Collagen matrices from 12.5 hr of invading cultures in the presence of 1 µm S1P (S1P) or S1P plus 0.1

Transcription

1 Two-Dimensional Gel Electrophoresis Collagen matrices from 12.5 hr of invading cultures in the presence of 1 µm S1P (S1P) or S1P plus.1 µg/ml pertussis toxin (S1P+PTx), or in the absence of S1P (Control) were collected and incubated in M199 containing 1µg/mL collagenase (Sigma), Complete Protease Inhibitor Cocktail (Roche Diagnostics) and HALT Phosphatase Inhibitor Cocktail (Thermo Scientific) at 37 o C for 1 min. For each condition, 24 matrices were prepared and 3, cells were seeded on each matrix. Cells were pelleted at 5 X g for 5 min from the medium containing the dissolved gels and washed once in ice-cold PBS. Cell pellets were flash-frozen in liquid nitrogen and stored at -8 o C. Frozen cell pellets were lysed by thawing and pipetting on ice in 1 ml of lysis solution I (.3% SDS; 2 mm dithiothreitol; 5 mm Tris, ph 7.5; broad range protease inhibitors [GE Healthcare]; HALT Phosphatase Inhibitor Cocktail [Thermo Scientific]). Proteins were further solubilized by heating at 1 o C for 1 min followed by incubating on ice for 5 min. Lysates were sonicated with a 15 sec burst (amplitude setting 6) on ice using a Sonics Vibracell sonicator to further fragment DNA and cytoskeletal structures. Nucleic acids were digested by adding DNase/RNase mix (GE Healthcare) and rotating the lysates at 4 o C for 45 min. Lysates were delipidated in chloroform-methanol by adding 4 ml of methanol and vortexing for 3 sec, followed by adding 1 ml of chloroform and vortexing for 3 sec, and finally by adding 3 ml of Millipore-purified water and vortexing for 6 sec. Samples were rotated at room temperature for 15 min, transferred to corex glass tubes, and centrifuged at 65 rpm in a Sorvall JA2 rotor for 2 min at room temperature. The interphase contained the proteins, which was transferred to a microfuge tube and mixed with.5 ml of methanol. After spinning for 1 min in a microfuge, the pellets were resuspended in.6 ml of water and proteins re-precipitated by adding a.8 volume of ice-cold acetone and incubating on ice for 15 min. Proteins were pelleted out of the acetone solution by spinning in a microfuge for 15 min and resolubilized in 1 μl of a 2D gel proteomic solubilization buffer (9.9 M urea; 4% CHAPS; 14% thiourea; 4.8% SDS; 1 mm Tris, ph 7.5; 4 mm DTT). Proteins were allowed to solubilize for 1 hr by rotating at room temperature and then desalted through microspin Pierce desalting columns into desalting solution

2 (9.9 M urea; 4% CHAPS). Protein concentrations were determined by the BCA protein assay after pretreating and re-precipitating an aliquot of each sample with BCA compatibility reagent and Compat-Able protein assay preparation set (Pierce cat. #2325 and #23215, respectively) to eliminate interference of the BCA protein reagent with thiourea. After determining the protein concentration, the samples were adjusted to 5 mg protein/1 ml desalt buffer I and subjected to a second spin through a desalting microspin column. Protein lysates (~1 μl) were mixed with 4 μl of Destreak Rehydration sample buffer (GE Healthcare Life Sciences) containing.77 mg of DTT. Protein samples were solubilized by rotating for 1 hr at room temperature. After adding another.77 mg DTT and ampholytes (Biorad 1X Bio-Lyte pi 3-1 ampholytes), samples were rotated for 3 min at room temperature and then allowed to rehydrate ph 3-1 Immobiline dry-strip gel strips (GE Healtcare Life Sciences) for 18 hrs. Rehydrated Immobiline dry strips were subjected to step-wise isoelectric focusing at 15 V for 6 hr, 5 V for 1 hr, 1 V for 1 hr, and 8 V for 6 hr in an Ettan IPGphorII unit. Proteins were then separated in the second dimension on large format (27 x 21 cm) 8-16% gradient SDS polyacrylamide gels at 5 W/gel for 9.5 hr. Gels were counter-stained with Sypro Red for 6 hrs in 7.5% acetic acid, destained for 1 hr in 7.5% acetic acid, and imaged in a Typhoon 92 laser scanner. Image analysis was performed using the Biological Variation Analysis (BVA) modules of the DeCyder software version 5. (GE Healthcare). Comparing each group in the BVA module generated average expression ratios and Student s t-tests of individual protein spots. In-Gel Digestion Spot-picking and in-gel digestion were carried out robotically on selected Sypro Red-stained preparative gels using the Ettan Spot Picker and the Ettan Digester (GE Healthcare). For in-gel digestion, protein spots of interest (1.4 expression ratio or greater) were excised and the gel plugs washed twice for 15 min each in 5% Acetonitrile (ACN)/5mM Ammonium Bicarbonate (ABC). The plugs were washed one

3 more time with 1% ACN for 15 min and then dried by centrifugal lyophilization for 3 min. In-gel digestion was conducted by adding 2 μl of trypsin (2ng/mL) and incubating for 15 min. After adding 1 μl of 25 mm ABC, the gel plugs were incubated at 37 o C overnight. The supernatants were removed and saved. A solution of 8% ACN/.1% Trifluoracetic acid was added to the gel plug for 3 min. The supernatant was then removed and pooled with the first supernatant. The peptide volume reduced down to 1 μl by centrifugal lyophilization and then subjected to LCMS. Protein Identification LCMS was carried out on a ThermoFinnagan (Thermo Electron) LCQDecaXP (ESI-TRAP model). Samples were run using an in-house packed C18 reverse phase nanospray needle. Mass spectra were used to interrogate human sequences in the NCBInr database (5/29; 478,579 entries human database). The automatic data analysis and database searching were fulfilled by the SEAQUEST software in the Bioworks Browser (version SP1). Searches with SEQUEST were performed to allow for a maximum of two missed trypsin cleavages. Additional SEQUEST search parameters were as follows: mass type setting was monoisotopic precursor and fragments; threshold tolerance was 5,; peptide tolerance, precursor ion tolerance, and fragment ion tolerance were 2.5, 1.4 and.1 AMU, respectively. Ions and ion series calculated were B and Y ions. Searches were also conducted using the MASCOT search engine ( The database searched by MASCOT was NCBInr ( sequences; residues) and the taxonomy was Homo sapiens (human) ( sequences). MASCOT search parameters were as follows: fixed modifications, carboxymethyl; variable modifications, oxidation (M); mass values, monoisotopic; protein mass, unrestricted; peptide mass tolerance, ± 1.8 Da; fragment mass tolerance: ±.8 Da. The search identification had a statistically significant p<.5 (based on mass/mass spectra). Redundancy of proteins that appeared in the database under different names and accession numbers was eliminated. If more than one protein was identified in one spot, the single protein member with the highest protein score (top rank) was singled out from the

4 multiprotein family. The molecular weight and pi values of most proteins were consistent with the gel regions from which the spots were excised. shrna sequences: For gene silencing, HUVECs were infected with plko.1-puro lentiviral vectors encoding shrnas against human annexin A2, β2-microglobulin, GFP, VE-cadherin, and PECAM1 (Sigma). For annexin 2 or VE-cadherin knockdown, findings were reproduced by two distinct shrnas. Annexin A2: CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG β2-microglobulin : CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG GFP: CCGGTACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTATTTTTG VE-cadherin: CCGGCGCCTCTGTCATGTACCAAATCTCGAGATTTGGTACATGACAGAGGCGTTTTTG CCGGCGTGGATTACGACTTCCTTAACTCGAGTTAAGGAAGTCGTAATCCACGTTTTTG PECAM1 CCGGCGGAGTGATCATTGCTCTCTTCTCGAGAAGAGAGCAATGATCACTCCGTTTTTG SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Identification of annexin 2. (A) 2D SDS-PAGE analyses of proteins extracted from invasion cultures in the presence of S1P (S1P) or S1P plus pertussis toxin (S1P+PTx), or in the absence of S1P (Control) were performed. The circle highlights the variation that is identified as annexin

5 2 by mass spectrometry. (B) Photographs depicting invasion responses (side-view). Cultures were fixed at 12.5 hrs, stained with toluidine blue and photographed. Scale bar represents 5 μm. (C) Verification of regulated protein expression of annexin 2. Collagen matrices containing invading cells were collected at 12.5 hr, placed in boiling Laemmli sample buffer, and heated at 95 C for 1 min prior to Western blot analyses using antibodies against annexin 2. The expression of actin was used as a loading control. Supplemental Figure 2. EC invasion is dependent on intact adherens junctions. (A) Photographs illustrating the invasion responses (side-view, upper panel; top-view, lower panel). The indicated concentrations of EGTA were administered to EC suspensions for 1 min prior to seeding on 3-D collagen matrices. Cultures were allowed to invade for 24 hr with the indicated concentrations of EGTA, fixed, and stained with toluidine blue for imaging. (B, D, F) Quantification of EC invasion density after 24 hrs of invasion. Data represent average numbers of invading cells per standardized field (n=3 fields). (C) ECs were incubated with 5 μg/ml VE-cadherin antibody (61252, BD Transduction Laboratories), 5 μg/ml isotype control antibody (ab18414, Abcam), or PBS containing.1% BSA only (vehicle) for 3 min prior to seeding on collagen matrices. Cells were allowed to invade in the presence of indicated antibodies for 24 hr, fixed, and stained with toluidine blue. (E) ECs were transduced with lentiviruses expressing indicated shrnas for 3 days and subsequently used for invasion assays. Invasion cultures were fixed at 24 hr, and stained with toluidine blue for imaging. Scale bar, 1 μm. Supplemental Figure 3. Annexin 2 depletion does not alter Rac1 activation. (A) EC monolayers were serum-starved for 6 hr and exposed to epidermal growth factor (EGF; 2 nm) or S1P (1 µm) for indicated times. Equal amounts of extracts were prepared and incubated with GST-PAK-PBD protein agarose beads. Eluates and starting lysates were analyzed by Western blot analyses. (B) ECs were transduced with lentiviruses expressing indicated shrnas for 3 days, serum-starved for 6 hr and treated with or without S1P (1 µm) for 15 min. Extracts were collected and incubated with GST-PAK-PBD protein agarose beads. Eluates and starting lysates were analyzed by Western blot analyses. Blots are representatives of three independent experiments. Densitometric analyses represent means ± SEM (n=3).

6 Supplemental Figure 4. Expression and localization of claudin-5 in annexin 2-depleted HUVECs. (A) Western blot analyses of claudin-5 expression in extracts of confluent HUVEC monolayers expressing shrna directed to B2M-, annexin 2-, and VE-cadherin. HUVECs were transduced with lentiviruses expressing indicated shrnas for 3 days and extracts were collected for Western blot analyses. (B) Immunofluorescence microscopy of B2M-, annexin 2-, VE-cadherin-depleted HUVECs. ECs were transduced with lentiviruses expressing indicated shrnas for 3 days and reseeded on glass coverslips for culture overnight prior to fixing and staining with anti-claudin-5 (red) and anti-ve-cadherin (green). Images were analyzed using epi-fluorescence microscopy. Scale bar, 5 μm. Supplemental Figure 5. Reintroducing constitutively active Akt compensates for VE-cadherin depletion and rescues EC invasion. (A) Quantification of EC invasion density. ECs were transduced with lentiviruses producing indicated shrnas for 3 days, and subsequently administered lentiviruses expressing myr-akt or GFP for an additional three days. Cultures were allowed to invade for 24 hrs, fixed, stained, and quantified. Data represent average numbers of invading cells per standardized field (n=3 fields, Students t-test, *p<.5, versus that of cells depleted of VE-cadherin but expressing GFP). (B) Photographs depicting invasion responses (side-view). Cultures were fixed at 24 hrs, stained with toluidine blue and photographed. Scale bar represents 1 μm. (C) FITC-dextran flux permeability assay. ECs were transduced with recombinant lentiviruses that express myr-akt or GFP for 3 days. Subsequently, cells were seeded on Transwell inserts, transduced with lentiviruses expressing shrnas indicated and grown to confluence. EC monolayers were serum-starved for 6 hrs and treated with 1 µm S1P for 1 hr prior to adding FITC-labeled dextran into the upper chambers. Endothelial permeability (fluorescence in the lower chamber) was measured at 1 hr after the addition of FITC-dextran. Data presented are average values ± SEM from three experiments (n=4, Students t-test, * p<.5, ** p<.1, compared with GFP controls).

7 Supplemental Figure 1 A B C annexin 2 actin

8 Supplemental Figure 2 A EGTA (nm) 2 (nm) 4 (nm) B Invading cells EGTA (nm) C Vehicle VE-cad Ab Isotype Ab D Invading cells vehicle VEcad Ab Isotype Ab E shve-cad shpecam-1 F Invading cells shvecad shpecam1

9 Supplemental Figure 3 A GST-PAK-PBD Pull Down Lysate Ctl EGF S1P (min) Rac1 actin B GST-PAK-PBD Pull Down lysate shanxa2 shvecad shanxa2 shvecad S1P (min) Rac1 B2M annexin 2 VE-cad Relative active Rac1/ total Rac1 levels (a.u.)

10 Supplemental Figure 4 A Claudin-5 VE-cadherin Overlay shve-cad shanxa2 shanxa2 shve-cad claudin-5 VE-cad annexin 2 B B2M actin

11 Supplemental Figure 5 A Invading cells shve-cad GFP GFP * shve-cad myrakt myrakt C Relative Fluorescence Units (RFUs) ** * shvecad B