5

LncRNA AB promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5 European Review for Medical and Pharmacological Sciences 2019; 23: 2374-2379 LncRNA AB073614 promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5 L.-Y. GUO 1, C.-F.

More information

LncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p

LncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p European Review for Medical and Pharmacological Sciences 2018; 22: 6838-6844 LncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p H.-X. CUI, M.-Y. ZHANG, K. LIU,

More information

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D EXPERIMENTAL AND THERAPEUTIC MEDICINE MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D YUPENG REN, GANG SHI, PENG JIANG and QINGKAI MENG Department

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion

More information

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao

More information

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,

More information

Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome

Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome Int J Clin Exp Pathol 2017;10(2):2030-2035 www.ijcep.com /ISSN:1936-2625/IJCEP0009456 Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical

More information

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906

More information

Long non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer

Long non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer European Review for Medical and Pharmacological Sciences 2017; 20: 479-483 Long non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer Y. CHEN, C.-X. WANG, X.-X. SUN, C. WANG,

More information

Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer

Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer European Review for Medical and Pharmacological Sciences 2016; 20: 5143-5147 Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,

More information

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,

More information

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 ONCOLOGY REPORTS 38: 1977-1984, 2017 mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 Hua Liang, Ruoyu Luo, Xiaoqi Chen, Yuzi Zhao and Aili Tan Department of Obstetrics and Gynecology,

More information

Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma

Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma European Review for Medical and Pharmacological Sciences 2017; 21: 3605-3610 Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma X.-L. MA 1, W.-D. ZHU 2, L.-X. TIAN 2,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.

More information

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients 1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of

More information

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

Association between downexpression of mir-1301 and poor prognosis in patients with glioma

Association between downexpression of mir-1301 and poor prognosis in patients with glioma European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.

More information

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer Sun et al. Journal of Experimental & Clinical Cancer Research (2018) 37:106 https://doi.org/10.1186/s13046-018-0771-x RESEARCH Open Access LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate

More information

RESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells

RESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells RESEARCH COMMUNICATION sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells Wei-Yi Huang, Dong-Hui Chen, Li Ning, Li-Wei Wang* Abstract

More information

Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer

Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer P. Liu 1, F. Xin 1 and C.F. Ma 2 1 Department of Obstetrics & Gynecology, Baoding Second Central Hospital,

More information

High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma

High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma European Review for Medical and Pharmacological Sciences 2018; 22: 7640-7645 High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma X.-H.

More information

Artificial Cells, Nanomedicine, and Biotechnology. ISSN: (Print) X (Online) Journal homepage:

Artificial Cells, Nanomedicine, and Biotechnology. ISSN: (Print) X (Online) Journal homepage: Artificial Cells, Nanomedicine, and Biotechnology An International Journal ISSN: 2169-1401 (Print) 2169-141X (Online) Journal homepage: https://www.tandfonline.com/loi/ianb20 Downregulated MEG3 contributes

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Long non-coding RNA CCAT1/miR-218/ ZFX axis modulates the progression of laryngeal squamous cell cancer

Long non-coding RNA CCAT1/miR-218/ ZFX axis modulates the progression of laryngeal squamous cell cancer 699417TUB0010.1177/1010428317699417Tumor BiologyZhang and Hu research-article2017 Original Article Long non-coding RNA CCAT1/miR-218/ ZFX axis modulates the progression of laryngeal squamous cell cancer

More information

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for

More information

Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell

Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell migration in gastric cancer cell lines Yan-Shen Shan 1, Hui-Ping Hsu 1, Ming-Derg Lai 2,3, Meng-Chi Yen 2,4, Wei-Ching Chen

More information

Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer

Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer Int J Clin Exp Pathol 2017;10(7):7596-7602 www.ijcep.com /ISSN:1936-2625/IJCEP0053748 Original Article Overexpression of mir-96 promotes cell proliferation by targeting FOXF2 in prostate cancer Wu-Ran

More information

Original Article mir-126 inhibits epithelial ovarian cancer growth partially by repression of IRS2

Original Article mir-126 inhibits epithelial ovarian cancer growth partially by repression of IRS2 Int J Clin Exp Med 2016;9(2):1520-1529 www.ijcem.com /ISSN:1940-5901/IJCEM0017368 Original Article mir-126 inhibits epithelial ovarian cancer growth partially by repression of IRS2 Yanli Wang 1, Jihong

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer European Review for Medical and Pharmacological Sciences 2016; 20: 3373-3377 Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer Z.-J. CHEN, Z. ZHANG, B.-B. XIE, H.-Y. ZHANG

More information

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang

More information

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

More information

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.

More information

Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells

Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells Int J Clin Exp Pathol 2018;11(7):3793-3801 www.ijcep.com /ISSN:1936-2625/IJCEP0078547 Original Article Circ-PAX2 promotes proliferation and metastasis by absorbing mir-186 in lung cancer cells Lei Wang

More information

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer The Bosnian Journal of Basic Medical Sciences publishes an Advanced online manuscript format as a free service to authors in order to expedite the dissemination of scientific findings to the research community

More information

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital

More information

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,

More information

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun

More information

LncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer

LncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer European Review for Medical and Pharmacological Sciences 2018; 22: 2328-2333 LncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer Q.-M. SHEN 1,2, H.-Y. WANG 1,2, S. XU

More information

MiR-24 promotes migration and invasion of non-small cell lung cancer by targeting ZNF367

MiR-24 promotes migration and invasion of non-small cell lung cancer by targeting ZNF367 JBUON 2018; 23(5): 1413-1419 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE MiR-24 promotes migration and invasion of non-small cell lung cancer

More information

GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer

GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 6809-6815 GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer M. LIANG 1, X.-C. LIU 1, T. LIU 2, W.-J. LI 3, J.-G. XIANG 1,

More information

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Int J Clin Exp Pathol 2017;10(4):4363-4369 www.ijcep.com /ISSN:1936-2625/IJCEP0043994 Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Rong-Gang Li 1, Zhuo Gao

More information

Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells

Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells Int J Clin Exp Pathol 2017;10(9):10127-10133 www.ijcep.com /ISSN:1936-2625/IJCEP0057301 Original Article mir-181 regulation of BAX controls cisplatin sensitivity of prostate cancer cells Zhi-Ping Cai,

More information

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

TUG1 promotes prostate cancer progression by acting as a cerna of. 1, Department of Breast surgery, China-Japan Union Hospital of Jilin

TUG1 promotes prostate cancer progression by acting as a cerna of. 1, Department of Breast surgery, China-Japan Union Hospital of Jilin Bioscience Reports: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date

More information

Up-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma

Up-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma /, 2017, Vol. 8, (No. 34), pp: 56168-56173 Up-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma Li-Chao Xu 1,*, Quan-Ning

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2016;9(2):2049-2053 www.ijcep.com /ISSN:1936-2625/IJCEP0014841 Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma

Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma European Review for Medical and Pharmacological Sciences 2018; 22: 8624-8629 Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma H.-X. AN 1, B. XU 2, Q. WANG 3, Y.-S.

More information

Original Article Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in non-small cell lung cancer cells

Original Article Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in non-small cell lung cancer cells Int J Clin Exp Med 2015;8(10):18482-18487 www.ijcem.com /ISSN:1940-5901/IJCEM0012566 Original Article Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in non-small cell

More information

Liu et al. Journal of Experimental & Clinical Cancer Research (2016) 35:170 DOI /s

Liu et al. Journal of Experimental & Clinical Cancer Research (2016) 35:170 DOI /s Liu et al. Journal of Experimental & Clinical Cancer Research (2016) 35:170 DOI 10.1186/s13046-016-0445-5 RESEARCH Open Access Tripartite motif containing 62 is a novel prognostic marker and suppresses

More information

Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1

Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1 2148 Downregulation of microrna-196a inhibits human liver cancer cell proliferation and invasion by targeting FOXO1 Liu Yang 1, Fei Peng 2, Jian Qin 3, Henghua Zhou 4 and Bing Wang 3 1 Department of Gastroenterology,

More information

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN J.W. Ling 1, P.R. Lu 2, Y.B. Zhang 1, S. Jiang 1 and Z.C. Zhang 1 1 Department of Ophthalmology, Third Hospital of Zhangjiagang,

More information

Long non-coding RNA XLOC_ correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma

Long non-coding RNA XLOC_ correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma European Review for Medical and Pharmacological Sciences 2017; 21: 4867-4874 Long non-coding RNA XLOC_010235 correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma F. YANG,

More information

Long non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer

Long non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3357-3362 Long non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer H.-H. ZHANG

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information