Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Transcription

1 SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar. 14 days (U2OS) or 10 days (H1299) after plating, colony number was counted. Luciferase reporter constructs: pgl3_rb1_3 UTR: A region in the 3 UTR of human Rb1 containing the mir-335 target sequence was amplified by PCR using oligos GGGAATTCGACGTCGGATTCATTGTCTCTCACAG and GGGAATTCCATATGGGTTATACTTTGCTTCCAGC and cloned into pgl3control (Promega) via AatII and NdeI. pgl3_rb1_3 UTR Δ: a fragments of the 3 UTR of human Rb1 lacking the target site for mir-335 was generated by PCR and cloned into pgl3control (Promega). pgl3-mest-002 Luc (Rep1): GCGGGATCCGGCAAAGGAGTGCTTGAAAC and GCGAAGCTTTAGGAGGAGGAAAGGGCTTC oligos were used to amplify Rep1 by PCR and cloned into pgl3basic (Promega) via BamHI and HindIII. pgl3-mest Luc: GCGAGCTAGCTGTGCTCCTGTTCAACCAAG and GCGGGATCCCGCCTGTCGGTAGAGTTTTC were used to amplify Rep2 by PCR and cloned into pgl3basic via NheI and BamHI. In luciferase reporter assays for E2F activity reporter plasmids containing the promoter region of E2F1 (pgl3- TATA6xE2F1-Luc), CDC25a (pgl3-cdc25a-luc) and Cdc6 (pgl3-cdc6-luc) were used. Chromatin immunoprecipitation (ChIP) 1

2 U2OS cells were treated with Etoposide for 24 hours or left untreated. Chromatin immunoprecipitation experiments were carried out as previously described (1). A polyclonal rabbit anti-human p53 antibody was used in ChIP experiments (Santa Cruz, FL-393). The following oligos were used for quantitative real time PCR on chromatin immunoprecipitates: A: TGATTCCACAATTTACCAGCTC, AATCGCTTTGTGCCAGACTC B: GGTGACAGTGTGTGGGAGAC, CTCCGGCATTGGATAAAGAG; C: CAGCTCGGAACGCTAAGTG, CAGTCTGCCCACTTGATCC; D: AAAAATAGCCTGGGGAGCTG, GGAAATGGCTTTCCGTCTG; p21: AGCAGGCTGTGGCTCTGATT, CAAAATAGCCACCAGCCTCTTCT. Quantitative PCR was performed using the SYBR Green Master Mix (Applied Bisystem) and analyzed a StepOnePlus TM real time PCR machine (Applied Biosystem). Analysis of mrna expression. Total RNA from indicated cell lines was purified using TRIzol reagent (Gibco/BRL). 1,5μg of total RNA was treated with DNAse (RQ1, Promega) and subjected to reverse transcription using oligo-dt primers (Promega) and SuperScriptII Reverse Transcriptase (Invitrogen) according to the manufacturer`s suggestions. Quantitative PCR was performed using the SYBR Green Master Mix (Applied Bisystem) and analyzed a StepOnePlus TM real time PCR machine (Applied Biosystem). mrna levels were normalized with actin. qrt-pcr primer sequences (Eurofins MWG Operon): human actin: CCAACCGCGAGAAGATGA, CCAGAGGCGTACAGGGATAG; human p53: CTCCTCTCCCCAGCCAAAGA, GGAACATCTCGAAGCGCTCA; human MEST3'UTR: GGGAGTGGTGGGTCCAGGTG, CAGTCGTAGCTGGATGTTGG 2

3 Statistical analysis. A one-tiled Student s t-test was used to assess statistical significance of observed differences in all experiments. Graphpad instat v.3.05 was used for statistical calculation. Soft agar colony assays were performed at least twice with three plating replicates. Error bars represent the standard deviation. 3

4 SUPPLEMENTARY FIGURE LEGENDS: Supplementary Figure 1: mir-335 is identical in placental animals and targets human and mouse Rb1. (A) mir-335 sequence is identical in placental mammals. Sequence of mature mir-335 in the listed mammalian species is shown. Accession numbers, sequence and location to chromosomes are indicated. (B) mir-335 targets Rb1. U2OS cells were transiently transfected with mimic mir-335 molecules and subjected to fluorescence immunohistochemistry analysis using specific antibodies against human Rb1. DNA was stained using Hoechst. (C,D) mir-335 targets mouse Rb1 at the posttranscriptional level leading to increased p53 protein levels. NIH 3T3 mouse embryonic fibroblasts (C) and C2C12 mouse myoblasts (D) were transiently transfected with mimic mir-335 and antagomir-335 oligonucleodites and Rb1 and p53 protein levels were measured by western blotting 72hrs post-transfection. Left panels, representative images; right panels, quantification of Rb1 and p53 protein levels normalized with actin; transient transfection of NIH-3T3 and C2C12 cells with mir-335 causes statistical significant changes in Rb1 and p53 protein levels. n, number of independent experiments; error bars refer to standard deviation. A Student`s t-test was used to calculate statistical significance: * p<0.05, ** p<0.01, ***p< Supplementary Figure 2: mir-335 impairs S-Phase entry and cell proliferation. (A) mir-335 impairs cell proliferation. Phase contrast images of U2OS cells transiently transfected with mimic mir-335 and mir-control oligonucleotides 72 hrs posttransfection. (B) Reduced incorporation of BrdU in U2OS cells transiently transfected 4

5 with mimc mir-335 compared to mir-control oligo transfected cells. mir-335 impairs S-Phase entry. Supplementary Figure 3: Rb pathway activity causes an increased expression of p53. (A) Western blotting analysis of U2OS cells transiently transfected with sirnas specific for human Rb1. A reduction of Rb1 levels causes a concomitant increase in p53 protein levels. Left panel, representative western blotting images; right panel, quantification against actin. (B) Western blotting analysis of U2OS cells transiently transfected with an expression vector encoding human Rb1. Increased Rb1 levels drive a concomitant decrease in p53 protein levels. Left panel, representative western blotting images; right panel, quantification against actin. (C) Verification of stable p53 knockdown in U2OS cells by western blotting. Stable expression of shrnas targeting p53 causes an efficient reduction of p53 protein levels (U2OS shp53, clone1, 2) compared to U2OS cells stably expressing control shrnas (U2OS sh Control, clone 1, 2). Left panel, western blotting image; right panel, quantification against actin. Actin was used as a loading control. (D) mir-335 promotes proliferation in p53 deficient MG-63 osteosarcoma cells. Left panel, reduced Rb1 protein levels in mir-335 transfected cells. Actin was used as a loading control. Right panel, growth curve of MG-63 cells transiently transfected with mimic mir-335 or mir-control oligonucleotides. Error bars represent standard deviation. n, number of independent experiments. A Student`s t-test was used to calculate statistical significance * p<0.05, *** p< Supplementary Figure 4: DNA damage induces cell cycle arrest and upregulation of mir-335 expression in a p53 dependent manner. 5

6 (A) FACS cell cycle profile and mir-335 expression levels of U2OS sh Control cells with functional p53 pathway after the treatment with DNA damage inducing agents. Top panel, Treatment with the inhibitor of topoisomerase II Etoposide causes an arrest in S and G2/M phase; DNA damage by Actinomycin D arrests cells in G1 or G2/M whereas the microtubule assembly inhibitor Nocodazole causes arrest in G2/M phase. Bottom panel, an increase in mir-335 levels is detected only upon Etoposide and Actinomycin D treatment which also causes p53 upregualtion (see also Fig 5A). mir- 335 levels were determined by quantitative stem loop RT-PCR (B) FACS cell cycle profile and mir-335 expression levels of U2OS cells with impaired p53 pathway (U2OS shp53) after the treatment with DNA damage inducing agents. Top panel, p53 dependent cell cycle arrest upon Etoposide and Actinomycin D treatment is less pronounced in U2OS shp53 cells. Arrest in G2/M phase by Nocodazole is unaffected upon reduced p53 levels in U2OS shp53 cells. Bottom panel, lack of mir-335 upreguation of U2OS shp53 cell upon Etoposide and Actinomycin D. mir-335 levels were determined by quantitative stem loop RT-PCR. Percentage of cells in individual cell cycle phases are indicated. Eto, Etoposide; Act-D, Actinomycin D; Noc, Nocodazole; Ctrl, untreated cells. (C) Left panel, FACS cell cycle profiles of MG-63 cells lacking functional p53 upon the treatment with Etoposide or Actinomycin D. Lack of p53 dependent cell cycle arrest causes the accumulation of cells in G2 phase and increased polyploidy. Central panel, determination of mir-335 expression levels in MG-63 cells after the treatment with Ectoposide or Actinomycin D by quantitative stem loop RT-PCR. Upregualtion of mir-335 upon treatment with DNA damaging agents Etoposide and Actinomycin D is dependent on p53. Right panel: Representative agarose gel after quantitative mir-335 RT-PCR showing absolute mir-335 levels after inducing DNA damage in MG-63 cells. p53 is required to upregulate mir-335 upon DNA 6

7 damage. In FACS profiles % of cells in respective cell cycle phases are indicated. Error bars indicate standard deviation. n, number of independent experiments. Supplementary figure 5. p53 increases mir-335 levels by inducing transcription of the mir-335 encoding gene MEST. (A) p53 increases mir-335 levels by inducing MEST expression. MG-63 cells were transiently transfected with wild type p53 and quantitative real time PCR was used to measure MEST and mir-335 expression levels. p53 expression efficiently indices MEST transcription resulting in a concomitant increase in mir-335. Actin and the snorna RNU48 was used as a loading control. (B) Simplified map on the promoter region of the human MEST gene. Arrowheads show the transcriptional start sites of the major MEST transcripts MEST-002; MEST-201 and MEST-001. Individual putative p53 binding sites are marked by asterisks (*) linked to a vertical line ( ). The nucleotide positions of individual p53 binding sites are indicated. The location of PCR amplicons (A, B, C and D) used to detect putative p53 binding regions in chromatin immunoprecipitation are indicated by blue bars. Bold bars indicate fragments of the MEST locus used in luciferase reporter assays to identify a p53 responsive promoter. Location of mir-335 in intron 2 of the MEST gene (position 9906) is indicated. Splicing pattern of MEST-002 is shown (top). (C) Luciferase reporter assay identifies a p53 responsive promoter driving the expression of MEST-002. Genomic regions at transcriptional start sites of MEST-002 (Rep1) and MEST-201/001 (Rep2) were used to generate firefly luciferase reporter constructs (see Material and Methods). A wild type p53 or a control plasmid was cotransfected with individual MEST reporter constructs and renilla luciferase into MG-63 cells and luciferase activity was assessed. p53 activates transcription from Rep1 indicating that the expression of MEST-002 is 7

8 dependent on p53. Rep2 and empty vector do not show luciferase activity. Firefly luciferase was normalized with co-transfected Renilla luciferase. (D) p53 is not enriched at putative p53 binding sites in MEST promoter regions upon DNA damage. U2OS cells were untreated or treated with Etoposide for 24 hrs to induce p53 expression and chromatin immunoprecipitation experiments were carried out to detect p53 at consensus p53 binding sites in the promoter region of the MEST locus. Etoposide treatment causes a 10 fold enrichment of p53 at the p21 promoter (p21 bs1) compared to untreated control cells. p53 is not enriched at putative p53 binding sites mesta, mest B, mest C and mest D upon DNA damage. n, number of independent experiments; error bars indicate standard deviation; A Student`s t-test was used to calculate statistical significance, *** p< Supplementary Figure 6: mir-335 is important for p53 dependent DNA stress response. FACS cell cycle profiles of U2OS cells stably overexpressing a scrambled control mirna, antagomir-335 or mir-335, untreated or treated with Etoposide for 24h. Overexpression of mir-335 causes delayed S-Phase entry in untreated cells. Overexpression of antagomir-335 antagonizes mir-335 upregulation upon treatment with Etoposide and impairs cell cycle arrest as indicated by an increased percentage of cells in S-Phase. In FACS profiles % of cells in respective cell cycle phases are indicated. Supplementary figure 7: The mir-335 Rb axis activates the p53 pathway without altering ARF expression and E2F activity. 8

9 (A) ARF protein levels in U2OS cells transiently transfected with mimic mir-335 as detected by Western blotting. Increased mir-335 levels do not impact on ARF expression. Treatment of U2OS with the de-methylating agent 5-aza cytidine (5-azadCT) for 3 days releases silencing of the p14 ARF gene promoter resulting in increased ARF protein levels. Actin was used as loading control. (B) Reporter assays for E2F activity in U2OS cells with ectopically increased mir-335 levels. U2OS cells were cotransfected with a mimic mir-335 molecules and luciferase reporters containing E2F responsive promoter elements of the E2F, CDC25 and CDC6 genes. mir-335 transfected cells do not show increased E2F activity compared to cells transfected with mir-control molecules. Overexpression of E2F1 results in massive activation of reporter genes. Renilla luciferase was co-transfected in all experiments to control for transfection efficiency. (C) mir-335 does not significantly affect p53 RNA levels. U2OS cells were transiently transfected with mimic mir-335 and mir-control molecules and p53 RNA levels were measured by quantitative real time PCR. Ectopically increased mir-335 levels do not significantly alter p53 RNA levels. Actin was used as a loading control. n, number of independent experiments; error bars indicate standard deviation. SUPPLEMENTARY REFERENCES 1. Drost J, Mantovani F, Tocco F, et al. BRD7 is a candidate tumour suppressor gene required for p53 function. Nat Cell Biol