Scholars Research Library. Polyphasic approach on characterization of Nostochopsis lobatus BTA9017 Wood em. Geitler from Madhya Pradesh, India

Transcription

1 Journal of Microbiology and BiotechnologyResearch Scholars Research Library J. Microbiol. Biotech. Res., 2015, 5 (6): 9-15 ( ISSN : CODEN (USA) : JMBRB4 Polyphasic approach on characterization of Nostochopsis lobatus BTA9017 Wood em. Geitler from Madhya Pradesh, India Onkar Nath Tiwari 1*, Indrama Thingujam 1, Ojit Singh Keithellakpam 1, Gunapati Oinam 1, Indira Wangkhem 1, Aribam Subhalaxmi 1, Miranda Longjam 1, Angom Thadoi 1, Richa Tandon 2, Girdhari Lal Tiwari 2 1 National Repository for Cyanobacteria and Microgreen algae (Freshwater), Microbial Resources Division, Institute of Bioresources and Sustainable Development, (A National Institute of DBT, Govt. of India), Takyelpat, Imphal , Manipur, INDIA, 2 Department of Botany, University of Allahabad, Allahabad, U. P., INDIA ABSTRACT The blue-green alga, Nostochopsis lobatus Wood em. Geitler, NCBI accession no. KJ consists of a dark green colony with a mucilaginous sheath, attached on rocks of flowing stream of Panna, Madhya Pradesh, India was the habitat and isolated. Scattered and lateral branches with stretching parallel and upward to the main filament in a polysaccharide sheath were the unique descriptive characteristics. The study of the bioactive compounds showed a high and comparable amount of sugar, pigments, chlorophyll, carotenoids, phycocyanin, phycoerythin, allophycocyanin including high soluble proteins and ammonia excretion in culture conditions. The 16S rrna sequence was compared with the retrieved cultures from NCBI GenBank database. Phylogenetic analysis was largely consistent which was obtained from 16S rrna gene sequence analysis. Phylogenetic tree was constructed by neighbor joining and the findings indicate that the genus Nostochopsis lobatus is distantly related to the genus Fischerella sp. and Westiellopsis sp. Furthermore, this alga could be considered as a source of supplement of food, therapeutic agent or for use as an ingredient in cosmetics in the future. Keywords: Biochemical analyses, Neighbour joining, Nostochopsis lobatus, Pigments, 16SrRNA INTRODUCTION Blue green algae also known as cyanobacteria are highly diverse group of prokaryotic microorganisms having oxygenic photosynthesis and most fascinating organisms within the earth biosphere [1]. Cyanobacteria exhibit the most diverse and complex morphology among all prokaryotic groups, perhaps indicating that they would have been the dominant life forms at some period of the early earth. Nostochopsis lobatus is the type of filamentous cyanobacteria that grow luxuriantly attached to the rock surface in the form of mucilaginous balls in fresh water slow flowing stream and ponds [2]. External gross appearance under aquatic or moist conditions is often gelatinous, slimy and occasionally filamentous clusters with colours ranging from dark green to brown black and rarely red. This variable colour range is primarily due to their photosynthetic pigments consisting of chlorophyll-a together with different concentrations of accessory pigments. Cyanobacteria have thin or thick gelatinous sheaths outside their cells walls their thickness and sometimes their colour contribute to the final appearance of the organism. Molecular data provide basic criteria for cyanobacterial taxonomy but to construct a comprehensive phylogenetic system of cyanobacteria a combination with knowledge on their morphology, physiology, biochemistry and ecology 9

2 is essential. The necessity to adopt a polyphasic approach combining the knowledge gained through modern ecological, ultra structural and molecular methods supported by the cultivation of numerous cyanobacterial morphotypes. MATERIALS AND METHODS Isolation of strain and growth condition Samples were collected from flowing stream attached on rock, Panna, Madhya Pradesh. Biomass was inoculated in Erlenmeyer flask containing BG-11 (-N) broth medium [3]. The flasks were kept in culture room under light:dark cycles of 14:10h conditions maintained at 28±2ºC under illumination provided by cool white fluorescent tubes of 54-67µmol photons m -2 s -1. The flasks were shaken manually on daily basis to prevent cell clumping. Morphological study The trinocular Carl Zeiss microscope with Axio Vision Viewer 4.8 software was used for image analysis. The length and width of vegetative cells, positions, frequency, present of sheath, position size and shape of heterocysts and thallus morphology and behaviour were the major parameters for morphological characterization. Estimation of chlorophyll-a Optical density (O.D.) was recorded at 665nm by using UV-Vis spectrophotometer model 1800 Shimadzu applying the method described [4]. Estimation of phycobiliproteins (PBS) Optical density (O.D.) was recorded at 615, 652 and 562 applying the method [5] for PC, APC and PE respectively. Estimation of extracellular ammonium excretion Ammonia excretion was determined by the method described by [6]. Optical density was measured at 640 nm. Estimation of total carotenoids Estimation of total carotenoids was determined by the method described by [7] and O.D. measured at 450 nm. Estimation of total sugar Total sugar was estimated following the method described by [8], O.D. was measured at 620 nm, total sugar content was calculated from the standard graph. Lipid profiling Lipid profiling method followed as per described by [9]. Determination of acetylene reduction activity Nitrogenase activity was measured by acetylene reduction technique described by [10]. Isolation of genomic DNA Chemical lysis is ineffective therefore mechanical disruption was done in present investigation by following Xanthogenate method [11]. PCR amplification of the 16S rrna gene To amplify the 16S rrna gene segments was carried out for 50 µl of reaction mixture using 2 µl (50 ng) of extracted DNA using PCR master mix made up of 5 µl of 1X Taq buffer with 1.5 mm MgCl 2, 5 µl of 200 µm each of dntps solution, 0.25 µl of 1.25 U Taq polymerase along with 1.5 µl of 0.3 µm each of cyanobacterial universal primer for 16S rrna like (536f-GTGCCAGCAGCCGCGGTRATA) and reverse (1488R- GGTTACCTTGTTACGACTTCACC) with µl of sterile double distilled water. After DNA amplification, 3 µl of DNA sample was mixed with 1 µl of loading dye by pipetting in and out and loaded the sample in 2% agarose gel in gel electrophoresis unit and ran for 45 mins at 60V. 200 bp DNA ladder was used as marker. After gel electrophoresis, gel was illuminated in gel documentation system and observed DNA bands. 10

3 Analysis of sequence data Nucleotide sequence obtained from DNA was compared with the sequence available in the NCBI database using BLAST ( Trees based on 16S rrna were constructed using the available cyanobacterial gene sequences along with the sequence determined in this study using the neighbour-joining method [12, 13] by using Kimura 2-parameter model [14] and maximum parsimony [15] method contained in the MEGA 4.0 software [16]. Sequences were aligned using CLUSTALW to produce working alignment of 16S rrna sequences for the target strains. The final alignments were obtained by manual refinement. Phylogenetic trees were constructed. The analysis of similarity matrix and phylogenetic tree was done. Statistical significance level of interior nodes was determined by bootstrap analysis (1,000 data re-samplings) [17] and values above 50% were reported. RESULTS AND DISCUSSION Thallus spherical more or less irregularly lobed, solid up to 3.5 cm diam., seldom very big trichomes radially arranged seemingly straight, in the innermost part bent irregularly and upper region richly branched, in the older parts branches scattered; branches lateral, broadly stretching upwards by a short bend and with its end being parallel to the main filament; cells in the branching zone barrel- shaped, 4-5.5µm broad and just before formation upto 9 µm broad, mostly up to 8 µm and in older regions upto 18µm long, trichome tapering or slightly pointed; heterocysts mostly lateral branch, more or less on 2-3 celled lateral branch, mucilage homogenous colourless, sheath present in the branching zone, thin and firm seemingly colourless (Fig. 1). Nostochopsis lobatus yielded sugar 7.0 and 12.7 µgml -1 along with pigments; chlorophyll-a: 9.81 µgml -1 and 12.6 µgml -1, total carotenoids: 4.56 and 2.25 µgml -1, phycocyanin: 45.6 and 66.8 µgml -1, phycoerythin 76.8 and 84.5 µgml -1 and allophycocyanin: 3.11 and 9.31 µgml -1 during 15 th and 30 th days growth period. Also N. lobatus contained soluble protein 17.0 and 34.6 µgml -1, extracellular ammonium excretion 5.20 and 6.20 µgml -1 during 15 th and 30 th days growth period (Table-1). The strain determined the high content of ethylene 7.21 and 39.1 (nmole C 2 H 4 /µg of Chl-ahr -1 ) in 15 th and 30 th days growth cycle. Lipid contain showed high amount of PUFA (Linolelaidic Acid Methyl Ester (58.1%) and saturated fatty acid (Arachidic Acid Methyl Ester (15.6%) (Table-2). 16S rrna sequences of cyanobacteria belong to filamentous heterocystous AB , KF , KF , HF , HF , KC , KC , AJ , KJ , KJ , AJ , AM , AJ , KJ , AF , AB , KM , KF , FM , FM , KP , AB , AM , AJ , NR_ , KM , FJ , KM , AB , AB , HF were obtained from GenBank and nucleotide sequence of the PCR amplified 16S rrna gene of studied strain i.e. Nostochopsis lobatus an outgroup as Synechococcus elongatus. To examine their phylogenetic relationship, 16S rrna sequence of 26 other cyanobacteria of heterocystous group was compared. Inference of the relationship from nucleotide of known function that is structurally similar can be accomplished through the comparative analysis. The study presented phylogenetic or evolutionary positions of the one strain using 16S rrna gene sequence (Fig. 2). Nostochopsis lobatus, a filamentous, branched diazotrophic cyanobacterium was attached to the rock surfaces of streams in the forms of solid mucilaginous balls contained unialgal population. High concentrations of total carotenoids, phycocyanin and phycoerythrin made a valuable research organism for nutraceutical point of view. Also N. lobatus produced substantial amount of fatty acids may be the good source for pharmaceutical industries. Molecular phylogenetic analysis was carried out on 16SrRNA for Nostochopsis lobatus of filamentous genus bearing true branching. Monophyletic origin of the stigonematalean taxa was supported by phylogenetic analysis of 16SrRNA as it suggested that heterocystous cyanobacteria with true branching filaments are monophyletic. The phylogeny inferred from Nostochopsis lobatus sequence (Fig. 2) supports almost the same topology as 16SrRNA Westiellopsis forms a cluster with Nostochopsis in the tree. Chlorogloeopsis which was characterized by the absence of distinct branches had a basal position within the stigonematalean clade. Fischeralla, Nostochopsis and Westiellopsis whose filaments exhibit T-shaped branching form a cluster [18]. Nostochopsis lobatus may be a promising cyanobacterium as it had a high nutritive value coupled with high phycobilin pigments and suggest the use of N. lobatus in nutraceutical industries. 11

4 Table-1: Biochemical characterization of Nostochopsis lobatus BTA9017 Strain code & NCBI accession no. Nostochopsis lobatus BTA9017 NCBI Accession No.: KJ Biochemical/ physiological characterization 15 th day 30 th day Total soluble protein (µgml -1 ) 17.00± ±6.11 Total carbohydrates (µgml -1 ) 7.00± ±1.15 Chlorophyll-a (µgml -1 ) 9.81± ±0.28 Extracellular ammonium excretion (µgml -1 ) 5.20± ±0.62 Total carotenoids (µgml -1 ) 4.56± ±0.74 Phycobiliproteins (µgml -1 ) PE 76.80± ±0.90 PC 45.60± ±1.01 APC 3.11± ±1.23 Nitrogenase activity (nmole C 2H 4/ µg of Chl-ahr -1 ) 7.21± ±5.58 Table-2: Fatty acid composition and lipid profiling of Nostochopsis lobatus BTA2017 SN Fatty acid composition Fatty acid content (%) 1 Caproic Acid Methyl Ester (C6:0) Caprylic Acid Methyl Ester (C8:0) Undecanoic Acid Methyl Ester (C11:0) Lauric Acid Methyl Ester (C12:0) Tridecanoic Acid Methyl Ester (C13:0) Myristic Acid Methyl Ester (C14:0) Myristoleic Acid Methyl Ester (C14:1) Pentadecanoic Acid Methyl Ester (C15:0) cis-10-pentadecenoic Acid Methyl Ester (C15:1) Palmitic Acid Methyl Ester (C16:0) Palmitoleic Acid Methyl Ester (C16:1) Heptadecanoic Acid Methyl Ester (C17:0) cis-10-heptadecenoic Acid Methyl Ester (C17:1) Elaidic Acid Methyl Ester (C18:1n9t) Oleic Acid Methyl Ester (C18:1n9c) Linolelaidic Acid Methyl Ester (C18:2n6t) Arachidic Acid Methyl Ester (C20:0) γ-linolenic Acid Methyl Ester (C18:3n6) cis-11-eicosenoic Acid Methyl Ester (C20:1) Linolenic Acid Methyl Ester (C18:3n3) Heneicosanoic Acid Methyl Ester (C21:0) cis-11,14-eicosadienoic Acid Methyl Ester (C20:2) Behenic Acid Methyl Ester (C22:0) Erucic Acid Methyl Ester (C22:1n9) cis-11,14,17-eicosatrienoic Acid Methyl Ester (C20:3n3) Tricosanoic Acid Methyl Ester (C23:0) cis-13,16-docosadienoic Acid Methyl Ester (C22:2) Lignoceric Acid Methyl Ester (C24:0) cis-5,8,11,14,17-eicosapentaenoic Acid Methyl Ester (C20:5n3) Nervonic Acid Methyl Ester (C24:1)

5 A B C D E F Fig. 1: A: Thallus behavior of Nostochopsis lobatus B: Growth pattern on agar plate C-F: Stages of filament organization and life cycle 13

6 Fig. 2: The phylogenetic relationships of cyanobacteria inferred from 16S rrna sequences. The tree was constructed by NJ method. The sequence obtained in the study is indicated in bold type. Numbers at each branch point are the bootstrap values for percentages of 1000 replicate trees calculated by NJ. Only values above 50% are shown. CONCLUSION From the above investigation, it is concluded that this strain is a promising nitrogen fixers which could be useful in commercial production of biofertilizer, since it has excreted high extracellular ammonium. Since the strain was found to contain high phycobiliproteins, it could be considered as potent candidate for alternative sources of natural colouring agents. The present findings indicate that producing mass culture of this strain for biotechnological importance would attract an increasing attention. Acknowledgements Authors are thankful to the DBT and DST, Govt. of India for financial assistance and we express our sincere gratitude to the Director, DBT-IBSD, Imphal, Manipur and HOD Botany, University of Allahabad for all kinds of support and help. REFERENCES [1] J Komarek. Algae, 2006, 21(4), [2] U Pandey; J Pandey. Bioresour. Technol., 2008, 99,

7 [3] RY Stanier; MM Kunisawa; G Cohen-Bazire. Bact. Res., 1971, 35, [4] G Mckinney. J. Biol. Chem., 1941, 140, [5] A Bennett; L Bogorad. J. Cell. Biol., 1973, 58, [6] L Solorzano. Limnol. Oceanogr., 1969, 4, [7] A Jensen. In: Handbook of phycological methods: Physiological and biochemical methods, Cambridge University press, 1978, pp [8] RG Spiro. Methods Enzymol., 1966, 8, [9] EG Bligh; WJ Dyer. Can. J. Biochem. Physiol., 1959, 37, [10] RWF Hardy; RC Burus; RD Holsten. Soil Biol. Biochem., 1973, 5, [11] D Tillett; BA Neilan. J. Phycol., 2000, 36(1), [12] N Saitou; M Nei. Mol. Biol. Evol., 1987, 4(4), [13] JD Thompson; DG Higgins; TJ Gibson. Nucleic Acids Res., 1994, 22, [14] M Kimura. J. Mol. Evol., 1980, 16, [15] RV Eck; MO Dayhoff. Atlas of protein sequence and structure, National Biomedical Research Foundation, Silver Springs, Maryland, [16] K Tamura; J Dudley; M Nei; S Kumar. Mol. Biol. Evol., 2007, 24, [17] J Felsenstein. Evolution, 1985, 39(4), [18] S Golubic; M Hernandez-Marine; L Hoffmann. Algol. Stud., 1996, 83,