Phospholipids, Triglycerids. Léránt István
|
|
- Marylou Clark
- 5 years ago
- Views:
Transcription
1 Phospholipids, Triglycerids Léránt István
2 Membran lipids Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of Glycerol Fatty acid Fatty acid Fatty acid Glycerol Fatty acid Fatty acid P Alcohol phospholipids Neutral fats Glycerol-phosphat acyltransferase Neutral fats Phospholipids
3 In most tissues Glycerol - glycerol-kinase ADIPOCYTES: Glycolysis - DHAP
4 BIOSYNTHESIS OF MEMBRANE LIPIDS Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of phospholipids Neutral fats ACYL-GLYCEROL-SYNTHETASE COMPLEX Endoplasmatic reticulum phosphatase Diacylglycerol acyltransferase
5 BIOSYNTHESIS OF MEMBRANE LIPIDS BIOSYNTHESIS of PHOSPHOLIPIDS Phosphatidic acid / alcohol - activation
6 SYNTHESIS of PHOSPHATIDYLINOSITOL 4,5 DIPHOSPHATE CDP-diacylglycerol phosphatidyl-inositol phosphatidyl-inositol 4,5 diphosphate Phospholipase C
7 Mitochondria - Cardiolipin R2 C O O H 2 C C H 2 C O H O C R1 O O P O O H H 2 C O P C CH 2 OH O O O CH 2 O H C O C R4 C O CH 2 O R3 Phosphatidyl - glycerol Diphosphatidyl glycerol; Cardiolipin P - P - ph ~ / = 7,0 pk H 3 PO 4 ~ / = 1-2 Mitochondria / Lues
8 Mitochondria - Cardiolipin Glycerol -3- P 2 glycerol-3-phosphate acyltranspherase phosphatidate CDP-DAG synthase phosphatidate CDP diacylglyc erol P GP synthase CDP diacylglyc erol phosphatidylglycerol - P (PGP) phosphatidylglycerol dephosphor ylation - P (PGP) phosphatidylglycerol phosphatidylglycerol CDP-diacylglycerol cardiolipi n P - P - CTP CDP
9 PHOSPHATIDYL-CHOLINE CHOLINE FOOD CIRCULATION Cholinergic presynaptical membrane Choline transport high affinity Liver: phosphatidyl-etanolamine Cytoplasm Endoplasmatic reticulum Choline-kinase CTP:phosphocholine cytidyliltranspherase CDP-CHOLINE: 1,2-diglyceride Phosphocholine ltranspherase Endoplasmatic reticulum
10 LIVER BIOSYNTHESIS OF PHOSPHATIDYL-ETANOLAMINE & PHOSPHATIDYL-CHOLINE CHOLINE CHOLINE-P CDP-CHOLINE CO 2 PHOSPHATIDYL SERINE 3 SAM PHOSPHATIDYL- CHOLINE 3 S-adenosylhomocysteine
11 LIVER BIOSYNTHESIS OF PHOSPHATIDYL-ETANOLAMINE & PHOSPHATIDYL-CHOLINE Rate limiting enzyme: CTP:phosphocholine cytidyliltranspherase CHOLINE CHOLINE-P Cytoplasm endoplasmatic reticulum translocation activation + fatty acid fatty-acyl-coa / DAG CDP-CHOLINE camp dep protein kinase Lipidtransport PCh dependent [Choline] / VLDL / fatty liver PHOSPHATIDYL- CHOLINE CO 2 PHOSPHATIDYL SERINE 3 SAM 3 S-adenosylhomocysteine
12
13
14
15
16
17
18 ABO blood group system Glu Gal GalNAc Gal O antigen Fuc Glu Gal GalNAc Gal GalNAc A antigen Fuc Glu Gal GalNAc Gal Gal B antigen Fuc
19 ABO blood group system Fucosyl-transferase 9 fucosyl-transferase (human) 3 fucosyl-transferase ABH
20 ABO system
21 People of certain ABO groups susceptibility to certain infections Bubonic plaque Small pox Bubonic plaque Yersinia pestis. Related bacteria: Pasteurella pestis - H antigén People of O group no anti-h antibody Frequency of O group is significantly lower in Mongólia, Turkey and in North Africa Extrapolation many hundred years ago?
22 People of ABO groups may be more susceptible to certain infections The Bubonic Plague There has been some suggestions that people of certain ABO groups may be more susceptible to certain infections. In particular it is thought that some historical pandemics have influenced the current distribution of the ABO gene frequencies in different parts of the world. In particular the bubonic plague and small pox The bubonic plague is caused by a bacterium Yersinia pestis. A related bacteria Pasteurella pestis possess a H like antigen. It has been extrapolated that the bacteria causing plague also expressed a similar H like antigen (25, 43). Therefore group O individuals who do not form an anti H are likely to be more susceptible to plague infection and mortality than A, B or AB people. This is supported by the observation that the frequency of the O gene is lower in areas that did experience significant plague epidemics such as Mongolia, Turkey and North Africa. These observations are not concrete. It is virtually impossible to extrapolate back to the organisms that were causing the plague centuries ago and confirm the H like antigen was present on the bacteria. The Bubonic Plague There has been some suggestions that people of certain ABO groups may be more susceptible to certain infections. In particular it is thought that some historical pandemics have influenced the current distribution of the ABO gene frequencies in
23 SMALLPOX A antigen-like structures Higher resistency of people of O és B groups Smallpox pandemic: Iceland Asia Africa Frequency of A substance is there significantly lower.
24
25 Gangliosides G M3 Gal Glu Ceramid NANA G M2 GalNAc Gal Glu Ceramid NANA Cholera toxin G M1 GalNAc Gal Glu Ceramid Gal NANA
26
27 Sphingolipidoses Demyelinisation: Sclerosis multiplex White matter [phospholipid], [plasmenyl ethanolamine], [sphingolipids] White matter ~ grey matter Sphingoliopidosis: Accumulation of complex lipids Synthesis of complex lipids is not affected. Lack of lysosomal enzymes All tissueas are affected Multiple sulfatase defficiency
28 Sphingolipidoses Niemann-Pick Ceramid P-Kol sphingomyelinase Accumulation of sphingomyelin
29 Gaucher disease Spleen, liver, bone-marrow, reticuloendothelial cells Accumulation of glucocerebrozides Gaucher cells Mentális retardáció Gaucher Ceramid Glu b-glucosidase
30 Krabbe disease Accumulation of Galactosyl ceramide Krabbe Ceramid Gal b-galaktosidase
31 Lack of Hexosaminidase A N-acetyl-galactosamine is not cleaved from the GM2 gangliosids Paralysis, deafness, Mental retardation Macrocephalia Death at age 2-4 1:3500 Tay-Sachs desease
32 Tay-Sachs disease Tay - Sachs Ceramid Glu Gal GalNAc NANA hexoseaminidase
33 Sphingolipidoses Fabry Ceramid Glu Gal Gal a-galaktosidase
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS. Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry STORAGE AND MEMBRANE LIPIDS STORAGE LIPIDS Mainly as triacylglycerols (triglycerides) in adipose cells Constitute
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationnumber Done by Corrected by Doctor
number 26 Done by حسام أبو عوض Corrected by Zaid Emad Doctor فيصل الخطيب 1 P a g e A small note about phosphatidyl inositol-4,5-bisphosphate (PIP2) before moving on: This molecule is found in the membrane
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationLipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair
Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.
More informationII- Compound Lipids. 1- Phospholipids
II- ompound Lipids ompound (conjugated) lipids are lipids conjugated with other substances. They include: 1- Phospholipids formed of lipid, phosphoric acid and nitrogenous base. 2- Glycolipids, formed
More informationI. Structure and Properties of Lipids
I. Structure and Properties of Lipids Lipids: A diverse group of compounds characterized by their low solubility in water and a high solubility in organic solvents such as chloroform and methanol. Nonpolar
More informationPHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure
More informationANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
More informationBiochemistry sheet #19. Biosynthesis of Triacylglycerol and Phosphoacylglycerol
Biochemistry sheet #19 Biosynthesis of Triacylglycerol and Phosphoacylglycerol Slide 1 This slide shows the components of triacylglycerol (TAG) and phosphoacylglycerol. TAG (Glycerol) Esterified to 3(
More informationAbdallah Q& Razi. Faisal
27 & Ahmad Attari م ح م د ي وس ف Abdallah Q& Razi Faisal Sphingophospolipids - The backbone of sphingophospholipids is sphingosine, unlike glycerophospholipids with a glycerol as the backbone. Which contains
More informationMembrane Lipids & Cholesterol Metabolism
Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationOptimising. membranes
Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationTest Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
More informationChapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.
BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal
More informationLIPIDS TAG, PL and SL metabolism. Marek Vecka
LIPIDS TAG, PL and SL metabolism Marek Vecka BIOSYNTHESIS OF TAG TWO BIOSYNTHETIC PATHWAYS IN MAMMALS liver, adipose tissue - use mainly phosphatidate pathway ( Kennedy pathway ) intestine - monoacylglycerol
More informationLeen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
More informationMolecular Organization of the Cell Membrane
Molecular Organization of the Cell Membrane A walk from molecules to a functional biostructure Cell Membrane Definition An ultrastructure separating connecting the cell to the environment 1 Coarse chemical
More informationChem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols
Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced
More informationLipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis
More informationQuestion (1) ) Put the sign ( ) against the right sentences and the sign (X) against the wrong sentences:(10 Marks)
Course No: PHARM 2315 Course Title:Biochemistry Date: 01/06/ 2017 No. of Questions: (5) Time: TWO hours Using Calculator (Yes) University of Palestine Final Exam Second Semester 2016/2017 Total Grade:
More informationTEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
More informationDr. Nafith Abu Tarboush
6 Dr. Nafith Abu Tarboush June 26 th 2013 Noor Salem 1 Not corrected Review Lipids are composed of two main connected parts : o Alcohol Sphingosine Glycerol o Fatty Acids (3 in number) Saturated Long Chain
More informationLIPIDS Introduction - complex lipids. Marek Vecka
LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other
More informationThe role of the laboratory in diagnosing lysosomal disorders
The role of the laboratory in diagnosing lysosomal disorders Dr Guy Besley, formerly Willink Biochemical Genetics Unit, Manchester Children s Hospital, Manchester M27 4HA, UK. Lysosomal disorders What
More informationFAD FADH2. glycerol-3- phosphate. dehydrogenase. This DHAP is metabolically no different from that produced in glycolysis.
1 Lipid Metabolism: ow that we are aware of the types of lipids in our bodies, it is important to see how we make them or break them. We will start our discussion with triacylglyceride degradation, and
More information2 Tissue Lipid Metabolism: b-oxidation of Fatty Acids. Lecturer Alexander N. Koval
2 Tissue Lipid Metabolism: b-oxidation of Fatty Acids Lecturer Alexander N. Koval The structure of the lecture course 12/1/2016 Koval A. (C), 2016 2 Biochemistry of Lipids-2 1. b-oxidation of fatty acids
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationContents 1 Metabolism and Roles of Eicosanoids in Brain
Contents 1 Metabolism and Roles of Eicosanoids in Brain... 1 1.1 Introduction... 1 1.2 Multiplicity of Cyclooxygenases, Lipoxygenases, and Epoxygenases in the Brain... 4 1.2.1 Cyclooxygenases (COXs)...
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More information1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant
1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant Lipid: Definition Biological molecules that are insoluble in aqueous solutions and
More informationPhospholipids and their metabolism
Phospholipids and their metabolism D. GOMPERTZ J. clin. Path., 26, suppl. (Ass. Clin. Path.), 5, -16 From the Departments of Medicine and Chemical Pathology, Royal Postgraduate Medical School, London Phospholipids
More informationSome common classifications of lipids and their general biologic functions Primary Functions Energy sources, biosynthetic precursors
NATURE F LIPIDS. Lipids have a hydrophobic nature because of the predominance of hydrocarbon chains ( H 2 H 2 H 2 ) in their structure. They are insoluble or only poorly soluble in water, but readily soluble
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationLIPIDS II: TRIACYLGLYCEROLS:
LIPIDS II: TRIACYLGLYCEROLS: How are they broken down? o Hydrolyzed into 3 fatty acids and 1 glycerol o Physiologically in body: Enzyme called a LIPASE present in adipocytes and intestines o Saponification
More informationPhospholipid Synthesis and Transport in Mammalian Cells
2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd doi:10.1111/tra.12230 Review Phospholipid Synthesis and Transport in Mammalian Cells Jean E. Vance Department of Medicine and Group on Molecular
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationClassification, functions and structure
Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids
More informationFATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS
FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS Dicarboxylic acids, ketone bodies. Department of General Chemistry Structure and classification of lipids Lipids can be divided into five categories, on the
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationKing Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids
King Saud University College of Science Department of Biochemistry General Biochemistry-II (BCH 302) Chapter 4 Lipids Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya http://faculty.ksu.edu.sa/75112
More informationTHROMBOSIS PRODUCT HIGHLIGHTS
PRODUCT HIGHLIGHTS AESKU.DIAGNOSTICS has extensive experience and know-how in the Anti-Phospholipid Syndrome (APS) field and offers the most comprehensive panel of anti-phospholipid tests, employing highly
More informationLipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Lipids and Membranes I. overview Lipids are related
More informationIT IS NOW well established that after injection of radioactive. and inner mitochondrial membranes
Study of the transfer of phospholipids from the endoplasmic reticulum to the outer and inner mitochondrial membranes MARIE-THERESE SAUNER and MARIANNE LEVY Laboratoire de Physiologie de la Nutrition, Facult6
More informationBIOC 462b Dr. Tischler SYNTHESIS OF FATTY ACIDS, TRIACYLGLYCEROL, PHOSPHOLIPIDS
BIO 462b Dr. Tischler YNTHI OF FTTY ID, TRIYLGLYROL, HOHOLIID Text: pages 343-351; 805-817; 820-831 ample roblems: see xam 4 sample problems on exam page of course web site Recommended roblems to olve:
More informationAnabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides
Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides
More informationAhmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun
10 Ahmad O. Olimat Abdallah Al-Qawasmeh Mohammed Yousef Dr.Mamoun A QUICK RECAP Eicosanoids They are derived from Arachidonic acid, a fatty acid that contains 20 carbon atoms and four double bonds. They
More informationBiochemistry of Lipids, Lipoproteins and Membranes
Biochemistry of Lipids, Lipoproteins and Membranes Editors DENNIS E. VANCE and JEAN E. VANCE Lipid and Lipoprotein Research Group, Faculty of Medicine, 328 Heritage Medical Research Centre, Edmonton, Aha.,
More informationBiological role of lipids
Lipids Lipids Organic compounds present in living organisms, insoluble in water but able to be extracted by organic solvents such as: chloroform, acetone, benzene. Extraction = the action of taking out
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationLearning Guide. Molecules to Cells Week Two
Learning Guide Molecules to Cells Week Two 1 Learning Session Learning Resource Learning Objective Assessment ILA 2 ph, Amino Acids, and Peptides TBL 2 Molecular Tools of Genetic Diagnosis Lecture 13 Introduction
More informationnumber Done by Corrected by Doctor
number 25 Done by موسى صبح Corrected by عبد الرحمن الحنبلي Doctor فيصل الخطيب 1 P a g e Introduction The subject of this lecture is glycerophospholipids also known as phosphoglyceridesor phosphoacylglycerols,
More informationRole of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationLipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10
1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural
More information2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below.
Paper 4: Biomolecules and their interactions Module 21: Classification of Lipids: simple and compound lipids, phospholipids, Cholesterol OBJECTIVE The main aim of this module is to introduce the students
More informationMass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
More informationMol Bio Biochem 694:407 &115: 511 Second Hourly, Deis
Mol Bio Biochem 694:407 &115: 511 Second Hourly, Deis Tuesday, Oct. 31, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth
More informationChapter 11: Lipids. Voet & Voet: Pages
Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,
More informationFatty Acids Synthesis L3
Fatty Acids Synthesis L3 The pathway for fatty acid synthesis occurs in the cytoplasm, whereas, oxidation occurs in the mitochondria. The other major difference is the use of nucleotide co-factors. Oxidation
More informationCHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS
HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility
More informationLecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in
Lecture 3 Lipids: Chapter 20 Sections 4-7! The most polar lipids are found in the membranes of cells and organelles! Why?! These lipids are amphipathic! Membranes are complex and have many components Membrane
More informationLipids and Biological Membranes
Lipids and Biological Membranes Lipids: Found in all living organisms Especially important as components of biological membranes Defined functionally, not structurally, as compounds that are totally or
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationMicroreview. A.-F. Miller, 2008, pg
Microreview Polysaccharides: a vast diversity based on stereochemistry. Stereochemical differences are associated with secondary and tertiary structural differences: nature s huge and plentiful polymers.
More informationPhospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes
Progress in Lipid Research 38 (1999) 361±399 www.elsevier.com/locate/plipres Phospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes George
More informationBiomolecules: lipids
Biomolecules: lipids Organic biomolecules: lipids Organic amphiphilic compounds insoluble in water Easily extracted from animal and vegetal cells using apolar solvents Fundamental to build cell's shape
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationLipids. Chapter 11: Outline. Fatty Acids. Lipid Classes. Fatty Acids-2. Fatty Acids-3. General Types eg. A fatty acid
Chapter 11: utline Lipid Classes Fatty Acids and Derivatives Triacylglycerols Phospholipids Isoprenoids Membranes Membrane Structure Membrane Function Wax Esters Sphingolipids Lipoproteins Lipids General
More informationDr MS Islam Sr. Lecturer of Biochemistry School of Life Sciences, Westville Campus
Dr MS Islam Sr. Lecturer of Biochemistry School of Life Sciences, Westville Campus Lipids play roles both in energy metabolism and in aspects of biological structure and functions The great bulk of lipid
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationBiochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib
Page1 بسم رلاهللا On Thursday, we discussed the synthesis of fatty acids and its regulation. We also went on to talk about the synthesis of Triacylglycerol (TAG). Last time, we started talking about the
More informationMILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
More informationDepartment of Biochemistry, Duke University Medical Center, Durham, NC (2, 6). During these selective transport processes
Lipid topogenesis R. M. Bell, L. M. Ballas, and R. A. Coleman Department of Biochemistry, Duke University Medical Center, Durham, NC 27710 Abstract Investigations of the topography of glycerolipid sorted
More informationVoet Biochemistry 3e John Wiley & Sons, Inc.
* * Voet Biochemistry 3e Lipid Metabolism Part I: (Chap. 25, sec.1-3) Glucose C 6 H 12 O 6 + 6 O 2 6 CO 2 + 6 H 2 O G o = -2823 kj/mol Fats (palmitic acid) C 16 H 32 O 2 + 23 O 2 16 CO 2 + 16 H 2 O G o
More informationSynthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
More informationObjectives By the end of lecture the student should:
Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More informationCARBOHYDRATE METABOLISM 1
CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationChapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,
More informationnumber Done by Corrected by Doctor
number 20 Done by Corrected by Rana Ghassan Doctor Only 4 questions in the mid-term exam are based on the 4 lectures to be given by Dr Faisal. Dr Faisal will give us 10 lectures, the first 4 are included
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationThin layer absorption chromatography can achieve very good separation of small lipid samples
Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from
More informationBIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.
BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In
More informationGUTS Lecture Syllabus for Lipid Structure and Nomenclature
GUTS Lecture Syllabus for Lipid Structure and Nomenclature For Questions or Assistance contact: Dr. Gwen Sancar, gsancar@ad.unc.edu Learning bjectives After completing the GUTS lecture and associated self-
More informationDr. Mamoun. Loai Azar
13 Dr. Mamoun Loai Azar Lipids (2) - To get the best of this sheet PLEASE study it side by side with the doctor s slides. - In this lecture the doctor continued talking about Eicosanoids. Derived Fatty
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationPropagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More information