Apolipoprotein (apo) A-II is a major protein constituent of

Transcription

1 Clinical Investigation and Reports Human Evidence That the Apolipoprotein A-II Gene Is Implicated in Visceral Fat Accumulation and Metabolism of Triglyceride-Rich Lipoproteins Ferdinand M. van t Hooft, MD, PhD; Giacomo Ruotolo, MD, PhD; Susanna Boquist, MD, PhD; Ulf de Faire, MD, PhD; Gösta Eggertsen, MD, PhD; Anders Hamsten, MD, PhD Background Apolipoprotein (apo) A-II is a major structural protein of plasma HDLs, but little is known regarding its functions. Methods and Results To investigate the physiological role of apoa-ii in humans, we screened the promoter region of the apoa-ii gene for a functional polymorphism and used this polymorphism as a tool in association studies. A common, functional polymorphism in the promoter region of the apoa-ii gene,attocsubstitution at position 265, was found. Electrophoretic mobility shift assays demonstrated that the 265T/C polymorphism influences the binding of nuclear proteins, whereas transient transfection studies in human hepatoma cells showed a reduced basal rate of transcription of the 265C allele compared with the 265T allele. The 265C allele was associated with decreased plasma apoa-ii concentration and decreased waist circumference in healthy 50-year-old men. In addition, oral fat tolerance tests provided evidence that the 265C allele enhances postprandial metabolism of large VLDLs. Conclusions ApoA-II appears to promote visceral fat accumulation and impair metabolism of large VLDLs. (Circulation. 2001;104: ) Key Words: lipoproteins apolipoproteins metabolism genetics obesity Apolipoprotein (apo) A-II is a major protein constituent of HDLs, but relatively little is known about the role of this apolipoprotein in HDL metabolism. 1 Increased plasma apoa-ii concentrations were proposed to be proatherogenic, 2 given that HDL particles that contain both apoa-i and apoa-ii are less effective than HDL particles that contain apoa-i for mobilization of cellular cholesterol from nonhepatic cells. 3,4 However, additional properties of apoa-ii have been reported, such as the ability to influence actions of hepatic lipase, 5,6 cholesterol ester transfer protein, 7 phospholipid transfer protein, 8 lecithin-cholesterol acyltransferase, 9 and class B type I scavenger receptor. 10 Moreover, studies in either human or murine apoa-ii transgenic mice 9,11 17 and apoa-ii knockout mice 18 indicate that apoa-ii is involved in plasma clearance of triglyceride-rich lipoproteins; influences plasma levels of free fatty acids, glucose, and insulin; and affects adipose mass, which suggests a role of apoa-ii in insulin sensitivity and fat homeostasis. Thus, murine data indicate that apoa-ii has a complex metabolic role, but whether apoa-ii has similar functions in humans is not clear. The aim of the present study was to uncover and to characterize a physiologically relevant polymorphism in the promoter region of the apoa-ii gene that influences apoa-ii production and to use this polymorphism as a tool to examine the overall role of apoa-ii in lipid and glucose metabolism in vivo in humans. Methods Subjects A total of 624 healthy men, all 50 years of age, 19 were included in the present study. Selection of men of identical age was intended to eliminate the confounding effect of age and sex on lipoprotein and glucose metabolism. Plasma apoa-ii concentration for each subject was measured by immunoturbidometric assay (Behringwerke AG). Plasma insulin was determined by ELISA (Dako Diagnostics). Plasma lipoproteins and whole-blood glucose were measured as described. 19 ApoB-48 and apob-100 concentrations in triglyceriderich lipoprotein fractions, isolated in the course of an oral fat tolerance test, were determined by SDS PAGE. 19 The protocol was approved by the Ethics Committee of the Karolinska Hospital, and all subjects gave informed consent to participate. Gene Sequencing For nucleotide sequencing of the promoter of the apoa-ii gene, a 1219-bp section spanning from position 1148 to 71 was amplified by polymerase chain reaction (PCR) with forward primer 5 -GCCGAGATCATGCCATTAC and reverse primer 5 - ATGCTGCTCACACATCTTGC. This PCR fragment was used as a Received May 29, 2001; revision received July 9, 2001; accepted July 9, From the Atherosclerosis Research Unit (F.M.v.H., G.R., S.B., A.H.), Department of Medicine, Karolinska Hospital; the Division of Cardiovascular Epidemiology (U. de F.), Institute of Environmental Medicine; and the Division of Clinical Chemistry (G.E.), Department of Laboratory Sciences, Huddinge University Hospital, Karolinska Institutet, Stockholm, Sweden. Correspondence and reprints requests to Dr Ferdinand M. van t Hooft, King Gustaf V Research Institute, Karolinska Hospital, S Stockholm, Sweden. Ferdinand.vant.Hooft@medks.ki.se 2001 American Heart Association, Inc. Circulation is available at

2 1224 Circulation September 11, 2001 template for further amplifications as part of the Taq DyeDeoxy terminator cycle-sequencing system (Perkin-Elmer Corp). Genotyping DNA was isolated by use of a genomic DNA isolation kit (Qiagen Inc). The 265T/C polymorphism in the apoa-ii promoter was analyzed by use of a PCR-fragment amplified with forward primer 5 -CATGGGTTGATATGTCAGAGC and reverse primer 5 - TCAGGTGACAGGGACTATGG followed by digestion with restriction enzyme BsmI. The 932G/A, 974C/G, 978G/C, and 1099T/C polymorphisms all were analyzed by use of a PCR fragment amplified with forward primer 5 -GCCGAGATCATGC- CATTAC and reverse primer 5 -CACCTGGTCATTTGATCACC followed by digestion with restriction enzymes MwoI, HphI, MaeIII, and BsmBI, respectively. ApoE genotype was determined as described. 20 DNA Constructs Two sets of double-stranded oligonucleotides were constructed, which constituted the 27-bp sequence around the 265T/C polymorphism flanked by BamHI and BglII ends. Double-stranded oligonucleotides were ligated head to tail into a BamHI-digested human cationic amino acid transporter vector. 21 Promoter cationic amino acid transporter (pcat) plasmids were also constructed by use of an 1186-bp promoter fragment spanning from 1148 to 38 and ligated into a pcat-basic vector as described by the supplier (Promega Corp). The promoter fragment was obtained by PCR amplification of DNA from a subject homozygous for the 265C allele with forward primer 5 -AACTGCAGGCCGAGATCATGC- CATTAC and reverse primer 5 -GCTCTAGACTAGCC- AGCGTCTCTGTCC. Wild-type plasmid and plasmids specific for the 978C and 1099C mutations were generated with the Quick- Change site-directed mutagenesis kit (Stratagene Cloning Systems), by use of the pcat plasmid described above. Electrophoretic Mobility Shift Assay Electrophoretic mobility shift assay (EMSA) was conducted as described. 22 Nonradioactive competitor DNAs, either identical, of the opposite allelic variant, or of nonspecific origin, were added in 100-fold excess of the labeled DNA. The 265T/C polymorphism was evaluated by use of 3 different nuclear extracts, 2 different sets of oligonucleotides, and 4 different annealing reactions in 8 separate experiments. Transient Transfection Assay Human hepatoma (HepG2) cells were transfected by use of the calcium-phosphate DNA coprecipitation method. 23 In all experiments, 5 g of CAT construct and 5 g of psv- -galactosidase plasmid (Promega) were added to the medium. CAT activity was analyzed as described 23 and quantified by use of a phosphorimager. -galactosidase activity was determined as described by the supplier (Promega). CAT levels were expressed in arbitrary units after standardization for -galactosidase activity. All constructs were tested in triplicate in 4 to 8 independent experiments. Statistical Methods Allele frequencies were compared by gene counting and 2 analysis. Differences in transcriptional activity were determined by Student s paired t test, whereas differences in continuous variables according to apoa-ii 265T/C genotype were tested by 1-way ANOVA. The Tukey-Kramer test was used for post hoc analysis when differences between groups were indicated by ANOVA. Responses to the oral fat load according to apoa-ii genotype were compared by repeated measures ANOVA. Results Polymorphisms in Proximal Promoter of ApoA-II Gene Five different polymorphisms were discovered: 265T/C, 932G/A, 974C/G, 978G/C, and 1099T/C. The Figure 1. Reduced transcriptional activity of the 265C allele. A, CAT activities of constructs harboring 30-bp fragments of the 265T site or the 265C site were compared in triplicate in 6 independent transfection studies with HepG2 cells. CAT activities of the 265C construct were expressed relative to the 265T construct. B, CAT activities of 1186-bp long apoa-ii promoter constructs that contain the 265C, 978C, or 1099C mutations were compared in triplicate in 4 independent transfection studies with HepG2 cells. CAT activities of constructs were expressed relative to activity of the hypothetical wild-type promoter with the 265T/ 978G/ 1099T haplotype. 265T/C (allele frequencies 0.63/0.37), 978G/C (0.64/ 0.36), and 1099T/C (0.73/0.27) polymorphisms were found to be common, whereas the 932G/A (0.98/0.02) and 974C/G (0.98/0.02) polymorphisms were relatively rare. The rare 932A and 974G alleles invariably were found in conjunction with the 978C allele. Mutant alleles of the common 265T/C, 978G/C, and 1099T/C polymorphisms were in almost complete negative linkage disequilibrium, which indicates the presence of 3 predominant haplotypes: 265C/ 978G/ 1099T, 265T/ 978C/ 1099T, and 265T/ 978G/ 1099C. 265T/C Polymorphism Influences Basal Rate of Transcription of the ApoA-II Gene HepG2 cells were transfected with minimal promoter constructs harboring 27-bp fragments of the apoa-ii promoter that contained either the 265T or 265C sites. As shown in Figure 1A, significantly lower CAT activities were observed for the construct that contained the 265C site versus constructs that contained the 265T site (71 20%, P 0.02). Additional transfection studies were conducted with plasmids that contained a 1186-bp apoa-ii promoter fragment harboring the 265C, 978C, or 1099C mutations introduced by site-directed mutagenesis. As shown in Figure 1B, significantly lower CAT activities were observed for the 265C construct compared with both the 978C (71 21% versus

3 van t Hooft et al Functional Apolipoprotein A-II Polymorphism 1225 Figure 2. Differential binding of nuclear proteins to the 265T and 265C sites. A, EMSA of nuclear extract derived from HepG2 cells bound to a 27-bp DNA fragment containing either the 265T (lanes 1to4)or 265C (lanes 5 to 8) site of apoa-ii promoter. Lanes 1 and 5 are without extract; lanes 2 and 6, with 50 g/ml of HepG2 extract; lanes 3 and 7, with 100 g/ml of HepG2 extract; and lanes 4 and 8, with 200 g/ml of HepG2 extract. Arrows 1 and 2 indicate protein- DNA complexes associated with the 265T/C site. B, Quantitative analysis of protein-dna complexes indicated with arrow 1 (left) and arrow 2 (right) in A. Protein-DNA complexes were quantified in 4 independent experiments by phosphorimager. Significant differences in intensities were observed at all 3 HepG2 concentrations tested (P 0.05) for the protein-dna complex 2 (right) %, P 0.01) and 1099C (71 21% versus %, P 0.04) constructs. Allele-Specific Binding of Nuclear Proteins to 265T/C Polymorphic Site Binding characteristics of a 30-bp DNA fragment that contained either the 265T or 265C site of the apoa-ii promoter were evaluated by use of nuclear extracts derived from HepG2 cells. As shown in Figure 2A, increased concentrations of 2 major DNA-protein complexes (arrows 1 and 2) were observed with increased nuclear extract concentrations. The DNA-protein complex indicated by arrow 2 in Figure 2A was present at considerably higher concentrations when the 265C fragment was compared with the 265T fragment. Quantitative analysis of this complex demonstrated significant differences between the 265C and 265T fragments at all nuclear extract concentrations tested (Figure 2B, right). In contrast, no quantitative differences were observed (Figure 2B, left) for the DNA-protein complex indicated by arrow 1 in Figure 2A. Competition studies (Figure 3) showed that a 100-fold excess of unlabeled 265T and 265C fragment substantially reduced the concentration of the radiolabeled DNA-protein complex 1, but no allele-specific differences were observed. In contrast, a 100-fold excess of unlabeled 265C fragment substantially reduced the concentration of DNA-protein complex 2 when the labeled 265C fragment was analyzed (Figure 3, lane 7), whereas a 100-fold excess of unlabeled 265T fragment had only a marginal effect on the concentration of DNA-protein complex 2 (Figure 3, lane 8). 265C allele Is Associated With Lower Plasma ApoA-II Concentration, Lower Waist Circumference, and Enhanced Postprandial Metabolism of Large VLDLs Relationships between the 265T/C polymorphism and clinical and biochemical parameters were analyzed in a group of 624 healthy, 50-year-old men (Table). Plasma apoa-ii concentration was significantly lower in carriers of the 265C allele than in carriers of the 265T allele. In contrast, no relationships were found between the 265T/C genotype and fasting plasma concentrations of major lipoproteins. On the other hand, a significant relationship was found between the 265T/C polymorphism and waist circumference, whereas no associations were observed between 265T/C genotype and either blood glucose or plasma insulin concentrations. Overall response of plasma triglycerides during the entire 6-hour postprandial period was unassociated with the 265T/C polymorphism in 97 subjects with an apoe3/3 genotype (T/T, n 39; T/C, n 42; and C/C, n 16). However, postprandial apob-100 concentrations in the Sf 60 of triglyceride-rich lipoproteins (a measure of large VLDL particles) were significantly lower in subjects homozygous Figure 3. Binding of nuclear proteins to the 265C allele is specific. EMSA of nuclear extract derived from HepG2 cells bound to the 265T (lanes 1 to 5) or 265C (lanes 6 to 9) site in presence of unlabeled DNA as competitor. Arrows indicate protein- DNA complexes associated with 265T/C site as indicated in Figure 2A. Lanes are as follows: 1, without extract; 2 and 6, 200 g/ml of HepG2 extract in the absence of competitor; and 3 to 5and7to9,200 g/ml of HepG2 extract in presence of 100- fold excess of unlabeled DNA as competitor. Competitors were as follows: 265T site (lanes 3 and 8), 265C site (lanes 4 and 7), and unrelated 27-bp fragment (lanes 5 and 9). A longer exposure time was used than in the experiment shown in Figure 2.

4 1226 Circulation September 11, 2001 Association of 265T/C Polymorphism and Plasma ApoA-II Concentration With Other Biochemical and Anthropometric Measurements 265T/C Polymorphism T/T T/C C/C ANOVA (P) No. of subjects (%) 247 (40) 296 (47) 81 (13) ApoA-II, mg/dl * * Triglycerides, mmol/l NS Cholesterol, mmol/l VLDL NS LDL NS HDL NS Body mass index, kg/m NS Waist circumference, cm * * 0.03 Glucose, mmol/l NS Insulin, pmol/l NS Values are mean SEM. *P 0.05 vs T/T (Tukey-Kramer post hoc test). for the 265C allele than in subjects homozygous (Figure 4) for the 265T allele (P 0.01 for genotype, P 0.02 for interaction between genotype and time by repeated measures ANOVA). Difference in plasma concentration of postprandial large VLDL particles according to genotype remained significant (P 0.02) at 6 hours after oral fat load after controlling for waist circumference or fasting plasma insulin concentration. In contrast, postprandial responses of small VLDLs (Sf 20 to 60 of apob-100) or chylomicron remnants of different particle size (as reflected by apob-48 concentrations in subfractions of triglyceride-rich lipoproteins) were uninfluenced by 265T/C polymorphism. Discussion Three basic observations were made regarding the physiological significance of the 265T/C polymorphism. First, in EMSA studies, a distinct difference in binding of nuclear Figure 4. Association between 265T/C polymorphism and postprandial concentrations of large VLDL particles. Fasting and postprandial concentrations of large VLDL particles (Sf 60 apob-100) were analyzed according to apoa-ii 265T/C genotype in subjects with apoe3/3 genotype. Subjects homozygous for 265C allele (n 16) had faster clearance than subjects homozygous for 265T allele (n 39). P 0.01 for genotype; P 0.02 for interaction time genotype by repeated measures ANOVA. factors was observed between 27-bp fragments that contained either the 265T or 265C site. Second, transient transfection studies provided evidence for decreased basal transcription rate of constructs that contained the 265C site compared with constructs that contained the 265T site. Third, a significant association was found between the 265T/C genotype and plasma apoa-ii concentration in healthy middle-aged men. These observations suggest that 265T/C polymorphism affects binding of 1 hepatic nuclear factors to the promoter of the apoa-ii gene, which results in decreased apoa-ii expression in hepatocytes, reduced secretion of apoa-ii by the liver, and decreased apoa-ii concentration in plasma. The corollary is that the 265T/C polymorphism can be used to analyze the physiological role of apoa-ii in humans. The human apoa-ii promoter segment between nucleotides 911 and 29 is sufficient for liver-restricted expression of a reporter gene in transgenic mice. 24 Rate of transcription of the apoa-ii gene is controlled by a complex array of regulatory elements, designated A to N on the basis of DNase I footprinting analysis. 25 The 265T/C polymorphism is found in the middle of element D, located between nucleotides 255 and Element D binds several different nuclear factors, designated AIID1, AIID2, and AIID4, as well as an activity related to CCAT/enhancer binding protein-. 26 Researchers have proposed that element D has a negative regulatory role in apoa-ii gene transcription when occupied by AIID1 or AIID4, whereas the negative effect is reversed when element D is occupied by AIID2. 27 The 265T/C polymorphism probably interrupts this delicate balance of binding of nuclear factors. Because transfection experiments and association studies indicate that the 265C allele is associated with a reduced rate of transcription, the nuclear proteins found in protein-dna complex 2 are likely to act as transcriptional repressors. Overall effect of the 265T/C polymorphism on the plasma apoa-ii concentration was relatively modest. This

5 van t Hooft et al Functional Apolipoprotein A-II Polymorphism 1227 observation is in agreement with previous reports 26,27 that show that deletion of element D has only a moderate effect on the rate of transcription of the apoa-ii gene. This fact limits the application of the 265T/C polymorphism in association studies and may explain the relatively small effect of the 265T/C polymorphism on biochemical and anthropometric measurements. Moreover, some of the effects of apoa-ii observed in murine models (for example, those related to HDL cholesterol concentration), may not be apparent in humans as a result of the limited effect of the 265T/C polymorphism on rate of transcription of the apoa-ii gene. An interesting observation in the present study was the relationship between 265T/C polymorphism and postprandial plasma concentrations of large VLDLs. This relationship indicates that reduced plasma apoa-ii concentration associated with the 265C allele enhances the ability to remove large VLDLs from circulation during alimentary lipemia. Overexpression of human apoa-ii earlier was shown to increase VLDL production and impair VLDL removal in mouse models. 16,17 In addition, enhanced clearance of remnant lipoproteins was observed in the apoa-ii/apoe double knockout mouse compared with the apoe knockout mouse. 18 These animal studies emphasize the effect of apoa-ii on remnant metabolism, whereas the human data point to a role of apoa-ii in clearance of large VLDL particles. Principal differences between murine and the human studies are likely to explain this discrepancy. Also, regulation of plasma concentrations of small VLDLs is more complex than that of large VLDLs, which renders demonstration of genotype-phenotype associations for small VLDLs more difficult. The association between the 265T/C polymorphism and waist circumference but not body mass index indicates a role of apoa-ii in visceral obesity. That apoa-ii is implicated in visceral obesity in transgenic mice recently was reported by Castellani et al, 17 who hypothesized that overexpression of apoa-ii alters HDL composition such that the HDL interaction with skeletal muscle CD36 is impaired, which results in reduced use of free fatty acids for energy production and increased fat mass. A direct relationship of apoa-ii expression to plasma free fatty acid concentrations also has been observed in studies involving common inbred strains of mice, 28 apoa-ii transgenic mice, 17 mice lacking apoa-ii, 18 and human families with high prevalence of coronary artery disease. 28 Additional functional polymorphisms were not found in the proximal promoter of the apoa-ii gene. Common functional mutations in the coding regions thus far have not been discovered, 29 and linkage disequilibrium was not observed between the 265T/C polymorphism and MspI and BstNI polymorphisms in the 3 end of the human apoa-ii gene (data not shown). Therefore, that the 265T/C polymorphism is in linkage disequilibrium with another functional polymorphism in the apoa-ii gene is unlikely, but it remains possible that observed associations are due to functional polymorphisms in other genes. Nevertheless, the overall similarity between our present human data and previous mouse data strongly suggests that associations between the 265T/C polymorphism and lipid and fat metabolism are directly related to the apoa-ii gene, thus underlining the multifunctional metabolic roles of apoa-ii. Acknowledgments The present study was supported by grants from the Swedish Medical Research Council (8691, 9533), the Swedish Heart-Lung Foundation, the Marianne and Marcus Wallenberg Foundation, the King Gustaf V 80th Birthday Foundation, and the Foundation for Old Servants. Dr Ruotolo was supported the International Atherosclerosis Society and Scientific Institute H San Raffaele, Milano, Italy. References 1. Hedrick CC, Lusis AJ. Apolipoprotein A-II. a protein in search of a function. Can J Cardiol. 1994;10: Parra HJ, Arveiler D, Evans AE, et al. A case-control study of lipoprotein particles in two populations at contrasting risk for coronary heart disease: the ECTIM study. Arterioscler Thromb. 1992;12: Lagrost L, Dengremont C, Athias A, et al. Modulation of cholesterol efflux from Fu5AH hepatoma cells by the apolipoprotein content of high density lipoprotein particles. J Biol Chem. 1995;270: Huang Y, von Eckardstein A, Wu S, et al. Cholesterol efflux, cholesterol esterification, and cholesteryl ester transfer by LpA-I and LpA-I/A-II in native plasma. Arterioscler Thromb Vasc Biol. 1995;15: Zhong SB, Goldberg IJ, Bruce C, et al. Human apoa-ii inhibits the hydrolysis of HDL triglyceride and the decrease of HDL size induced by hypertriglyceridemia and cholesteryl ester transfer protein in transgenic mice. J Clin Invest. 1994;94: Weng W, Brandenburg NA, Zhong S, et al. ApoA-II maintains HDL levels in part by inhibition of hepatic lipase: studies in apoa-ii and hepatic lipase double knockout mice. J Lipid Res. 1999;40: Lagrost L, Perségol L, Lallemant C, et al. Influence of apolipoprotein composition of high density lipoprotein particles on cholesteryl ester transfer protein activity. J Biol Chem. 1994;269: Pussinen PJ, Jauhiainen M, Ehnholm C. ApoA-II/apoA-I molar ratio in the HDL particle influences phospholipid transfer protein-mediated HDL interconversion. J Lipid Res. 1997;38: Maezal-Casacuberta A, Blanco-Vaca F, Ishibi BV, et al. Functional cholesterol acyltransferase deficiency and high density lipoprotein deficiency in transgenic mice overexpressing human apolipoprotein A-II. J Biol Chem. 1996;271: Pilon A, Briand O, Lestavel S, et al. Apolipoprotein AII enrichment of HDL enhances their affinity for class B type I scavenger receptor but inhibits specific cholesteryl ester uptake. Arterioscler Thromb Vasc Biol. 2000;20: Schultz JR, Gong EL, McCall MR, et al. Expression of human apolipoprotein A-II and its effect on high density lipoproteins in transgenic mice. J Biol Chem. 1992;267: Warden CH, Hedrick CC, Qiao JH, et al. Atherosclerosis in transgenic mice overexpressing apolipoprotein A-II. Science. 1993;261: Schultz J, Verstuyft JG, Gong EL, et al. Protein composition determines the anti-atherogenic properties of HDL in transgenic mice. Nature. 1993; 365: Hedrick CC, Castellani LW, Warde CH, et al. Influence of mouse apolipoprotein A-II on plasma lipoproteins in transgenic mice. J Biol Chem. 1993;268: Boisfer E, Lambert G, Atger V, et al. Overexpression of human apolipoprotein A-II in mice induces hypertriglyceridemia due to defective very low density lipoprotein hydrolysis. J Biol Chem. 1999; 274: Escola-Gil JC, Julve J, Marzal-Casacuberta A, et al. ApoA-II expression in CETP transgenic mice increases VLDL production and impairs VLDL clearance. J Lipid Res. 2001;42: Castellani LW, Goto AM, Lusis AJ. Studies with apolipoprotein A-II transgenic mice indicate a role of HDLs in adiposity and insulin resistance. Diabetes. 2001;50: Weng W, Breslow JL. Dramatically decreased high density lipoprotein cholesterol, increased remnant clearance, and insulin hypersensitivity in apolipoprotein A-II knockout mice suggest a complex role for apolipoprotein A-II in atherosclerosis susceptibility. Proc Natl Acad Sci U S A. 1996;93:

6 1228 Circulation September 11, Boquist S, Ruotolo G, Tang R, et al. Alimentary lipemia, postprandial triglyceride-rich lipoproteins, and common carotid intima-media thickness in healthy, middle-aged men. Circulation. 1999;99: Van den Maagdenberg AMJM, De Knijff P, Stalenhoef AFH, et al. Apolipoprotein E*3-Leiden allele results from a partial gene duplication in exon 4. Biochem Biophys Res Commun. 1989;165: Lew DJ, Decker T, Strehlow I, et al. Overlapping elements in the guanylate-binding protein gene promoter mediate transcriptional induction by alpha and gamma interferons. Mol Cell Biol. 1991;11: Dawson SJ, Wiman B, Hamsten A, et al. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-i (PAI-I) gene respond differently to interleukin-i in HepG2 cells. J Biol Chem. 1993;268: Sambrook J, Fritsch EF, Maniatis T. In: Molecular Cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Lab Press; Ribeiro A, Pastier D, Kardassis D, et al. Cooperative binding of upstream stimulatory factor and hepatic nuclear factor 4 drives the transcription of the human apolipoprotein A-II gene. J Biol Chem. 1999;274: Chambaz J, Cardot P, Pastier D, et al. Promoter elements and factors required for hepatic transcription of the human apoa-ii gene. J Biol Chem. 1991;266: Cardot P, Chambaz J, Kardassis D, et al. Factors participating in the liver-specific expression of the human apolipoprotein A-II gene and their significance for transcription. Biochemistry. 1993;32: Cardot P, Pastier D, Lacorte JM, et al. Purification and characterization of nuclear factors binding to the negative regulatory element D of human apolipoprotein A-II promoter: a negative regulatory effect is reversed by GABP, an Ets-related protein. Biochemistry. 1994;33: Warden CH, Daluiski A, Bu X, et al. Evidence for linkage of the apolipoprotein A-II locus to plasma apolipoprotein A-II and free fatty acid levels in mice and humans. Proc Natl Acad Sci U S A. 1993;90: Dupuy-Gorce AM, Desmarais E, Vigneron S, et al. DNA polymorphisms in linkage disequilibrium at the 3 end of the APO AII gene: relationships with lipids, apolipoproteins and coronary heart disease. Clin Genet. 1996;50: