ib Blackwell Publishing
|
|
- Curtis Rodgers
- 5 years ago
- Views:
Transcription
1 Plant Lipids Biology, Utilisation and Manipulation Edited by DENIS J. MURPHY Biotechnology Unit School of Applied Sciences University of Glamorgan Cardiff, UK ib Blackwell Publishing CRC Press
2 Contents Contributors Preface xiii xv 1 The study and utilisation of plant lipids: from margarine to lipid rafts 1 DENIS J. MURPHY 1.1 Introduction Early studies of plant lipids The chemistry era - and the definition of the term 'lipid' The biochemistry era The molecular genetics revolution New frontiers - cell biology and the 'omics Conclusions and future prospects 22 2 Fatty acid biosynthesis 27 JOHN L. HARWOOD 2.1 Introduction Carbon supply for fatty acid formation Acetyl-CoA carboxylase Structure of ACCase Properties of different isoforms of ACCase Herbicides acting on ACCase Genes coding for ACCase Regulation of ACCase Fatty acid synthase Acyl carrier protein Condensing enzymes The other component enzymes of FAS Termination of FAS Mitochondrial FAS Regulation of fatty acid formation Biotechnological aspects 56
3 vi CONTENTS 3 Fatty acid manipulation 67 DAVID F. HILDEBRAND, KESHUN YU, CHARLES MCCRACKEN and SURYADEVARA S. RAO 3.1 Introduction The soluble A9 desaturases Engineering chain length specificity of soluble A9 desaturases Stearoyl-CoA desaturases Front-end desaturases A12 Desaturase-like enzymes and their use in the modification of fatty acid residues Structures and functions Substrates and products Gene isolation, characterization and testing Rational gene design Segregation of novel fatty acids from membrane lipids Compartmentation of storage and membrane lipid synthesis Selective accumulation of novel fatty acids in oil bodies Medium-chain fatty acids Very-long-chain fatty acids Novel monoenoic fatty acids Novel fatty acids produced by diverged Fad2 enzymes Gene specific promoters for tissue specific novel fatty acid accumulation Structures and occurrences of hydroxy, conjugated and epoxy fatty acids in plant seed oils Hydroxy fatty acids Conjugated fatty acids Epoxy fatty acids 90 4 Non-food lipids 103 SEVIM Z. ERHAN and ATANU ADHVARYU 4.1 Introduction Structure and composition of lipids Simple lipids Triacylglycerols Industrial applications Industrial commodity seed oils Soybean oil Canolaoil 112
4 CONTENTS vii Sunflower oil Saffloweroil Linseed oil Tung oil New industrial oilseed crops Meadowfoam oil Lesquerella oil Cupheaoil Crambeoil Jojoba wax Use of tallow and yellow grease for industrial applications Structural modifications Interesterification Fractionation Solvent fractionation Column chromatography Thin-layer chromatography Hydrogenation Concluding remarks Membrane lipids 123 PETER DORMANN 5.1 Introduction Structures and localisation of glycerolipids Phosphatidic acid Galactolipids Sulfolipid Phosphatidylglycerol and diphosphatidylglycerol Phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine and N-acyl-phosphatidylethanolamine Phosphatidylinositol Biosynthesis of membrane glycerolipids Biosynthesis of phosphatidic acid Synthesis of glycerolipids from diacylglycerol or CDP-diacylglycerol Biosynthesis of galactolipids Biosynthesis of sulfolipid Biosynthesis of PG and DPG Biosynthesis of PS, PC, PE and NAPE Biosynthesis of PI 139
5 viii CONTENTS 5.4 Membrane lipid turnover Hydrolysis of phospholipid head groups: phospholipases C and D ' Phospholipase C Phospholipase D Hydrolysis of acyl groups from membrane lipids Phospholipase A Phospholipase A Lysophospholipase Patatin-like acyl hydrolases with phospholipase and glycolipase activities DADl-like acylhydrolases SAGlOl-like acyl hydrolases and PDAT-like acyltransferases Glycolipases Fatty acyl turnover and acyl-coa synthetases Physiological roles of membrane lipids Growth at high and low temperatures Unsaturated fatty acids The role of unsaturated molecular species of PG in chilling sensitivity Increase of PC synthesis during cold treatment The role of thylakoid lipids in photosynthesis Growth during phosphate deprivation Summary and future perspectives Storage lipids 162 RANDALL J. WESELAKE 6.1 Introduction Pathways leading to triacylglycerols Properties and regulation of enzymes involved in triacylglycerol biosynthesis and associated phospholipid metabolism sm-glycerol-3-phosphate acyltransferase Lysophosphatidic acid acyltransferase Phosphatidic acid phosphatase Diacylglycerol acyltransferase Enzymes catalyzing acyl-coa-independent synthesis of triacylglycerol CDP-choline:-l,2-diacylglycerol cholinephosphotransferase Lysophosphatidylcholine acyltransferase 181
6 CONTENTS ix Phospholipases Soluble lysophosphatidic acid phosphatase and monoacylglycerol acyltransferase in developing peanut Complex metabolic processes can affect the fatty acid composition of triacylglycerol Structure, composition and biogenesis of lipid bodies Mobilization of storage lipids Degradation of triacylglycerols into fatty acids /S-Oxidation of fatty acids and conversion of lipid to carbohydrate /{-Oxidation during seed maturation Storage lipids in developing pollen grains Effect of environmental conditions and carbon source on triacylglycerol accumulation The role of lipid-protein particles and plasma membrane vesicles in membrane turnover Biosynthesis of liquid wax esters Do plants transport storage lipids? Conclusions and future directions Lipid-associated proteins 226 DENIS J. MURPHY 7.1 Introduction Plant lipid-associated proteins Oleosins Oleo-pollenins ('oleosin-like proteins') Caleosins Plastid lipid-associated proteins Minor lipid-associated proteins in plants Lipid-associated proteins in non-storage tissues in plants Phloem ' Roots and meristems Rubber Comparisons with non-plant systems Animals The PAT family of cytosolic lipid-body proteins Caveolins - the unexpected lipid-associated proteins Extracellular lipid-body proteins Microorganisms Fungi Prokaryotes Viruses Conclusions 258
7 CONTENTS The plant cuticle: formation and structure of epidermal surfaces 270 LJERKA KUNST, A.L. SAMUELS and REINHARD JETTER 8.1 Introduction Biosynthesis of cuticle components De novo fatty acid synthesis Cutin biosynthesis Synthesis of very-long-chain fatty acid wax precursors Synthesis of aliphatic cuticular wax components The acyl reduction pathway The decarbonylation pathway The /S-diketone pathway Cuticle biosynthesis in the context of the epidermal cell Saturated long-chain fatty acids are exported from the plastid to the ER for elongation VLCFA modification and delivery of wax constituents to the plasma membrane Export of wax components from the epidermal cell to the cuticle Cuticle composition and structure Formation and composition of epicuticular crystals Physical and chemical distinction between epicuticular film and intracuticular wax Crystalline arrangement of epi- and intracuticular wax molecules Conclusions 294 Inositol-containing lipids: roles in cellular signalling 303 BJ0RN K. DR0BAK 9.1 Introduction Phosphoinositides: synthesis, turnover and function Biosynthesis of phosphatidylinositol Phosphorylation of phosphatidylinositol and other phosphoinositides Phosphatidylinositol 3-kinases Phosphatidylinositol 4-kinases Phosphatidylinositol 5-kinases Phosphatidylinositol 3-monophosphate 5-kinases Phosphatidylinositol 4-monophosphate 5-kinases Phosphoinositide-protein interactions Profilin ADF/cofilin PARF and other FYVE-finger domain proteins Proteins containing PH-domains 319
8 CONTENTS xi Proteins containing PX-domains Proteins containing ENTH-, VHS-and FERM-domains Conclusions Oxylipins 329 SABINE ROSAHL AND IVO FEUSSNER 10.1 Introduction: synthesis of oxylipins LOX pathway The CYP74 family Jasmonic acid biosynthesis enzymes Oxylipins as signal molecules Jasmonic acid in wound signalling Systemic wound signalling The role of jasmonic acid in insect resistance Oxylipins and pathogen defence Jasmonic acid signal transduction mutants and their effects on the pathogen responses Cross-talk between salicylic acid and lipid signalling in pathogen defence responses LOX products - antimicrobial compounds and their impact on lipid peroxidation processes Conclusions and future prospects Prenyllipids and their derivatives: sterols, prenylquinones, carotenoids and terpenoids 355 PIERRE BENVENISTE 11.1 Introduction General considerations Prenylquinones Properties of prenylquinones Tocopherols and tocotrienols Plastoquinone Biosynthesis of prenylquinones Biosynthesis of tocopherol and plastoquinone Biosynthesis of tocotrienolquinones Carotenoids Biosynthesis of carotenoids Metabolic engineering of carotenoid biosynthesis Catabolism of carotenoids Sterols ,3(S)-oxidosqualene-cycloartenol cyclase (OSC) S-Adenosylmethionine-sterol-C-methyltransferases (SMTs) 368
9 Xll CONTENTS ,4-dimethyl sterol and 4a-methyl sterol 4-demethylation (SMOs) Cyclopropyl sterol isomerase (CPI) ' Obtusifoliol-14a-demethylase(OBT14DM) A sterol-a 14 -reductase(14red) A 8 -A 7 -sterol isomerase (8ISO) A 7 -sterol-c5(6)-desaturase(5des) A 57 -sterol A 7 -reductase (7RED) A 5 -sterol A 24 -reductase (isomerase) (DIM) Sterol-A 22 -desaturase Terpenoids, mono-, sesqui- and diterpenes Biosynthesis of Taxol (paclitaxel) Cyclisation of geranylgeranyl diphosphate Hydroxylations Acetylations, benzoylations phenylalanoylation Conclusions 379 List of Abbreviations 388 Index 394
Plant Lipids Suni Allsebastian: Deni: fm 2004/10/14 06:33 page i #1
Plant Lipids Biological Sciences Series A series which provides an accessible source of information at research and professional level in chosen sectors of the biological sciences. Series Editor: Professor
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationThin layer absorption chromatography can achieve very good separation of small lipid samples
Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from
More informationWhy discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis
Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels Dehesh UC Davis Fossil fuel is believed to be derived from ancient lipid rich organic material such as spores and planktonic algae! Rudolf
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationLipids are broadly classified in to simple, complex and derived, which are further subdivided into different groups.
Paper No. 01 Paper Title: Food Chemistry Module -9: Classification of lipids Lipids are organic substances which are insoluble in water and soluble in organic solvents. Lipids are not polymers and exist
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationChapter 11: Lipids. Voet & Voet: Pages
Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationMPS Advanced Plant Biochemistry Course. Fall Semester Lecture 11. Lipids III
MPS 587 - Advanced Plant Biochemistry Course Fall Semester 2011 Lecture 11 Lipids III 9. Triacylglycerol synthesis 10. Engineering triacylglycerol fatty acid composition Today s topics on the Arabidopsis
More informationLipids and Fatty Acids
Lipids and Fatty Acids Objectives: 1. What are Lipids? properties glycerolipids vs. isoprenoids glycerolipid structure glycerolipid nomenclature 2. Fatty acid biosynthesis ellular localization Substrate
More informationMCQS ON LIPIDS. Dr. RUCHIKA YADU
MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL
More informationProduction and trade of vegetable oils p. 1 Extraction, refining and processing p. 1 Vegetable oils--production, disappearance and trade p.
Production and trade of vegetable oils p. 1 Extraction, refining and processing p. 1 Vegetable oils--production, disappearance and trade p. 3 Soybean oil p. 7 Palm oil p. 8 Rapeseed/canola oil p. 8 Sunflowerseed
More informationLipids and Classification:
Lipids and Classification: Lipids: Biological lipids are a chemically diverse group of organic compounds which are insoluble or only poorly soluble in water. They are readily soluble in non-polar solvents
More informationANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
More informationPHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationFatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
More informationLecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation
Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies
More informationGas Chromatography/ Mass Spectrometry
Gas Chromatography/ Mass Spectrometry Edited by H.F. Linskens and J.F. Jackson Contributors R.S. Bandurski G. Combaut A.Ehmann P.Hedden B.Janistyn H.Kameoka H.Kodama D.V.Lynch J.K.MacLeod H.Nyberg L.M.S.Palni
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationLipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures
Lipid Analysis Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th 2005 Introduction to lipid structures Fatty acids Acylglycerols Glycerophospholipids Sterols Strategies involved in lipid
More informationLipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND. Bridgwater, England LIPIDOMIC ANALYSIS. Fourth Edition. Invergowrie, Dundee, Scotland
Lipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND LIPIDOMIC ANALYSIS Fourth Edition WILLIAM W.CHRISTIE MRS Lipid Analysis Unit, Scottish Crop Research Institute, Dundee, Scotland Invergowrie, and
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationTest Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationBY: RASAQ NURUDEEN OLAJIDE
BY: RASAQ NURUDEEN OLAJIDE LECTURE CONTENT INTRODUCTION CLASSIFICATION OF LIPIDS PROPERTIES OF LIPIDS REACTIONS OF LIPIDS (CHEMICAL PROPERTIES) SOME QUANTITATIVE TESTS FOR LIPIDS CHEMISTRY AND PROPERTIES
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationMolecular Organization of the Cell Membrane
Molecular Organization of the Cell Membrane A walk from molecules to a functional biostructure Cell Membrane Definition An ultrastructure separating connecting the cell to the environment 1 Coarse chemical
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationPlant Biochemistry 31S2-33. ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto. P.M. Dey. J.B. Harborne. edited by.
31S2-33 Plant Biochemistry edited by P.M. Dey Division of Biochemistry, School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20 OEX, UK. and J.B. Harborne Department
More informationLeen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
More informationSynthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
More informationMPS Advanced Plant Biochemistry Course
MPS 587 - Advanced Plant Biochemistry Course Lipids section guest lecture: Philip Bates Post-doc Browse lab Office: 453 Clark Hall Email: phil_bates@wsu.edu Lecture 9 Lipids I 1. What is a lipid? 2. Fatty
More informationBiochemistry sheet #19. Biosynthesis of Triacylglycerol and Phosphoacylglycerol
Biochemistry sheet #19 Biosynthesis of Triacylglycerol and Phosphoacylglycerol Slide 1 This slide shows the components of triacylglycerol (TAG) and phosphoacylglycerol. TAG (Glycerol) Esterified to 3(
More informationBiosynthesis and functions of free and combined fatty alcohols associated with suberin
Laboratoire Biosynthesis and functions of free and combined fatty alcohols associated with suberin Collaborating Laboratories: Dr. Owen Rowland Sollapura Vishwanath PhD Candidate Department of Biology
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationAnabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides
Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides
More informationBCMB 3100 Fall 2013 Exam III
BCMB 3100 Fall 2013 Exam III 1. (10 pts.) (a.) Briefly describe the purpose of the glycerol dehydrogenase phosphate shuttle. (b.) How many ATPs can be made when electrons enter the electron transport chain
More informationMEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 MEMBRANE STRUCTURE Lecture 8 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University Plasma Membrane 2 Plasma membrane: The outer boundary of the cell that separates it from the world
More informationGlycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
Zheng et al. BMC Plant Biology (2016) 16:70 DOI 10.1186/s12870-016-0758-8 RESEARCH ARTICLE Open Access Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
More informationOptimising. membranes
Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins
More information6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced?
Lipid Metabolism Learning bjectives 1 How Are Lipids Involved in the Generationand Storage of Energy? 2 How Are Lipids Catabolized? 3 What Is the Energy Yield from the xidation of Fatty Acids? 4 How Are
More informationMass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
More informationPlant Biochemistry Lecture 08: PLANT LIPID
http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ Password: Plant Biochemistry Lecture 08: PLANT LIPID Lipids are molecules that contain hydrocarbons and make up the building
More informationBiochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib
Page1 بسم رلاهللا On Thursday, we discussed the synthesis of fatty acids and its regulation. We also went on to talk about the synthesis of Triacylglycerol (TAG). Last time, we started talking about the
More informationLIPIDS Introduction - complex lipids. Marek Vecka
LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other
More informationIntroduction to Lipid Chemistry
Introduction to Lipid Chemistry Benjamin Schwartz Ontario SCC Education Day September 18, 2018 Lipid knowledge for the personal care industry What is a Lipid? Lipids are fatty acids and their derivatives,
More informationCellular Biochemistry
Cellular Biochemistry Fall Semester 2013 Sept. 23 Benoit Kornmann Institute of Biochemistry Introduction to biological membranes General functions and properties Membrane lipids Physical properties Distribution/asymmetry
More informationLecture: 26 OXIDATION OF FATTY ACIDS
Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationBRIEF CONTENTS COPYRIGHTED MATERIAL III METABOLIC AND DEVELOPMENTAL INTEGRATION COMPARTMENTS CELL REPRODUCTION PLANT ENVIRONMENT AND AGRICULTURE
BRIEF CONTENTS I COMPARTMENTS 1 Membrane Structure and Membranous Organelles 2 2 The Cell Wall 45 3 Membrane Transport 111 4 Protein Sorting and Vesicle Traffic 151 5 The Cytoskeleton 191 II CELL REPRODUCTION
More informationLipids in Photosynthesis
Lipids in Photosynthesis Essential and Regulatory Functions Edited by Hajime Wada Department of Life Sciences Graduate School of Arts and Science University of Tokyo Japan and Norio Murata National Institute
More informationFATS & OILS GLOSSARY
FATS & OILS GLOSSARY Antioxidant A substance that slows or interferes with the reaction of a fat or oil with oxygen. The addition of antioxidants to fats or foods containing them retard rancidity and increases
More informationBiosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids
Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent
More informationSynthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
More informationTEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
More informationLipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10
1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationFAD FADH2. glycerol-3- phosphate. dehydrogenase. This DHAP is metabolically no different from that produced in glycolysis.
1 Lipid Metabolism: ow that we are aware of the types of lipids in our bodies, it is important to see how we make them or break them. We will start our discussion with triacylglyceride degradation, and
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationDr. Nafith Abu Tarboush
4 Dr. Nafith Abu Tarboush June 24 th 2013 Ahmad Moayd 1 Definition and general properties refer to slide no. 2 Lipids: macromolecules made from Alcohol and Fatty acid bonded by ester linkage. Amphipathic
More information2-more complex molecules (fatty acyl esters) as triacylglycerols.
** Fatty acids exist in two forms:- 1-free fatty acids (unesterified) 2-more complex molecules (fatty acyl esters) as triacylglycerols. ** most tissues might use fatty acids as source of energy during
More informationKing Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids
King Saud University College of Science Department of Biochemistry General Biochemistry-II (BCH 302) Chapter 4 Lipids Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya http://faculty.ksu.edu.sa/75112
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationOBJECTIVE. Lipids are largely hydrocarbon derivatives and thus represent
Paper 4. Biomolecules and their interactions Module 20: Saturated and unsaturated fatty acids, Nomenclature of fatty acids and Essential and non-essential fatty acids OBJECTIVE The main aim of this module
More informationEnhanced microbial lipid production with genetically modified yeast and fungus
Enhanced microbial lipid production with genetically modified yeast and fungus Pacific Rim Summit on Industrial Biotechnology and Bioenergy 2014 Kari Koivuranta, Marilyn Wiebe, Laura Ruohonen and Merja
More informationBiology 638 Biochemistry II Exam-3. (Note that you are not allowed to use any calculator)
Biology 638 Biochemistry II Exam-3 (Note that you are not allowed to use any calculator) 1. In the non-cyclic pathway, electron pathway is. Select the most accurate one. a. PSII PC Cyt b 6 f PC PSI Fd-NADP
More information2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below.
Paper 4: Biomolecules and their interactions Module 21: Classification of Lipids: simple and compound lipids, phospholipids, Cholesterol OBJECTIVE The main aim of this module is to introduce the students
More informationDisruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth
The Plant Cell, Vol. 15, 1020 1033, April 2003, www.plantcell.org 2003 American Society of Plant Biologists Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty
More informationLIPIDS TAG, PL and SL metabolism. Marek Vecka
LIPIDS TAG, PL and SL metabolism Marek Vecka BIOSYNTHESIS OF TAG TWO BIOSYNTHETIC PATHWAYS IN MAMMALS liver, adipose tissue - use mainly phosphatidate pathway ( Kennedy pathway ) intestine - monoacylglycerol
More informationCELLULAR METABOLISM. Metabolic pathways can be linear, branched, cyclic or spiral
CHM333 LECTURE 24 & 25: 3/27 29/13 SPRING 2013 Professor Christine Hrycyna CELLULAR METABOLISM What is metabolism? - How cells acquire, transform, store and use energy - Study reactions in a cell and how
More informationChapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.
BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal
More information3.1.3 Lipids. Source: AQA Spec
alevelbiology.co.uk SPECIFICATION Triglycerides and phospholipids are two groups of lipid. Triglycerides are formed by the condensation of one molecule of glycerol and three molecules of fatty acid. A
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationSyllabus for BASIC METABOLIC PRINCIPLES
Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the
More informationFatty Acid Desaturation
Fatty Acid Desaturation Objectives: 1. Isolation of desaturase mutants 2. Substrates for fatty acid desaturation 3. ellular localization of desaturases References: Buchanan et al. 2000. Biochemistry and
More informationGeneral Biochemistry-1 BCH 202
General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:
More informationnumber Done by Corrected by Doctor Faisal Al- Khateeb
number 21 Done by Omar Sami Corrected by حسام أبو عوض Doctor Faisal Al- Khateeb 1 P a g e (Only one or two marks are allocated for this sheetin the exam). Through this lecture we are going to cover the
More informationSEEDS. Physiology of Development and Germination. J. Derek Bewley
SEEDS Physiology of Development and Germination J. Derek Bewley Plant Physiology Research Group Department of Biology University of Calgary Calgary, Alberta, Canada and Michael Black Department of Biology
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationA mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany
A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid Lewis Kurschner and Karen Thulasi Masters in Botany Fatty acid nomenclature Fatty acyl composition Chain length Degree of unsaturation and position
More informationComposition and Structure of Bovine Milk Lipids Introduction p. 1 Fatty Acids p. 3 Origins of the Fatty Acids p. 4 Saturated Fatty Acids p.
Composition and Structure of Bovine Milk Lipids Introduction p. 1 Fatty Acids p. 3 Origins of the Fatty Acids p. 4 Saturated Fatty Acids p. 5 Cis-unsaturated Fatty Acids p. 5 Trans-unsaturated Fatty Acids
More informationBIOCATALYTIC CONVERSION OF OTHER LIPIDS
Chapter 6 BIOCATALYTIC CONVERSION OF OTHER LIPIDS In Chapters 4 and 5, lipase-mediated conversion of acylglycerols were presented. The Chapter 6 deals with biocatalytic modification of phospholipids, sphingolipids,
More informationLipids are used to store and excess energy from extra carbohydrates in animals
Lipids Lipids are a major source of energy used by cells, however lipids are more difficult for your body to break down. They produce nearly twice the amount of energy than proteins or carbohydrates. Lipids
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More information