G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France

Size: px
Start display at page:

Download "G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France"

Transcription

1 LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France Liver X receptors (LXRα and LXRβ) are oxysterol-activated nuclear receptors. These sterolresponsive transcription factors regulate the expression of genes involved in intestinal cholesterol absorption and conversion of cholesterol to bile acids [1]. Since the macrophage plays an important role in host defense and immuno-inflammatory responses, particular interest has been paid to the role of LXRs in the control of macrophage gene expression and function. Altered macrophage functions contribute to the pathogenesis of many infectious, immunological and inflammatory disease processes, including atherosclerosis. Research reported over the last few years revealed important roles for LXRs in macrophage inflammation and cholesterol homeostasis with consequences in atherosclerosis development. LXRs and Macrophage Cholesterol Homeostasis Macrophage cholesterol homeostasis maintenance is the result of a balance between influx, endogenous synthesis, esterification/hydrolysis, and efflux of cholesterol. In macrophages, LXR ligand activation enhances the expression of the ATP-binding cassette transporter ABCA1 and, consequently, apoai-mediated cholesterol efflux [2,3], the first step of the reverse cholesterol transport from peripheral tissues to the liver. In addition they regulate the expression of the transporters ABCG1 and ABCG4 [4] which mediate cholesterol efflux to larger HDL particles [5]. Moreover, phospholipid transfer protein (PLTP), another modulator of HDL metabolism with a potential role in reverse cholesterol transport, is also a direct target gene for LXR in macrophages [6]. One important determinant governing cholesterol availability for efflux to extra-cellular acceptors is the mobilization of cholesterol from intracellular pools to the plasma membrane. Recently, it has been demonstrated that LXRs also control intracellular cholesterol trafficking in human macrophages [7]. LXR activation enhances the mobilization of free cholesterol to the plasma membrane resulting in a relative enrichment in cholesterol content of the outer layer, where it becomes readily available for efflux. Incubation of macrophages with synthetic LXR activators increases the amount of free cholesterol in the plasma membrane by inducing the gene expression of the Niemann-Pick C proteins NPC1 and NPC2, both involved in cholesterol trafficking from late endosome/lysosomes to the plasma membrane [7]. NPC1, a trans-membrane glycoprotein localized in the late endosomal compartment, contains a sterol-sensing domain projected into the lumen, whereas NPC2 is a soluble cholesterol-binding protein localized in the core of late endosomes [8]. LXR regulation of NPC1 and NPC2 occurs in a species-specific manner, since no induction is observed in murine bone marrow-derived macrophages upon stimulation [7]. These observations provide further evidence for the existence of species-differences in response to LXR agonists, which may result in distinct regulation of cholesterol homeostasis. Such speciesdifferences have already been reported for cholesterol 7alpha-hydroxylase (Cyp7A1), which is only induced in rodents, but not in human liver [9].

2 The enrichment of cholesterol in the plasma membrane and induction of apoai-specific cholesterol efflux by LXR activation is drastically reduced in the presence of progesterone [7], which blocks cholesterol mobilization from the late endosome/lysosome and mimics a phenotype comparable to the one observed in NPC-deficient cells [10,11]. Interestingly, simultaneous repression of NPC1 and NPC2 expression by a sirna approach, leads to a drastic reduction of basal as well as LXR-induced cholesterol efflux, without affecting ABCA1 gene expression. However, LXR activation still results in an, albeit smaller, induction of cholesterol efflux suggesting the existence of other pathways involved in cholesterol movement regulated by LXR. It thus appears that stimulation of post-lysosomal cholesterol mobilization to the plasma membrane by LXR activation via NPC1 and NPC2 induction is an important step upstream of cholesterol efflux [7]. Recently, fibroblasts isolated from NPC patients were shown to display a reduced accessibility of plasma membrane cholesterol to cholesterol oxidase [12] associated with an impaired cholesterol efflux to apoai [13]. In line, NPC1-deficient subjects have decreased plasma HDL cholesterol levels [13]. The induction of NPC1 and NPC2 gene expression after LXR activation and the subsequent induction of cholesterol efflux, could have physiological consequences in vivo in cells other than macrophages. Of particular interest, recent studies suggest a role of cholesterol metabolism in the development of Alzheimer s disease [14]. In neuronal cells, which express ABCA1 [15], stimulation of cholesterol efflux decreased amyloid β-peptide secretion [14]. LXRs also modulate the intracellular distribution of cholesterol. In fact, LXR activation decreases cholesterol esterification rates and reduces cholesteryl ester levels in human macrophage foam cells [7]. These actions of LXR are not due to a decreased gene expression of ACAT1, the enzyme responsible for cholesterol esterification in macrophages. ACAT1 enzyme activity and cholesterol esterification rate are also controlled by fatty acid (FA) availability which could depend partially on their catabolism via mitochondrial FA oxidation. Carnitine palmitoyltransferase 1 (CPT-1) is an enzyme, which is located in the outer mitochondrial membrane and which controls the entry of long chain FAs into the mitochondria where they are degraded by β-oxidation [16]. However, in contract to PPARα, LXR activation did not affect CPT-1 mrna levels in macrophages, thus rendering the possibility that reduced cholesterol esterification is due to lowered FA substrate availability unlikely. Moreover, LXR activators did not affect neutral cholesteryl ester hydrolase (NCEH) activity in macrophages, thus indicating that the effects of LXR occur rather via inhibition of cholesterol esterification than by stimulation of cholesteryl ester hydrolysis. Thus, it is likely that the stimulation of cholesterol mobilization to the plasma membrane by LXR activators, results in a reduced availability of cholesterol as substrate for ACAT1. These data demonstrate a novel role for LXR in the control of cholesterol mobilization and distribution, an effect which, associated with the induction of ABCA1 and ABCG1/ABCG4, may contribute to enhanced liberation and efflux of free cholesterol and stimulation of the initial step of the reverse cholesterol transport pathway [17]. LXRs and Atherosclerosis These studies point to a role of LXRs as potential therapeutic targets for the treatment or prevention of atherosclerosis. However, it should be mentioned that in addition to their beneficial effect on cholesterol metabolism, LXRs induce the expression of genes involved in hepatic lipogenesis causing elevation of plasma triglycerides in agonist-treated mice [18]. Moreover,

3 LXR agonists increase expression of CETP, which may result in a transfer of cholesterol esters from HDL to LDL [19]. Thus these observations raise the question whether the net effect of LXR activation would be beneficial or deleterious with respect to atherosclerosis development. Initial studies addressing this issue demonstrated that activation of LXRs by synthetic ligands protects against atherosclerosis development in apoe-/- or LDLR-/- mouse models of atherosclerosis [20,21]. However, in order to use LXR ligands as therapeutic agents, it would be desirable if such compounds would provoke regression of established atherosclerotic lesions. Recently, it has been reported that the LXR agonist T increases ATP-binding cassette transporter ABCA1 expression within pre-existing atherosclerotic lesions in hypercholesterolemic and atherosclerotic LDLR-/- mice, resulting in the regression of the lesions [22]. In addition, LXR agonist treatment may result in a remodeling of vulnerable to stable lesions with an increase of collagen and a reduction in macrophage content. A second unresolved issue is the target cell and tissue involved in the atheroprotective effects of LXR agonists. In theory, these effects could be either due to the promotion of cholesterol excretion in the liver, the inhibition of cholesterol absorption in the intestine, the induction of cholesterol efflux from macrophages or a combination of these mechanisms. Using macrophage-selective LXR-deficient mice created by bone marrow transplantation, it has been demonstrated that macrophage LXR expression is necessary for the atheroprotective actions of an LXR agonist [22]. These data are in line with previous bone marrow transplant studies reporting that loss of LXR expression leads to exacerbated atherosclerosis [23]. Thus, although it is possible that the effects of LXRs in other tissues are relevant for atherogenesis, the macrophage appears to play a necessary role. In summary, LXR activation in macrophages triggers changes in gene expression, including induction of genes involved in cholesterol trafficking and efflux and repression of genes of the inflammatory response, thus contributing to the atheroprotective effects of its ligands. These observations provide evidence for the utility of LXR modulators in the treatment of cardiovascular diseases. Selective LXR agonists, which act on macrophages but do not stimulate hepatic lipogenesis, may display the most optimal therapeutic properties. The development of LXRβ-selective agonists represents one possible way to achieve this objective, since the LXRα isoform is thought to play the dominant role in hepatic lipogenesis, whereas both LXRα and LXRβ are equally effective in promoting cholesterol efflux in macrophages [24]. References 1. Tontonoz P, Mangelsdorf DJ. Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol 2003;17: Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the human ABC1 promoter by LXR/RXR. J Biol Chem 2000;275: Venkateswaran A, Laffitte BA, Joseph SB, et al. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXRalpha [In Process Citation]. Proc Natl Acad Sci U S A 2000;97: Engel T, Lorkowski S, Lueken A, et al. The human ABCG4 gene is regulated by oxysterols and retinoids in monocyte-derived macrophages. Biochem Biophys Res Comm 2001;288: Wang N, Lan D, Chen W, Matsuura F, Tall AR. ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci U S A 2004;101(26):

4 6. Laffitte BA, Joseph SB, Chen M, et al. The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol 2003;23: Rigamonti E, Helin L, Lestavel S, et al. Liver X receptor activation controls intracellular cholesterol trafficking and esterification in human macrophages. Circ Res 2005;97: Naureckiene S, Sleat DE, Lackland H, et al. Identification of HE1 as the second gene of Niemann-Pick C disease. Science 2000;290: Menke JG, Macnaul KL, Hayes NS, et al. A novel liver X receptor agonist establishes species differences in the regulation of cholesterol 7alpha-hydroxylase (CYP7a). Endocrinology 2002;143: Butler JD, Blanchette-Mackie J, Goldin E, et al. Progesterone blocks cholesterol translocation from lysosomes. J Biol Chem 1992;267: Sato M, Akaboshi S, Katsumoto T, et al. Accumulation of cholesterol and GM2 ganglioside in cells cultured in the presence of progesterone: an implication for the basic defect in Niemann- Pick disease type C. Brain Dev 1998;20: Garver WS, Krishnan K, Gallagos JR, Michikawa M, Francis GA, Heidenreich RA. Niemann- Pick C1 protein regulates cholesterol transport to the trans-golgi network and plasma membrane caveolae. J Lipid Res 2002;43: Choi HY, Karten B, Chan T, et al. Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human Niemann-Pick type C disease. J Biol Chem 2003;278: Sun Y, Yao J, Kim TW, Tall AR. Expression of liver X receptor target genes decreases cellular amyloid beta peptide secretion. J Biol Chem 2003;278: Panzenboeck U, Balazs Z, Sovic A, et al. ABCA1 and scavenger receptor class B, type I, are modulators of reverse sterol transport at an in vitro blood-brain barrier constituted of porcine brain capillary endothelial cells. J Biol Chem 2002;277: McGarry JD, Brown NF. The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur J Biochem 1997;244: Naik SU, Wang X, Da Silva JS, et al. Pharmacological activation of liver X receptors promotes reverse cholesterol transport in vivo. Circulation 2005; Dec 19; [Epub ahead of print]. 18. Schultz JR, Tu H, Luk A, et al. Role of LXRs in control of lipogenesis. Genes Dev 2000;14: Masson D, Staels B, Gautier T, et al. Cholesteryl ester transfer protein modulates the effect of liver X receptor agonists on cholesterol transport and excretion in the mouse. J Lipid Res 2004;45: Joseph SB, McKilligin E, Pei L, et al. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc Natl Acad Sci U S A 2002;99: Terasaka N, Hiroshima A, Koieyama T, et al. T , a synthetic liver X receptor ligand, inhibits development of atherosclerosis in LDL receptor-deficient mice. FEBS Lett 2003;536: Levin N, Bischoff ED, Daige CL, et al. Macrophage liver X receptor is required for antiatherogenic activity of LXR agonists. Arterioscler Thromb Vasc Biol 2005;25: Tangirala RK, Bischoff ED, Joseph SB, et al. Identification of macrophage liver X receptors as inhibitors of atherosclerosis. Proc Natl Acad Sci U S A 2002;99: Lund EG, Peterson LB, Adams AD, et al. Different roles of liver X receptor alpha and beta in lipid metabolism: Effects of an alpha-selective and a dual agonist in mice deficient in each subtype. Biochem Pharmacol 2005: Dec 1; [Epub ahead of print]. Please address correspondence to: Bart Staels

5 UR 545 INSERM Institut Pasteur de Lille 1, rue Calmette BP Lille, France Tel: Fax:

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

Liver X receptors as integrators of metabolic and inflammatory signaling

Liver X receptors as integrators of metabolic and inflammatory signaling Liver X receptors as integrators of metabolic and inflammatory signaling Noam Zelcer and Peter Tontonoz Review series Howard Hughes Medical Institute, Department of Pathology and Laboratory Medicine, UCLA,

More information

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA

More information

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain

More information

Regulating Hepatic Cellular Cholesterol

Regulating Hepatic Cellular Cholesterol Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,

More information

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol

More information

Ligand activation of LXRβ reverses atherosclerosis and cellular cholesterol overload in mice lacking LXRα and apoe

Ligand activation of LXRβ reverses atherosclerosis and cellular cholesterol overload in mice lacking LXRα and apoe Research article Ligand activation of LXRβ reverses atherosclerosis and cellular cholesterol overload in mice lacking LXRα and apoe Michelle N. Bradley, 1 Cynthia Hong, 1 Mingyi Chen, 1 Sean B. Joseph,

More information

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein

More information

EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE

EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE C. Fiévet and B. Staels, Institut Pasteur de Lille, Département d Athérosclérose, Lille, F- 59019 France, Inserm, U545, Lille, F-59019

More information

Liver X Receptor: A Novel Therapeutic Target

Liver X Receptor: A Novel Therapeutic Target Review Article www.ijpsonline.com Liver X Receptor: A Novel Therapeutic Target M. B. PATEL*, N. A. OZA, I. S. ANAND, S. S. DESHPANDE AND C. N. PATEL Department of Pharmacology, Shri Sarvajanik Pharmacy

More information

Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein

More information

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

More information

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured

More information

Lipids digestion and absorption, Biochemistry II

Lipids digestion and absorption, Biochemistry II Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very

More information

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

Lipid metabolism in familial hypercholesterolemia

Lipid metabolism in familial hypercholesterolemia Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

Niacin Metabolism: Effects on Cholesterol

Niacin Metabolism: Effects on Cholesterol Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342

More information

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang

More information

Lipoproteins Metabolism

Lipoproteins Metabolism Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical

More information

Cholesterol is an essential component of mammalian cell

Cholesterol is an essential component of mammalian cell Brief Reviews Intracellular Cholesterol Transport Raymond E. Soccio, Jan L. Breslow Abstract Intracellular cholesterol transport is essential for the maintenance of cholesterol homeostasis. Many aspects

More information

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

More information

Cholesterol Transport and Regulation in the Mammary Gland

Cholesterol Transport and Regulation in the Mammary Gland J Mammary Gland Biol Neoplasia (2014) 19:43 58 DOI 10.1007/s10911-014-9316-x Cholesterol Transport and Regulation in the Mammary Gland Edgar C. Ontsouka & Christiane Albrecht Received: 10 September 2013

More information

PPAR history of research

PPAR history of research PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,

More information

Regulation of Metabolism by Nuclear Hormone Receptors

Regulation of Metabolism by Nuclear Hormone Receptors Regulation of Metabolism by Nuclear Hormone Receptors Huey Jing Huang* and Ira G. Schulman { *Department of Biology, Exelixis Inc., 4757 Nexus Centre Drive, San Diego, California 92121 { Center for Molecular

More information

Reviews. This Review is part of a thematic series on ABC Transporters in the Cardiovascular System, which includes the following articles:

Reviews. This Review is part of a thematic series on ABC Transporters in the Cardiovascular System, which includes the following articles: Reviews This Review is part of a thematic series on ABC Transporters in the Cardiovascular System, which includes the following articles: ATP-Binding Cassette Cholesterol Transporters and Cardiovascular

More information

BIOLOGICAL ROLE OF LIVER X RECEPTORS

BIOLOGICAL ROLE OF LIVER X RECEPTORS JOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2008, 59, Suppl 7, 31 55 www.jpp.krakow.pl M. BARANOWSKI BIOLOGICAL ROLE OF LIVER X RECEPTORS Department of Physiology, Medical University of Bialystok, Bialystok,

More information

Liver X Receptor modulators: Effects on lipid metabolism and potential use in the treatment of atherosclerosis

Liver X Receptor modulators: Effects on lipid metabolism and potential use in the treatment of atherosclerosis Liver X Receptor modulators: Effects on lipid metabolism and potential use in the treatment of atherosclerosis C. Fiévet, B. Staels To cite this version: C. Fiévet, B. Staels. Liver X Receptor modulators:

More information

Role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis

Role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis Role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis Daniel J. Rader 1,2, Eric T. Alexander 1,2, Ginny L. Weibel 2, Jeffrey Billheimer 1, George H. Rothblat 2

More information

Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins

Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins Review Article Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins A. R. Tall From the Division of Molecular Medicine, Department

More information

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport. Alice Skoumalová Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug

Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug Curriculum Vitae Yi Fu ( 付毅 ) (PhD, MBBS) Baker IDI Heart and Diabetes Institute 75 Commercial Road, Prahran, Melbourne, VIC 3004 Australia Phone: +61 3 8532 1288 Email: yi.fu@bakeridi.edu.au PROFILE Research

More information

ATHEROSCLEROSIS IS THE leading cause of mortality

ATHEROSCLEROSIS IS THE leading cause of mortality 0888-8809/03/$15.00/0 Molecular Endocrinology 17(6):985 993 Printed in U.S.A. Copyright 2003 by The Endocrine Society doi: 10.1210/me.2003-0061 MINIREVIEW Liver X Receptor Signaling Pathways in Cardiovascular

More information

Patrick Linsel-Nitschke and Alan R. Tall

Patrick Linsel-Nitschke and Alan R. Tall HDL AS A TARGET IN THE TREATMENT F ATHERSCLERTIC CARDIVASCULAR DISEASE Patrick Linsel-Nitschke and Alan R. Tall Abstract Lipid abnormalities are among the key risk factors for cardiovascular disease. Indeed,

More information

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

The ins and outs of lipid efflux

The ins and outs of lipid efflux J Mol Med (2008) 86:129 134 DOI 10.1007/s00109-007-0293-z CLINICAL IMPLICATIONS The ins and outs of lipid efflux Stefan Lorkowski Published online: 15 December 2007 # Springer-Verlag 2007 Keywords ABC

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Lipid Metabolism in Familial Hypercholesterolemia

Lipid Metabolism in Familial Hypercholesterolemia Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis

The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis Daniel J. Rader, 1, *, Eric T. Alexander,*, Ginny L. Weibel, Jeffrey Billheimer,* and George H. Rothblat

More information

Macrophages play essential roles in immunity and lipid. Regulation of Macrophage Functions by PPAR-, PPAR-, and LXRs in Mice and Men

Macrophages play essential roles in immunity and lipid. Regulation of Macrophage Functions by PPAR-, PPAR-, and LXRs in Mice and Men ATVB In Focus Metabolic Syndrome and Atherosclerosis Series Editor: Marja-Riitta Taskinen Preview Brief Reviews in this Series: Deprés JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, Rodés-Cabau

More information

Do oxysterols control cholesterol homeostasis?

Do oxysterols control cholesterol homeostasis? PERSPECTIVE Biology and biochemistry of cholesterol Ira Tabas, Series Editor Do oxysterols control cholesterol homeostasis? Ingemar Björkhem Division of Clinical Chemistry, Karolinska Institutet, Huddinge

More information

Peroxisome proliferator-activated receptors (PPARs) are

Peroxisome proliferator-activated receptors (PPARs) are Molecular Medicine Peroxisome Proliferator-Activated Receptor Reduces Cholesterol Esterification in Macrophages G. Chinetti, S. Lestavel, J.-C. Fruchart, V. Clavey, B. Staels Abstract Peroxisome proliferator-activated

More information

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship

More information

Strathprints Institutional Repository

Strathprints Institutional Repository Strathprints Institutional Repository Tate, Rothwelle and Rotondo, Dino and Davidson, Jillian (2015) Regulation of lipid metabolism by micrornas. Current Opinion in Lipidology, 26 (3). pp. 243-244. ISSN

More information

Hasoo, Manhl (2013) Regulation of liver X receptors by microrna- 155 in pulmonary fibrosis. PhD thesis.

Hasoo, Manhl (2013) Regulation of liver X receptors by microrna- 155 in pulmonary fibrosis. PhD thesis. Hasoo, Manhl (2013) Regulation of liver X receptors by microrna- 155 in pulmonary fibrosis. PhD thesis. http://theses.gla.ac.uk/4563/ Copyright and moral rights for this thesis are retained by the author

More information

CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia

CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:

More information

Mechanisms of high density lipoprotein-mediated efflux of cholesterol from cell plasma membranes

Mechanisms of high density lipoprotein-mediated efflux of cholesterol from cell plasma membranes Atherosclerosis 137 Suppl. (1998) S13 S17 Mechanisms of high density lipoprotein-mediated efflux of cholesterol from cell plasma membranes Michael C. Phillips *, Kristin L. Gillotte, M. Page Haynes, William

More information

Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.

Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32. Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081

More information

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour

More information

REGULATION OF ABCG5 AND ABCG8 STEROL TRANSPORTERS IN BILIARY CHOLESTEROL ELIMINATION, REVERSE CHOLESTEROL TRANSPORT AND DYSLIPIDEMIA

REGULATION OF ABCG5 AND ABCG8 STEROL TRANSPORTERS IN BILIARY CHOLESTEROL ELIMINATION, REVERSE CHOLESTEROL TRANSPORT AND DYSLIPIDEMIA University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2011 REGULATION OF ABCG5 AND ABCG8 STEROL TRANSPORTERS IN BILIARY CHOLESTEROL ELIMINATION, REVERSE CHOLESTEROL

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease

ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease Physiol Rev 85: 1343 1372, 2005; doi:10.1152/physrev.00005.2005. ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease JOHN F. ORAM AND JAY W. HEINECKE

More information

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS

More information

Cell Injury MECHANISMS OF CELL INJURY

Cell Injury MECHANISMS OF CELL INJURY Cell Injury MECHANISMS OF CELL INJURY The cellular response to injurious stimuli depends on the following factors: Type of injury, Its duration, and Its severity. Thus, low doses of toxins or a brief duration

More information

Thematic review series: The Pathogenesis of Atherosclerosis

Thematic review series: The Pathogenesis of Atherosclerosis thematic review Thematic review series: The Pathogenesis of Atherosclerosis Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host 1 Weerapan

More information

Atherosclerosis Compendium

Atherosclerosis Compendium Atherosclerosis Compendium Circulation Research Compendium on Atherosclerosis Atherosclerosis: Successes, Surprises, and Future Challenges Epidemiology of Atherosclerosis and the Potential to Reduce the

More information

1. This is the location where N-linked oligosaccharide is initially synthesized and attached to glycoproteins.

1. This is the location where N-linked oligosaccharide is initially synthesized and attached to glycoproteins. Biology 4410 Name Spring 2006 Exam 2 A. Multiple Choice, 2 pt each Pick the best choice from the list of choices, and write it in the space provided. Some choices may be used more than once, and other

More information

SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL

SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL Laurent Yvan-Charvet, 1, * Tamara A. Pagler,* Nan Wang,* Takafumi Senokuchi,* May Brundert, Hongna Li,* Franz Rinninger,

More information

Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid phenotype

Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid phenotype Clinical Science (2010) 119, 265 272 (Printed in Great Britain) doi:10.1042/cs20100266 265 ACCELERATED PUBLICATION Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid

More information

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing

More information

Association of liver X receptor α (LXRα) gene polymorphism and ischemic stroke

Association of liver X receptor α (LXRα) gene polymorphism and ischemic stroke Association of liver X receptor α (LXRα) gene polymorphism and ischemic stroke H.X. Wang 1, K. Zhang 2, L. Zhao 1, J.W. Tang 1, L.Y. Gao 1 and Z.P. Wei 1 1 Department of Neurology, The Affiliated Fourth

More information

Cholesterol metabolism in the central nervous system during early

Cholesterol metabolism in the central nervous system during early Cholesterol metabolism in the central nervous system during early development and in the mature animal John M. Dietschy 1 and Stephen D. Turley Department of Internal Medicine, University of Texas Southwestern

More information

The Role of Macrophage Lipophagy in Reverse Cholesterol Transport

The Role of Macrophage Lipophagy in Reverse Cholesterol Transport Review Article Endocrinol Metab 2017;32:41-46 https://doi.org/10.3803/enm.2017.32.1.41 pissn 2093-596X eissn 2093-5978 The Role of Macrophage Lipophagy in Reverse Cholesterol Transport Se-Jin Jeong, Mi-Ni

More information

Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia

Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia REVIEW Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia Jerzy Bełtowski Department of Pathophysiology, Medical University, Lublin, Poland Keywords Atherosclerosis; Lipogenesis; Liver X receptor;

More information

endomembrane system internal membranes origins transport of proteins chapter 15 endomembrane system

endomembrane system internal membranes origins transport of proteins chapter 15 endomembrane system endo system chapter 15 internal s endo system functions as a coordinated unit divide cytoplasm into distinct compartments controls exocytosis and endocytosis movement of molecules which cannot pass through

More information

Lipidne mikrodomene. funkcija

Lipidne mikrodomene. funkcija Lipidne mikrodomene funkcija 1 Cellular processes involving lipid rafts - Signal transduction - Protein and lipid trafficking and sorting - Endosome(clathrin)-independent endocytosis: - potocytosis and

More information

Effects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and

Effects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and Effects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and Consequences to the Host Weerapan Khovidhunkit*, Min-Sun Kim, Riaz A. Memon**, Judy K. Shigenaga, Arthur H. Moser,

More information

1. endoplasmic reticulum This is the location where N-linked oligosaccharide is initially synthesized and attached to glycoproteins.

1. endoplasmic reticulum This is the location where N-linked oligosaccharide is initially synthesized and attached to glycoproteins. Biology 4410 Name Spring 2006 Exam 2 A. Multiple Choice, 2 pt each Pick the best choice from the list of choices, and write it in the space provided. Some choices may be used more than once, and other

More information

Review. ATP-Binding Cassette Transporters, Atherosclerosis,

Review. ATP-Binding Cassette Transporters, Atherosclerosis, Review This Review is part of a thematic series on High-Density Lipoprotein, which includes the following articles: Mendelian Disorders of High-Density Lipoprotein Metabolism [Circ Res. 2014;114:124 142]

More information

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

More information

Liver LXRα expression is crucial for whole body cholesterol homeostasis and reverse cholesterol transport in mice

Liver LXRα expression is crucial for whole body cholesterol homeostasis and reverse cholesterol transport in mice Research article Liver LXRα expression is crucial for whole body cholesterol homeostasis and reverse cholesterol transport in mice Yuan Zhang, 1 Sarah R. Breevoort, 2 Jerry Angdisen, 2 Mingui Fu, 1 Daniel

More information

Thematic review series: The Immune System and Atherogenesis

Thematic review series: The Immune System and Atherogenesis thematic review Thematic review series: The Immune System and Atherogenesis Lipoprotein-associated inflammatory proteins: markers or mediators of cardiovascular disease? Alan Chait, 1 Chang Yeop Han, John

More information

Cholesterol cell homeostasis is regulated by a complex

Cholesterol cell homeostasis is regulated by a complex Bis(Monoacylglycero)Phosphate Accumulation in Macrophages Induces Intracellular Cholesterol Redistribution, Attenuates Liver-X Receptor/ATP-Binding Cassette Transporter A1/ATP-Binding Cassette Transporter

More information

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA

More information

Print: ISSN Online: ISSN

Print: ISSN Online: ISSN Review Article Interplay between Cholesterol, SREBPs, MicroRNA-33 in Dyslipidemia Abdul Hafeez Kandhro Abdul Hafeez Kandhro, Healthcare Molecular & Diagnostic Laboratory, Hyderabad, Pakistan, Email of

More information

ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL

ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL Ashley M. Vaughan 1 and John F. Oram Department of Medicine, Division of Metabolism, Endocrinology,

More information

Cholesterol and Lipoprotein Metabolism and Atherosclerosis: Recent Advances in Reverse Cholesterol Transport

Cholesterol and Lipoprotein Metabolism and Atherosclerosis: Recent Advances in Reverse Cholesterol Transport Cholesterol and Lipoprotein Metabolism and Atherosclerosis. 27 November, Vol. 16 (Suppl. 1), 2017: s27-s42 The Official Journal of the Mexican Association of Hepatology, the Latin-American Association

More information

Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol

Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol Homeostasis Timothy J. Sontag 1,#, Bijoy Chellan 2, Clarissa V. Bhanvadia 1,3, Godfrey S. Getz 1, Catherine A.

More information

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept

More information

The relationship between coronary artery disease and low

The relationship between coronary artery disease and low Cellular Phospholipid and Cholesterol Efflux in High-Density Lipoprotein Deficiency Michel Marcil, PhD; Rachel Bissonnette, MSc; Jérôme Vincent, DEA; Larbi Krimbou, DES; Jacques Genest, MD Background Prospective

More information

CHAPTER 1. General Introduction

CHAPTER 1. General Introduction CHAPTER 1 General Introduction General Introduction Contents 1. Lipoproteins and lipid metabolism 1. Exogenous pathway 2. Endogenous pathway 3. Reverse cholesterol pathway 2. Atherosclerosis 1. Pathogenesis

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

More information

Cholesterol Metabolism

Cholesterol Metabolism Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000

More information

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital

More information

4. ABSORPTION. Transport mechanisms. Absorption ABSORPTION MECHANISMS. Active transport. Active transport uses metabolic energy

4. ABSORPTION. Transport mechanisms. Absorption ABSORPTION MECHANISMS. Active transport. Active transport uses metabolic energy 4. ABSORPTION ABSORPTION MECHANISMS Once the digestive process is completed, the nutrients have to be transferred across the digestive tract epithelium into the intracellular space and eventually into

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

More information

New opportunities for targeting. multiple lipid pathways. Michel FARNIER, DIJON, FRANCE

New opportunities for targeting. multiple lipid pathways. Michel FARNIER, DIJON, FRANCE New opportunities for targeting multiple lipid pathways Michel FARNIER, DIJN, FRANCE Lipid lowering drug therapy 60s and 70s - nicotinic acid -resins 70s to 90s - fibrates the 90s - statins Coronary heart

More information

Integrative Physiology

Integrative Physiology Integrative Physiology Acute Psychological Stress Accelerates Reverse Cholesterol Transport via Corticosterone-Dependent Inhibition of Intestinal Cholesterol Absorption Reija Silvennoinen, Joan Carles

More information