Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Size: px
Start display at page:

Download "Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR"

Transcription

1 Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA [1] Human SR-A CCAGGGACATGGAATGCAA CCAGTGGGACCTCGATCTCC [2] Human CD36 GAGAACTGTTATGGGGCTAT TTCAACTGGAGAGGCAAAGG [2] Human SR-BI TGATGATGGAGAATAAGCCCAT TGACCGGGTGGATGTCCAGGAAC [3] Human ApoE TTCCTGGCAGGATGCCAGGC GGTCAGTTGTTCCTCCAGTTC [4] Human ABCA-1 TGTCCAGTCCAGTAATGGTTCTGT AAGCGAGATATGGTCCGGATT [5] Human ABCG-1 TGCAATCTTGTGCCATATTTGA CCAGCCGACTGTTCTGATCA [6] Human NPC-1 CTTAGTGCAGGAACTCTGTCCAGG TCCACATCACGGCAGGCATTGTAC [6] Human NPC-2 GGTTTGTCTTGTGACCGC AGGAATGTAGCTGCCAGG [6] Human CPT-1 ACAGTCGGTGAGGCCTCTTATGAA TCTTGCTGCCTGAATGTGAGTTGG [7] Human ADRP TGTGAGATGGCAGAGAACGGT CTGCTCACGAGCTGCATCATC [8] Human ACAT-1 GATGAAGGAAGGCTGGTGC GGAAGCTGGTGGCAGTGTAT [9] Human NCEH CACTCCTGCTGACTTGACCA CATCCCCTGTGCTGAAGAAT - Human GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC [10] Mouse SR-A TGAACGAGAGGATGCTGACTG GGAGGGGCCATTTTTAGTGC [11] Mouse CD36 GAACCACTGCTTTCAAAAACTGG TGCTGTTCTTTGCCACGTCA [11] Mouse SR-BI TTTGGAGTGGTAGTAAAAAGGGC TGACATCAGGGACTCAGAGTAG [11] Mouse ApoE ACAGATCAGCTCGAGTGGCAAA ATCTTGCGCAGGTGTGTGGAGA [12] Mouse ABCA-1 AGTGATAATCAAAGTCAAAGGCACAC AGCAACTTGGCACTAGTAACTCTG [5] Mouse ABCG-1 TTCATCGTCCTGGGCATCTT CGGATTTTGTATCTGAGGACGAA [5] Mouse β-actin TGGAGAAGAGCTATGAGCTGCCTG GTGCCACCAGACAGCACTGTGTTG [13] 1

2 References 1. Lecart, S., N. Lecointe, A. Subramaniam, S. Alkan, D. Ni, R. Chen, V. Boulay, J. Pene, K. Kuroiwa, S. Tominaga, and H. Yssel Activated, but not resting human Th2 cells, in contrast to Th1 and T regulatory cells, produce soluble ST2 and express low levels of ST2L at the cell surface. European Journal of Immunology 32: Draude, G., and R. L. Lorenz TGF-beta1 downregulates CD36 and scavenger receptor A but upregulates LOX-1 in human macrophages. American Journal of Physiology - Heart & Circulatory Physiology 278:H Eguchi, A., A. Murakami, and H. Ohigashi Nobiletin, a citrus flavonoid, suppresses phorbol ester-induced expression of multiple scavenger receptor genes in THP-1 human monocytic cells. FEBS Letters 580: Singh, N. N., and D. P. Ramji Transforming growth factor-beta-induced expression of the apolipoprotein E gene requires c-jun N-terminal kinase, p38 kinase, and casein kinase 2. Arteriosclerosis, Thrombosis & Vascular Biology 26: Kaplan, R., X. Gan, J. G. Menke, S. D. Wright, and T. Q. Cai Bacterial lipopolysaccharide induces expression of ABCA1 but not ABCG1 via an LXR-independent pathway. Journal of Lipid Research 43: Chinetti-Gbaguidi, G., E. Rigamonti, L. Helin, A. L. Mutka, M. Lepore, J. C. Fruchart, V. Clavey, E. Ikonen, S. Lestavel, and B. Staels Peroxisome proliferator-activated receptor alpha controls cellular cholesterol trafficking in macrophages. Journal of Lipid Research 46: Chinetti, G., S. Lestavel, J. C. Fruchart, V. Clavey, and B. Staels Peroxisome proliferator-activated receptor alpha reduces cholesterol esterification in macrophages. Circulation Research 92: Larigauderie, G., C. Cuaz-Perolin, A. B. Younes, C. Furman, C. Lasselin, C. Copin, M. Jaye, J. C. Fruchart, and M. Rouis Adipophilin increases triglyceride storage in human macrophages by stimulation of biosynthesis and inhibition of beta-oxidation. FEBS Journal 273:

3 9. Yamanishi, Y., D. L. Boyle, M. Clark, R. A. Maki, M. D. Tortorella, E. C. Arner, and G. S. Firestein Expression and regulation of aggrecanase in arthritis: the role of TGF-beta. Journal of Immunology 168: Lei, L., Y. Xiong, J. Chen, J. B. Yang, Y. Wang, X. Y. Yang, C. C. Chang, B. L. Song, T. Y. Chang, and B. L. Li TNF-alpha stimulates the ACAT1 expression in differentiating monocytes to promote the CE-laden cell formation. Journal of Lipid Research 50: Hickman, S. E., E. K. Allison, and J. El Khoury Microglial dysfunction and defective beta-amyloid clearance pathways in aging Alzheimer's disease mice. Journal of Neuroscience 28: Gafencu, A. V., M. R. Robciuc, E. Fuior, V. I. Zannis, D. Kardassis, and M. Simionescu Inflammatory signaling pathways regulating ApoE gene expression in macrophages. Journal of Biological Chemistry 282: Harvey, E. J., N. Li, and D. P. Ramji Critical role for casein kinase 2 and phosphoinositide-3-kinase in the interferon-gamma-induced expression of monocyte chemoattractant protein-1 and other key genes implicated in atherosclerosis. Arteriosclerosis, Thrombosis & Vascular Biology 27:

4 Supplementary Figure Legends Supplement Figure I ST2 mrna expression in THP-1 macrophages and HMDMs ST2 RT-PCR was performed on cdna generated from THP-1 macrophages and HMDMs using primers detailed in supplementary table I. GAPDH was used as an internal control (20 cycles, 60 C annealing temperature). The PCR products were size fractionated by agarose gel electrophoresis and analyzed using a Syngene gel documentation system (GRI). RT indicates where reverse transcriptase was omitted in the cdna synthesis step. M indicates molecular weight markers. Data is indicative of three separate experiments. Supplement Figure II reduces AcLDL uptake by THP-1 macrophages in a time and concentration-dependent manner DiI-AcLDL uptake was measured in 24 hour 160nM PMA-differentiated THP-1 macrophages incubated with a range of concentrations (1-20 ng/ml) of for 24 hours (n=3) (A) or over a range of time points (1-24 hours) with (10 ng/ml) (n=3) (B). Data represents mean+sd. Student s t- test, * P<0.05; ** P<0.01; *** P<

5 Supplement Figure I THP-1 HMDMs -RT ST2 GAPDH 4

6 A Supplement Figure II 120 % DiI-AcLDL uptake ** ** *** *** 0 B No DiI- AcLDL Untreated (1 ng/ml) (5 ng/ml) (10 ng/ml) (20 ng/ml) 120 % DiI-AcLDL uptake * * ** *** 0 No DiI- AcLDL Untreated 1hr 3hr 6hr 24hr

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France

G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille,

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Materials and Methods Cell culture Foam cell formation Cellular uptake of DiI-OxLDL In vitro cholesterol efflux assays

Materials and Methods Cell culture Foam cell formation Cellular uptake of DiI-OxLDL In vitro cholesterol efflux assays Materials and Methods Cell culture Mouse peritoneal macrophages (MPMs) were harvested from adult C57BL/6J mice (Jackson Laboratories, Sacramento, CA) and cultured as previously described. 1 J774.A1, THP-1,

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Table S1. Quantitative RT-PCR primers

Table S1. Quantitative RT-PCR primers Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,

More information

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured

More information

Peroxisome proliferator-activated receptors (PPARs) are

Peroxisome proliferator-activated receptors (PPARs) are Molecular Medicine Peroxisome Proliferator-Activated Receptor Reduces Cholesterol Esterification in Macrophages G. Chinetti, S. Lestavel, J.-C. Fruchart, V. Clavey, B. Staels Abstract Peroxisome proliferator-activated

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid phenotype

Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid phenotype Clinical Science (2010) 119, 265 272 (Printed in Great Britain) doi:10.1042/cs20100266 265 ACCELERATED PUBLICATION Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid

More information

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides. 1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis

Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis Supplementary Information Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation in Atherosclerosis Kazuyuki Kasahara 1,, Takeshi Tanoue 3, Tomoya Yamashita 1,*, Keiko

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

Atherosclerosis is a chronic inflammatory response to. Neopterin Counters Vascular Inflammation and Atherosclerosis ORIGINAL RESEARCH

Atherosclerosis is a chronic inflammatory response to. Neopterin Counters Vascular Inflammation and Atherosclerosis ORIGINAL RESEARCH Neopterin Counters Vascular Inflammation and Atherosclerosis Remina Shirai, MSc; Kengo Sato, PhD; Tomoyuki Yamashita, BSc; Maho Yamaguchi, BSc; Taisuke Okano, BSc; Kaho Watanabe-Kominato, MSc; Rena Watanabe,

More information

IL-24 AND ITS ROLE IN WOUND HEALING

IL-24 AND ITS ROLE IN WOUND HEALING IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor

More information

Increased CD36 protein as a response to defective insulin signaling in macrophages

Increased CD36 protein as a response to defective insulin signaling in macrophages Research article Increased CD36 protein as a response to defective insulin signaling in macrophages Chien-Ping Liang, Seongah Han, Haruka Okamoto, Ronald Carnemolla, Ira Tabas, Domenico Accili, and Alan

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Lipid metabolism in familial hypercholesterolemia

Lipid metabolism in familial hypercholesterolemia Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Macrophages play essential roles in immunity and lipid. Regulation of Macrophage Functions by PPAR-, PPAR-, and LXRs in Mice and Men

Macrophages play essential roles in immunity and lipid. Regulation of Macrophage Functions by PPAR-, PPAR-, and LXRs in Mice and Men ATVB In Focus Metabolic Syndrome and Atherosclerosis Series Editor: Marja-Riitta Taskinen Preview Brief Reviews in this Series: Deprés JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, Rodés-Cabau

More information

Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic

Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic Supplemental file Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic Protein-1-Induced Protein Ming He, Xiao Liang, Lan He, Wen Wen, Sijia Zhao, Liang Wen, Yan Liu, John

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200 JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,

More information

Ebrahim Abbasi Oshaghi 1,2

Ebrahim Abbasi Oshaghi 1,2 1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi

More information

Autophagy involved in lipopolysaccharide-induced foam cell formation is mediated by adipose differentiation-related protein

Autophagy involved in lipopolysaccharide-induced foam cell formation is mediated by adipose differentiation-related protein Feng et al. Lipids in Health and Disease 2014, 13:10 RESEARCH Open Access Autophagy involved in lipopolysaccharide-induced foam cell formation is mediated by adipose differentiation-related protein Xuyang

More information

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =

More information

Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein

More information

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.

More information

Niacin Metabolism: Effects on Cholesterol

Niacin Metabolism: Effects on Cholesterol Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342

More information

PPARg phosphorylation mediated by JNK MAPK: a potential role in macrophage-derived

PPARg phosphorylation mediated by JNK MAPK: a potential role in macrophage-derived Acta Pharmacologica Sinica 2006 Sep; 27 (9): 1146 1152 Full-length article PPARg phosphorylation mediated by JNK MAPK: a potential role in macrophage-derived foam cell formation 1 Ran YIN 2, Yu-gang DONG

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Review. Lipid droplet associated proteins: an emerging role in atherogenesis. Histology and Histopathology

Review. Lipid droplet associated proteins: an emerging role in atherogenesis. Histology and Histopathology Histol Histopathol (2011) 26: 631-642 http://www.hh.um.es Histology and Histopathology Cellular and Molecular Biology Review Lipid droplet associated proteins: an emerging role in atherogenesis Insa Buers

More information

EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE

EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE C. Fiévet and B. Staels, Institut Pasteur de Lille, Département d Athérosclérose, Lille, F- 59019 France, Inserm, U545, Lille, F-59019

More information

The uptake of lipids by macrophages (M ) resulting in

The uptake of lipids by macrophages (M ) resulting in TIP47, a Lipid Cargo Protein Involved in Macrophage Triglyceride Metabolism Insa Buers, Horst Robenek, Stefan Lorkowski, Yvonne Nitschke, Nicholas J. Severs, Oliver Hofnagel Objective Uptake of lipids

More information

Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,

Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard

More information

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

More information

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE Roberta Di Benedetto Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Istituto Superiore

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation

More information

Abstract: I. A ims Aim 1:

Abstract: I. A ims Aim 1: Abstract: Previous work from our laboratory demonstrated that obese mice have alterations in antiviral cytokine gene expression when infected with the influenza virus. Since these cytokines play a major

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Role of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis

Role of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis Role of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis ANDREW C. NICHOLSON, JIHONG HAN, MARIA FEBBRAIO, ROY L. SILVERSTERIN, AND DAVID P. HAJJAR Center of Vascular Biology, Cornell

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012

Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 1. What is Inflammation? 2. Acute and Chronic Inflammation 3. Role of Chronic Inflammation in Modern Human Diseases

More information

SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL

SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL Laurent Yvan-Charvet, 1, * Tamara A. Pagler,* Nan Wang,* Takafumi Senokuchi,* May Brundert, Hongna Li,* Franz Rinninger,

More information

Microglia, Inflammation, and FTD

Microglia, Inflammation, and FTD FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?

More information

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

More information

Supplementary Data. (continued)

Supplementary Data. (continued) Supplementary Data SUPPLEMENTARY FIG. S1. Gating strategy for Figure 1. Splenocytes were gated for dimension and for positivity to the different markers representing different cell populations. (A) B cells,

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Anti-atherogenic actions of dihomo-gamma-linolenic acid in macrophages

Anti-atherogenic actions of dihomo-gamma-linolenic acid in macrophages Anti-atherogenic actions of dihomo-gamma-linolenic acid in macrophages Hayley Gallagher BSc (Hons), MRes Primary Supervisor: Dr Dipak P. Ramji A thesis presented for the degree of Doctor of Philosophy

More information

Writing Effective Grant Proposals

Writing Effective Grant Proposals WritingEffectiveGrantProposals SUPPLEMENTALHANDOUT EXERCISES (toaccompanypowerpointslidepresentation) PamelaDerish ScientificPublicationsManager DepartmentofSurgery,UCSF tel415.885 7686 Pamela.Derish@ucsfmedctr.org

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris William Michael Mihalko, MD PhD, Lev Djenderedjian, Paramjeet S. Cheema, Richard A. Smith, PhD. University of Tennessee,

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Atherosclerosis Compendium

Atherosclerosis Compendium Atherosclerosis Compendium Circulation Research Compendium on Atherosclerosis Atherosclerosis: Successes, Surprises, and Future Challenges Epidemiology of Atherosclerosis and the Potential to Reduce the

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information