Phospholipids, Triglycerids. Léránt István

Size: px
Start display at page:

Download "Phospholipids, Triglycerids. Léránt István"

Transcription

1 Phospholipids, Triglycerids Léránt István

2 Membran lipids Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of Glycerol Fatty acid Fatty acid Fatty acid Glycerol Fatty acid Fatty acid P Alcohol phospholipids Neutral fats Glycerol-phosphat acyltransferase Neutral fats Phospholipids

3 In most tissues Glycerol - glycerol-kinase ADIPOCYTES: Glycolysis - DHAP

4 BIOSYNTHESIS OF MEMBRANE LIPIDS Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of phospholipids Neutral fats ACYL-GLYCEROL-SYNTHETASE COMPLEX Endoplasmatic reticulum phosphatase Diacylglycerol acyltransferase

5 BIOSYNTHESIS OF MEMBRANE LIPIDS BIOSYNTHESIS of PHOSPHOLIPIDS Phosphatidic acid / alcohol - activation

6 SYNTHESIS of PHOSPHATIDYLINOSITOL 4,5 DIPHOSPHATE CDP-diacylglycerol phosphatidyl-inositol phosphatidyl-inositol 4,5 diphosphate Phospholipase C

7 Mitochondria - Cardiolipin R2 C O O H 2 C C H 2 C O H O C R1 O O P O O H H 2 C O P C CH 2 OH O O O CH 2 O H C O C R4 C O CH 2 O R3 Phosphatidyl - glycerol Diphosphatidyl glycerol; Cardiolipin P - P - ph ~ / = 7,0 pk H 3 PO 4 ~ / = 1-2 Mitochondria / Lues

8 Mitochondria - Cardiolipin Glycerol -3- P 2 glycerol-3-phosphate acyltranspherase phosphatidate CDP-DAG synthase phosphatidate CDP diacylglyc erol P GP synthase CDP diacylglyc erol phosphatidylglycerol - P (PGP) phosphatidylglycerol dephosphor ylation - P (PGP) phosphatidylglycerol phosphatidylglycerol CDP-diacylglycerol cardiolipi n P - P - CTP CDP

9 PHOSPHATIDYL-CHOLINE CHOLINE FOOD CIRCULATION Cholinergic presynaptical membrane Choline transport high affinity Liver: phosphatidyl-etanolamine Cytoplasm Endoplasmatic reticulum Choline-kinase CTP:phosphocholine cytidyliltranspherase CDP-CHOLINE: 1,2-diglyceride Phosphocholine ltranspherase Endoplasmatic reticulum

10 LIVER BIOSYNTHESIS OF PHOSPHATIDYL-ETANOLAMINE & PHOSPHATIDYL-CHOLINE CHOLINE CHOLINE-P CDP-CHOLINE CO 2 PHOSPHATIDYL SERINE 3 SAM PHOSPHATIDYL- CHOLINE 3 S-adenosylhomocysteine

11 LIVER BIOSYNTHESIS OF PHOSPHATIDYL-ETANOLAMINE & PHOSPHATIDYL-CHOLINE Rate limiting enzyme: CTP:phosphocholine cytidyliltranspherase CHOLINE CHOLINE-P Cytoplasm endoplasmatic reticulum translocation activation + fatty acid fatty-acyl-coa / DAG CDP-CHOLINE camp dep protein kinase Lipidtransport PCh dependent [Choline] / VLDL / fatty liver PHOSPHATIDYL- CHOLINE CO 2 PHOSPHATIDYL SERINE 3 SAM 3 S-adenosylhomocysteine

12

13

14

15

16

17

18 ABO blood group system Glu Gal GalNAc Gal O antigen Fuc Glu Gal GalNAc Gal GalNAc A antigen Fuc Glu Gal GalNAc Gal Gal B antigen Fuc

19 ABO blood group system Fucosyl-transferase 9 fucosyl-transferase (human) 3 fucosyl-transferase ABH

20 ABO system

21 People of certain ABO groups susceptibility to certain infections Bubonic plaque Small pox Bubonic plaque Yersinia pestis. Related bacteria: Pasteurella pestis - H antigén People of O group no anti-h antibody Frequency of O group is significantly lower in Mongólia, Turkey and in North Africa Extrapolation many hundred years ago?

22 People of ABO groups may be more susceptible to certain infections The Bubonic Plague There has been some suggestions that people of certain ABO groups may be more susceptible to certain infections. In particular it is thought that some historical pandemics have influenced the current distribution of the ABO gene frequencies in different parts of the world. In particular the bubonic plague and small pox The bubonic plague is caused by a bacterium Yersinia pestis. A related bacteria Pasteurella pestis possess a H like antigen. It has been extrapolated that the bacteria causing plague also expressed a similar H like antigen (25, 43). Therefore group O individuals who do not form an anti H are likely to be more susceptible to plague infection and mortality than A, B or AB people. This is supported by the observation that the frequency of the O gene is lower in areas that did experience significant plague epidemics such as Mongolia, Turkey and North Africa. These observations are not concrete. It is virtually impossible to extrapolate back to the organisms that were causing the plague centuries ago and confirm the H like antigen was present on the bacteria. The Bubonic Plague There has been some suggestions that people of certain ABO groups may be more susceptible to certain infections. In particular it is thought that some historical pandemics have influenced the current distribution of the ABO gene frequencies in

23 SMALLPOX A antigen-like structures Higher resistency of people of O és B groups Smallpox pandemic: Iceland Asia Africa Frequency of A substance is there significantly lower.

24

25 Gangliosides G M3 Gal Glu Ceramid NANA G M2 GalNAc Gal Glu Ceramid NANA Cholera toxin G M1 GalNAc Gal Glu Ceramid Gal NANA

26

27 Sphingolipidoses Demyelinisation: Sclerosis multiplex White matter [phospholipid], [plasmenyl ethanolamine], [sphingolipids] White matter ~ grey matter Sphingoliopidosis: Accumulation of complex lipids Synthesis of complex lipids is not affected. Lack of lysosomal enzymes All tissueas are affected Multiple sulfatase defficiency

28 Sphingolipidoses Niemann-Pick Ceramid P-Kol sphingomyelinase Accumulation of sphingomyelin

29 Gaucher disease Spleen, liver, bone-marrow, reticuloendothelial cells Accumulation of glucocerebrozides Gaucher cells Mentális retardáció Gaucher Ceramid Glu b-glucosidase

30 Krabbe disease Accumulation of Galactosyl ceramide Krabbe Ceramid Gal b-galaktosidase

31 Lack of Hexosaminidase A N-acetyl-galactosamine is not cleaved from the GM2 gangliosids Paralysis, deafness, Mental retardation Macrocephalia Death at age 2-4 1:3500 Tay-Sachs desease

32 Tay-Sachs disease Tay - Sachs Ceramid Glu Gal GalNAc NANA hexoseaminidase

33 Sphingolipidoses Fabry Ceramid Glu Gal Gal a-galaktosidase

METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS. Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry

METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS. Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry STORAGE AND MEMBRANE LIPIDS STORAGE LIPIDS Mainly as triacylglycerols (triglycerides) in adipose cells Constitute

More information

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,

More information

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids. Martina Srbová Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 26 Done by حسام أبو عوض Corrected by Zaid Emad Doctor فيصل الخطيب 1 P a g e A small note about phosphatidyl inositol-4,5-bisphosphate (PIP2) before moving on: This molecule is found in the membrane

More information

Phospholipids Metabolism

Phospholipids Metabolism Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester

More information

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.

More information

II- Compound Lipids. 1- Phospholipids

II- Compound Lipids. 1- Phospholipids II- ompound Lipids ompound (conjugated) lipids are lipids conjugated with other substances. They include: 1- Phospholipids formed of lipid, phosphoric acid and nitrogenous base. 2- Glycolipids, formed

More information

I. Structure and Properties of Lipids

I. Structure and Properties of Lipids I. Structure and Properties of Lipids Lipids: A diverse group of compounds characterized by their low solubility in water and a high solubility in organic solvents such as chloroform and methanol. Nonpolar

More information

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure

More information

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids

More information

Biochemistry sheet #19. Biosynthesis of Triacylglycerol and Phosphoacylglycerol

Biochemistry sheet #19. Biosynthesis of Triacylglycerol and Phosphoacylglycerol Biochemistry sheet #19 Biosynthesis of Triacylglycerol and Phosphoacylglycerol Slide 1 This slide shows the components of triacylglycerol (TAG) and phosphoacylglycerol. TAG (Glycerol) Esterified to 3(

More information

Abdallah Q& Razi. Faisal

Abdallah Q& Razi. Faisal 27 & Ahmad Attari م ح م د ي وس ف Abdallah Q& Razi Faisal Sphingophospolipids - The backbone of sphingophospholipids is sphingosine, unlike glycerophospholipids with a glycerol as the backbone. Which contains

More information

Membrane Lipids & Cholesterol Metabolism

Membrane Lipids & Cholesterol Metabolism Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Optimising. membranes

Optimising. membranes Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation

More information

Chapter 16 - Lipid Metabolism

Chapter 16 - Lipid Metabolism Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them

More information

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter

More information

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2. BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal

More information

LIPIDS TAG, PL and SL metabolism. Marek Vecka

LIPIDS TAG, PL and SL metabolism. Marek Vecka LIPIDS TAG, PL and SL metabolism Marek Vecka BIOSYNTHESIS OF TAG TWO BIOSYNTHETIC PATHWAYS IN MAMMALS liver, adipose tissue - use mainly phosphatidate pathway ( Kennedy pathway ) intestine - monoacylglycerol

More information

Leen Alsahele. Razan Al-zoubi ... Faisal

Leen Alsahele. Razan Al-zoubi ... Faisal 25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase

More information

Molecular Organization of the Cell Membrane

Molecular Organization of the Cell Membrane Molecular Organization of the Cell Membrane A walk from molecules to a functional biostructure Cell Membrane Definition An ultrastructure separating connecting the cell to the environment 1 Coarse chemical

More information

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis

More information

Question (1) ) Put the sign ( ) against the right sentences and the sign (X) against the wrong sentences:(10 Marks)

Question (1) ) Put the sign ( ) against the right sentences and the sign (X) against the wrong sentences:(10 Marks) Course No: PHARM 2315 Course Title:Biochemistry Date: 01/06/ 2017 No. of Questions: (5) Time: TWO hours Using Calculator (Yes) University of Palestine Final Exam Second Semester 2016/2017 Total Grade:

More information

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

More information

Dr. Nafith Abu Tarboush

Dr. Nafith Abu Tarboush 6 Dr. Nafith Abu Tarboush June 26 th 2013 Noor Salem 1 Not corrected Review Lipids are composed of two main connected parts : o Alcohol Sphingosine Glycerol o Fatty Acids (3 in number) Saturated Long Chain

More information

LIPIDS Introduction - complex lipids. Marek Vecka

LIPIDS Introduction - complex lipids. Marek Vecka LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other

More information

The role of the laboratory in diagnosing lysosomal disorders

The role of the laboratory in diagnosing lysosomal disorders The role of the laboratory in diagnosing lysosomal disorders Dr Guy Besley, formerly Willink Biochemical Genetics Unit, Manchester Children s Hospital, Manchester M27 4HA, UK. Lysosomal disorders What

More information

FAD FADH2. glycerol-3- phosphate. dehydrogenase. This DHAP is metabolically no different from that produced in glycolysis.

FAD FADH2. glycerol-3- phosphate. dehydrogenase. This DHAP is metabolically no different from that produced in glycolysis. 1 Lipid Metabolism: ow that we are aware of the types of lipids in our bodies, it is important to see how we make them or break them. We will start our discussion with triacylglyceride degradation, and

More information

2 Tissue Lipid Metabolism: b-oxidation of Fatty Acids. Lecturer Alexander N. Koval

2 Tissue Lipid Metabolism: b-oxidation of Fatty Acids. Lecturer Alexander N. Koval 2 Tissue Lipid Metabolism: b-oxidation of Fatty Acids Lecturer Alexander N. Koval The structure of the lecture course 12/1/2016 Koval A. (C), 2016 2 Biochemistry of Lipids-2 1. b-oxidation of fatty acids

More information

Biosynthesis of Fatty Acids

Biosynthesis of Fatty Acids Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty

More information

Contents 1 Metabolism and Roles of Eicosanoids in Brain

Contents 1 Metabolism and Roles of Eicosanoids in Brain Contents 1 Metabolism and Roles of Eicosanoids in Brain... 1 1.1 Introduction... 1 1.2 Multiplicity of Cyclooxygenases, Lipoxygenases, and Epoxygenases in the Brain... 4 1.2.1 Cyclooxygenases (COXs)...

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant

1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant 1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant Lipid: Definition Biological molecules that are insoluble in aqueous solutions and

More information

Phospholipids and their metabolism

Phospholipids and their metabolism Phospholipids and their metabolism D. GOMPERTZ J. clin. Path., 26, suppl. (Ass. Clin. Path.), 5, -16 From the Departments of Medicine and Chemical Pathology, Royal Postgraduate Medical School, London Phospholipids

More information

Some common classifications of lipids and their general biologic functions Primary Functions Energy sources, biosynthetic precursors

Some common classifications of lipids and their general biologic functions Primary Functions Energy sources, biosynthetic precursors NATURE F LIPIDS. Lipids have a hydrophobic nature because of the predominance of hydrocarbon chains ( H 2 H 2 H 2 ) in their structure. They are insoluble or only poorly soluble in water, but readily soluble

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

LIPIDS II: TRIACYLGLYCEROLS:

LIPIDS II: TRIACYLGLYCEROLS: LIPIDS II: TRIACYLGLYCEROLS: How are they broken down? o Hydrolyzed into 3 fatty acids and 1 glycerol o Physiologically in body: Enzyme called a LIPASE present in adipocytes and intestines o Saponification

More information

Phospholipid Synthesis and Transport in Mammalian Cells

Phospholipid Synthesis and Transport in Mammalian Cells 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd doi:10.1111/tra.12230 Review Phospholipid Synthesis and Transport in Mammalian Cells Jean E. Vance Department of Medicine and Group on Molecular

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Classification, functions and structure

Classification, functions and structure Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids

More information

FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS

FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS Dicarboxylic acids, ketone bodies. Department of General Chemistry Structure and classification of lipids Lipids can be divided into five categories, on the

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids King Saud University College of Science Department of Biochemistry General Biochemistry-II (BCH 302) Chapter 4 Lipids Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya http://faculty.ksu.edu.sa/75112

More information

THROMBOSIS PRODUCT HIGHLIGHTS

THROMBOSIS PRODUCT HIGHLIGHTS PRODUCT HIGHLIGHTS AESKU.DIAGNOSTICS has extensive experience and know-how in the Anti-Phospholipid Syndrome (APS) field and offers the most comprehensive panel of anti-phospholipid tests, employing highly

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Lipids and Membranes I. overview Lipids are related

More information

IT IS NOW well established that after injection of radioactive. and inner mitochondrial membranes

IT IS NOW well established that after injection of radioactive. and inner mitochondrial membranes Study of the transfer of phospholipids from the endoplasmic reticulum to the outer and inner mitochondrial membranes MARIE-THERESE SAUNER and MARIANNE LEVY Laboratoire de Physiologie de la Nutrition, Facult6

More information

BIOC 462b Dr. Tischler SYNTHESIS OF FATTY ACIDS, TRIACYLGLYCEROL, PHOSPHOLIPIDS

BIOC 462b Dr. Tischler SYNTHESIS OF FATTY ACIDS, TRIACYLGLYCEROL, PHOSPHOLIPIDS BIO 462b Dr. Tischler YNTHI OF FTTY ID, TRIYLGLYROL, HOHOLIID Text: pages 343-351; 805-817; 820-831 ample roblems: see xam 4 sample problems on exam page of course web site Recommended roblems to olve:

More information

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides

More information

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun 10 Ahmad O. Olimat Abdallah Al-Qawasmeh Mohammed Yousef Dr.Mamoun A QUICK RECAP Eicosanoids They are derived from Arachidonic acid, a fatty acid that contains 20 carbon atoms and four double bonds. They

More information

Biochemistry of Lipids, Lipoproteins and Membranes

Biochemistry of Lipids, Lipoproteins and Membranes Biochemistry of Lipids, Lipoproteins and Membranes Editors DENNIS E. VANCE and JEAN E. VANCE Lipid and Lipoprotein Research Group, Faculty of Medicine, 328 Heritage Medical Research Centre, Edmonton, Aha.,

More information

Biological role of lipids

Biological role of lipids Lipids Lipids Organic compounds present in living organisms, insoluble in water but able to be extracted by organic solvents such as: chloroform, acetone, benzene. Extraction = the action of taking out

More information

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

More information

Learning Guide. Molecules to Cells Week Two

Learning Guide. Molecules to Cells Week Two Learning Guide Molecules to Cells Week Two 1 Learning Session Learning Resource Learning Objective Assessment ILA 2 ph, Amino Acids, and Peptides TBL 2 Molecular Tools of Genetic Diagnosis Lecture 13 Introduction

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 25 Done by موسى صبح Corrected by عبد الرحمن الحنبلي Doctor فيصل الخطيب 1 P a g e Introduction The subject of this lecture is glycerophospholipids also known as phosphoglyceridesor phosphoacylglycerols,

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10 1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural

More information

2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below.

2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below. Paper 4: Biomolecules and their interactions Module 21: Classification of Lipids: simple and compound lipids, phospholipids, Cholesterol OBJECTIVE The main aim of this module is to introduce the students

More information

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

More information

Mol Bio Biochem 694:407 &115: 511 Second Hourly, Deis

Mol Bio Biochem 694:407 &115: 511 Second Hourly, Deis Mol Bio Biochem 694:407 &115: 511 Second Hourly, Deis Tuesday, Oct. 31, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth

More information

Chapter 11: Lipids. Voet & Voet: Pages

Chapter 11: Lipids. Voet & Voet: Pages Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,

More information

Fatty Acids Synthesis L3

Fatty Acids Synthesis L3 Fatty Acids Synthesis L3 The pathway for fatty acid synthesis occurs in the cytoplasm, whereas, oxidation occurs in the mitochondria. The other major difference is the use of nucleotide co-factors. Oxidation

More information

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility

More information

Lecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in

Lecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in Lecture 3 Lipids: Chapter 20 Sections 4-7! The most polar lipids are found in the membranes of cells and organelles! Why?! These lipids are amphipathic! Membranes are complex and have many components Membrane

More information

Lipids and Biological Membranes

Lipids and Biological Membranes Lipids and Biological Membranes Lipids: Found in all living organisms Especially important as components of biological membranes Defined functionally, not structurally, as compounds that are totally or

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Microreview. A.-F. Miller, 2008, pg

Microreview. A.-F. Miller, 2008, pg Microreview Polysaccharides: a vast diversity based on stereochemistry. Stereochemical differences are associated with secondary and tertiary structural differences: nature s huge and plentiful polymers.

More information

Phospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes

Phospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes Progress in Lipid Research 38 (1999) 361±399 www.elsevier.com/locate/plipres Phospholipid biosynthesis in the yeast Saccharomyces cerevisiae and interrelationship with other metabolic processes George

More information

Biomolecules: lipids

Biomolecules: lipids Biomolecules: lipids Organic biomolecules: lipids Organic amphiphilic compounds insoluble in water Easily extracted from animal and vegetal cells using apolar solvents Fundamental to build cell's shape

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile

More information

Lipids. Chapter 11: Outline. Fatty Acids. Lipid Classes. Fatty Acids-2. Fatty Acids-3. General Types eg. A fatty acid

Lipids. Chapter 11: Outline. Fatty Acids. Lipid Classes. Fatty Acids-2. Fatty Acids-3. General Types eg. A fatty acid Chapter 11: utline Lipid Classes Fatty Acids and Derivatives Triacylglycerols Phospholipids Isoprenoids Membranes Membrane Structure Membrane Function Wax Esters Sphingolipids Lipoproteins Lipids General

More information

Dr MS Islam Sr. Lecturer of Biochemistry School of Life Sciences, Westville Campus

Dr MS Islam Sr. Lecturer of Biochemistry School of Life Sciences, Westville Campus Dr MS Islam Sr. Lecturer of Biochemistry School of Life Sciences, Westville Campus Lipids play roles both in energy metabolism and in aspects of biological structure and functions The great bulk of lipid

More information

Summary of fatty acid synthesis

Summary of fatty acid synthesis Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty

More information

Biochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib

Biochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib Page1 بسم رلاهللا On Thursday, we discussed the synthesis of fatty acids and its regulation. We also went on to talk about the synthesis of Triacylglycerol (TAG). Last time, we started talking about the

More information

MILK BIOSYNTHESIS PART 3: FAT

MILK BIOSYNTHESIS PART 3: FAT MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl

More information

Department of Biochemistry, Duke University Medical Center, Durham, NC (2, 6). During these selective transport processes

Department of Biochemistry, Duke University Medical Center, Durham, NC (2, 6). During these selective transport processes Lipid topogenesis R. M. Bell, L. M. Ballas, and R. A. Coleman Department of Biochemistry, Duke University Medical Center, Durham, NC 27710 Abstract Investigations of the topography of glycerolipid sorted

More information

Voet Biochemistry 3e John Wiley & Sons, Inc.

Voet Biochemistry 3e John Wiley & Sons, Inc. * * Voet Biochemistry 3e Lipid Metabolism Part I: (Chap. 25, sec.1-3) Glucose C 6 H 12 O 6 + 6 O 2 6 CO 2 + 6 H 2 O G o = -2823 kj/mol Fats (palmitic acid) C 16 H 32 O 2 + 23 O 2 16 CO 2 + 16 H 2 O G o

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty

More information

Objectives By the end of lecture the student should:

Objectives By the end of lecture the student should: Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

CARBOHYDRATE METABOLISM 1

CARBOHYDRATE METABOLISM 1 CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids

Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 20 Done by Corrected by Rana Ghassan Doctor Only 4 questions in the mid-term exam are based on the 4 lectures to be given by Dr Faisal. Dr Faisal will give us 10 lectures, the first 4 are included

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

Thin layer absorption chromatography can achieve very good separation of small lipid samples

Thin layer absorption chromatography can achieve very good separation of small lipid samples Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from

More information

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc. BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In

More information

GUTS Lecture Syllabus for Lipid Structure and Nomenclature

GUTS Lecture Syllabus for Lipid Structure and Nomenclature GUTS Lecture Syllabus for Lipid Structure and Nomenclature For Questions or Assistance contact: Dr. Gwen Sancar, gsancar@ad.unc.edu Learning bjectives After completing the GUTS lecture and associated self-

More information

Dr. Mamoun. Loai Azar

Dr. Mamoun. Loai Azar 13 Dr. Mamoun Loai Azar Lipids (2) - To get the best of this sheet PLEASE study it side by side with the doctor s slides. - In this lecture the doctor continued talking about Eicosanoids. Derived Fatty

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Propagation of the Signal

Propagation of the Signal OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information