Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR
|
|
- Janel James
- 6 years ago
- Views:
Transcription
1 Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA [1] Human SR-A CCAGGGACATGGAATGCAA CCAGTGGGACCTCGATCTCC [2] Human CD36 GAGAACTGTTATGGGGCTAT TTCAACTGGAGAGGCAAAGG [2] Human SR-BI TGATGATGGAGAATAAGCCCAT TGACCGGGTGGATGTCCAGGAAC [3] Human ApoE TTCCTGGCAGGATGCCAGGC GGTCAGTTGTTCCTCCAGTTC [4] Human ABCA-1 TGTCCAGTCCAGTAATGGTTCTGT AAGCGAGATATGGTCCGGATT [5] Human ABCG-1 TGCAATCTTGTGCCATATTTGA CCAGCCGACTGTTCTGATCA [6] Human NPC-1 CTTAGTGCAGGAACTCTGTCCAGG TCCACATCACGGCAGGCATTGTAC [6] Human NPC-2 GGTTTGTCTTGTGACCGC AGGAATGTAGCTGCCAGG [6] Human CPT-1 ACAGTCGGTGAGGCCTCTTATGAA TCTTGCTGCCTGAATGTGAGTTGG [7] Human ADRP TGTGAGATGGCAGAGAACGGT CTGCTCACGAGCTGCATCATC [8] Human ACAT-1 GATGAAGGAAGGCTGGTGC GGAAGCTGGTGGCAGTGTAT [9] Human NCEH CACTCCTGCTGACTTGACCA CATCCCCTGTGCTGAAGAAT - Human GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC [10] Mouse SR-A TGAACGAGAGGATGCTGACTG GGAGGGGCCATTTTTAGTGC [11] Mouse CD36 GAACCACTGCTTTCAAAAACTGG TGCTGTTCTTTGCCACGTCA [11] Mouse SR-BI TTTGGAGTGGTAGTAAAAAGGGC TGACATCAGGGACTCAGAGTAG [11] Mouse ApoE ACAGATCAGCTCGAGTGGCAAA ATCTTGCGCAGGTGTGTGGAGA [12] Mouse ABCA-1 AGTGATAATCAAAGTCAAAGGCACAC AGCAACTTGGCACTAGTAACTCTG [5] Mouse ABCG-1 TTCATCGTCCTGGGCATCTT CGGATTTTGTATCTGAGGACGAA [5] Mouse β-actin TGGAGAAGAGCTATGAGCTGCCTG GTGCCACCAGACAGCACTGTGTTG [13] 1
2 References 1. Lecart, S., N. Lecointe, A. Subramaniam, S. Alkan, D. Ni, R. Chen, V. Boulay, J. Pene, K. Kuroiwa, S. Tominaga, and H. Yssel Activated, but not resting human Th2 cells, in contrast to Th1 and T regulatory cells, produce soluble ST2 and express low levels of ST2L at the cell surface. European Journal of Immunology 32: Draude, G., and R. L. Lorenz TGF-beta1 downregulates CD36 and scavenger receptor A but upregulates LOX-1 in human macrophages. American Journal of Physiology - Heart & Circulatory Physiology 278:H Eguchi, A., A. Murakami, and H. Ohigashi Nobiletin, a citrus flavonoid, suppresses phorbol ester-induced expression of multiple scavenger receptor genes in THP-1 human monocytic cells. FEBS Letters 580: Singh, N. N., and D. P. Ramji Transforming growth factor-beta-induced expression of the apolipoprotein E gene requires c-jun N-terminal kinase, p38 kinase, and casein kinase 2. Arteriosclerosis, Thrombosis & Vascular Biology 26: Kaplan, R., X. Gan, J. G. Menke, S. D. Wright, and T. Q. Cai Bacterial lipopolysaccharide induces expression of ABCA1 but not ABCG1 via an LXR-independent pathway. Journal of Lipid Research 43: Chinetti-Gbaguidi, G., E. Rigamonti, L. Helin, A. L. Mutka, M. Lepore, J. C. Fruchart, V. Clavey, E. Ikonen, S. Lestavel, and B. Staels Peroxisome proliferator-activated receptor alpha controls cellular cholesterol trafficking in macrophages. Journal of Lipid Research 46: Chinetti, G., S. Lestavel, J. C. Fruchart, V. Clavey, and B. Staels Peroxisome proliferator-activated receptor alpha reduces cholesterol esterification in macrophages. Circulation Research 92: Larigauderie, G., C. Cuaz-Perolin, A. B. Younes, C. Furman, C. Lasselin, C. Copin, M. Jaye, J. C. Fruchart, and M. Rouis Adipophilin increases triglyceride storage in human macrophages by stimulation of biosynthesis and inhibition of beta-oxidation. FEBS Journal 273:
3 9. Yamanishi, Y., D. L. Boyle, M. Clark, R. A. Maki, M. D. Tortorella, E. C. Arner, and G. S. Firestein Expression and regulation of aggrecanase in arthritis: the role of TGF-beta. Journal of Immunology 168: Lei, L., Y. Xiong, J. Chen, J. B. Yang, Y. Wang, X. Y. Yang, C. C. Chang, B. L. Song, T. Y. Chang, and B. L. Li TNF-alpha stimulates the ACAT1 expression in differentiating monocytes to promote the CE-laden cell formation. Journal of Lipid Research 50: Hickman, S. E., E. K. Allison, and J. El Khoury Microglial dysfunction and defective beta-amyloid clearance pathways in aging Alzheimer's disease mice. Journal of Neuroscience 28: Gafencu, A. V., M. R. Robciuc, E. Fuior, V. I. Zannis, D. Kardassis, and M. Simionescu Inflammatory signaling pathways regulating ApoE gene expression in macrophages. Journal of Biological Chemistry 282: Harvey, E. J., N. Li, and D. P. Ramji Critical role for casein kinase 2 and phosphoinositide-3-kinase in the interferon-gamma-induced expression of monocyte chemoattractant protein-1 and other key genes implicated in atherosclerosis. Arteriosclerosis, Thrombosis & Vascular Biology 27:
4 Supplementary Figure Legends Supplement Figure I ST2 mrna expression in THP-1 macrophages and HMDMs ST2 RT-PCR was performed on cdna generated from THP-1 macrophages and HMDMs using primers detailed in supplementary table I. GAPDH was used as an internal control (20 cycles, 60 C annealing temperature). The PCR products were size fractionated by agarose gel electrophoresis and analyzed using a Syngene gel documentation system (GRI). RT indicates where reverse transcriptase was omitted in the cdna synthesis step. M indicates molecular weight markers. Data is indicative of three separate experiments. Supplement Figure II reduces AcLDL uptake by THP-1 macrophages in a time and concentration-dependent manner DiI-AcLDL uptake was measured in 24 hour 160nM PMA-differentiated THP-1 macrophages incubated with a range of concentrations (1-20 ng/ml) of for 24 hours (n=3) (A) or over a range of time points (1-24 hours) with (10 ng/ml) (n=3) (B). Data represents mean+sd. Student s t- test, * P<0.05; ** P<0.01; *** P<
5 Supplement Figure I THP-1 HMDMs -RT ST2 GAPDH 4
6 A Supplement Figure II 120 % DiI-AcLDL uptake ** ** *** *** 0 B No DiI- AcLDL Untreated (1 ng/ml) (5 ng/ml) (10 ng/ml) (20 ng/ml) 120 % DiI-AcLDL uptake * * ** *** 0 No DiI- AcLDL Untreated 1hr 3hr 6hr 24hr
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationG. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France
LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille,
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationMaterials and Methods Cell culture Foam cell formation Cellular uptake of DiI-OxLDL In vitro cholesterol efflux assays
Materials and Methods Cell culture Mouse peritoneal macrophages (MPMs) were harvested from adult C57BL/6J mice (Jackson Laboratories, Sacramento, CA) and cultured as previously described. 1 J774.A1, THP-1,
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationAmniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
More informationPotential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.
Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured
More informationPeroxisome proliferator-activated receptors (PPARs) are
Molecular Medicine Peroxisome Proliferator-Activated Receptor Reduces Cholesterol Esterification in Macrophages G. Chinetti, S. Lestavel, J.-C. Fruchart, V. Clavey, B. Staels Abstract Peroxisome proliferator-activated
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationOverexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid phenotype
Clinical Science (2010) 119, 265 272 (Printed in Great Britain) doi:10.1042/cs20100266 265 ACCELERATED PUBLICATION Overexpression of STARD3 in human monocyte/macrophages induces an anti-atherogenic lipid
More informationGene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.
1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationDifferential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ
Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationCommensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis
Supplementary Information Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation in Atherosclerosis Kazuyuki Kasahara 1,, Takeshi Tanoue 3, Tomoya Yamashita 1,*, Keiko
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
More informationAtherosclerosis is a chronic inflammatory response to. Neopterin Counters Vascular Inflammation and Atherosclerosis ORIGINAL RESEARCH
Neopterin Counters Vascular Inflammation and Atherosclerosis Remina Shirai, MSc; Kengo Sato, PhD; Tomoyuki Yamashita, BSc; Maho Yamaguchi, BSc; Taisuke Okano, BSc; Kaho Watanabe-Kominato, MSc; Rena Watanabe,
More informationIL-24 AND ITS ROLE IN WOUND HEALING
IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor
More informationIncreased CD36 protein as a response to defective insulin signaling in macrophages
Research article Increased CD36 protein as a response to defective insulin signaling in macrophages Chien-Ping Liang, Seongah Han, Haruka Okamoto, Ronald Carnemolla, Ira Tabas, Domenico Accili, and Alan
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationMacrophages play essential roles in immunity and lipid. Regulation of Macrophage Functions by PPAR-, PPAR-, and LXRs in Mice and Men
ATVB In Focus Metabolic Syndrome and Atherosclerosis Series Editor: Marja-Riitta Taskinen Preview Brief Reviews in this Series: Deprés JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, Rodés-Cabau
More informationEndothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic
Supplemental file Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic Protein-1-Induced Protein Ming He, Xiao Liang, Lan He, Wen Wen, Sijia Zhao, Liang Wen, Yan Liu, John
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationOriginal Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine
Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationJLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200
JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,
More informationEbrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
More informationAutophagy involved in lipopolysaccharide-induced foam cell formation is mediated by adipose differentiation-related protein
Feng et al. Lipids in Health and Disease 2014, 13:10 RESEARCH Open Access Autophagy involved in lipopolysaccharide-induced foam cell formation is mediated by adipose differentiation-related protein Xuyang
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationEffect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice
ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationPPARg phosphorylation mediated by JNK MAPK: a potential role in macrophage-derived
Acta Pharmacologica Sinica 2006 Sep; 27 (9): 1146 1152 Full-length article PPARg phosphorylation mediated by JNK MAPK: a potential role in macrophage-derived foam cell formation 1 Ran YIN 2, Yu-gang DONG
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationReview. Lipid droplet associated proteins: an emerging role in atherogenesis. Histology and Histopathology
Histol Histopathol (2011) 26: 631-642 http://www.hh.um.es Histology and Histopathology Cellular and Molecular Biology Review Lipid droplet associated proteins: an emerging role in atherogenesis Insa Buers
More informationEFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE
EFFECTS OF PPARγ LIGANDS ON ATHEROSCLEROSIS AND CARDIOVASCULAR DISEASE C. Fiévet and B. Staels, Institut Pasteur de Lille, Département d Athérosclérose, Lille, F- 59019 France, Inserm, U545, Lille, F-59019
More informationThe uptake of lipids by macrophages (M ) resulting in
TIP47, a Lipid Cargo Protein Involved in Macrophage Triglyceride Metabolism Insa Buers, Horst Robenek, Stefan Lorkowski, Yvonne Nitschke, Nicholas J. Severs, Oliver Hofnagel Objective Uptake of lipids
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationBIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE
BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE Roberta Di Benedetto Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Istituto Superiore
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationDietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationAbstract: I. A ims Aim 1:
Abstract: Previous work from our laboratory demonstrated that obese mice have alterations in antiviral cytokine gene expression when infected with the influenza virus. Since these cytokines play a major
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationRole of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis
Role of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis ANDREW C. NICHOLSON, JIHONG HAN, MARIA FEBBRAIO, ROY L. SILVERSTERIN, AND DAVID P. HAJJAR Center of Vascular Biology, Cornell
More informationTherapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationVadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012
Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 1. What is Inflammation? 2. Acute and Chronic Inflammation 3. Role of Chronic Inflammation in Modern Human Diseases
More informationSR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL
SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL Laurent Yvan-Charvet, 1, * Tamara A. Pagler,* Nan Wang,* Takafumi Senokuchi,* May Brundert, Hongna Li,* Franz Rinninger,
More informationMicroglia, Inflammation, and FTD
FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationSupplementary Data. (continued)
Supplementary Data SUPPLEMENTARY FIG. S1. Gating strategy for Figure 1. Splenocytes were gated for dimension and for positivity to the different markers representing different cell populations. (A) B cells,
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationAnti-atherogenic actions of dihomo-gamma-linolenic acid in macrophages
Anti-atherogenic actions of dihomo-gamma-linolenic acid in macrophages Hayley Gallagher BSc (Hons), MRes Primary Supervisor: Dr Dipak P. Ramji A thesis presented for the degree of Doctor of Philosophy
More informationWriting Effective Grant Proposals
WritingEffectiveGrantProposals SUPPLEMENTALHANDOUT EXERCISES (toaccompanypowerpointslidepresentation) PamelaDerish ScientificPublicationsManager DepartmentofSurgery,UCSF tel415.885 7686 Pamela.Derish@ucsfmedctr.org
More informationSupplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationEffects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris
Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris William Michael Mihalko, MD PhD, Lev Djenderedjian, Paramjeet S. Cheema, Richard A. Smith, PhD. University of Tennessee,
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationAtherosclerosis Compendium
Atherosclerosis Compendium Circulation Research Compendium on Atherosclerosis Atherosclerosis: Successes, Surprises, and Future Challenges Epidemiology of Atherosclerosis and the Potential to Reduce the
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSpherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin
Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
More information