Effect of the Synaptic Scaffolding Protein Homer1a on Chronic Compression of Dorsal Root Ganglion

Transcription

1 Available online at Annals of Clinical & Laboratory Science, vol. 39, no. 1, Effect of the Synaptic Scaffolding Protein Homer1a on Chronic Compression of Dorsal Root Ganglion Zheng-Liang Ma, Wei Zhu, Wei Zhang, and Xiao-ping Gu Department of Anesthesiology, Drum Tower Hospital, Medical Department of Nanjing University, Nanjing, Jiangsu Province, China Abstract. Activity-dependent plasticity in the spinal dorsal horn may underlie the development of neuropathic pain following peripheral nerve injury. A product of an immediate early gene (IEG), the synaptic scaffolding protein Homer1a, has received increasing attention because it appears to play a critical role in synaptic plasticity. In this study, we explored the early expression of Homer1 gene in the spinal dorsal horn by using the neuropathic pain model of chronic compression of dorsal root ganglion (CCD). The levels of Homer1a mrna in the ipsilateral dorsal horn of CCD rats were markedly increased at 4 hr, remained elevated at 8 hr, and then returned to baseline values by 24 hr after CCD treatment. In contrast, there were no significant changes of Homer1a expression in the Sham-operated or Control groups. Significant thermal hyperalgesia appeared at 24 hr post-operation in the CCD rats, but not in the Shamoperated or Control groups. These data show that CCD induces a transient and rapid increase in Homer1a expression in the spinal dorsal horn. These data also suggest that the transient and rapid increase in Homer1a expression may play an important role in the thermal hyperalgesia elicited by neural injury. Keywords: spinal dorsal root ganglion compression, Homer1a, synaptic plasticity, neuropathic pain Introduction The Homer protein family is a major constituent of the postsynaptic density (PSD), and much Chronic compression of the L4 and L5 dorsal root evidence suggests an important role of Homer in ganglia (CCD) can result in neuropathic pain synaptic plasticity [8,9]. Recent studies have shown syndromes, including hyperalgesia, allodynia, and that plastic changes in the processing of nociceptive spontaneous pain. Several factors, such as MCP-1/ information in the spinal dorsal horn are involved CCR2 [1], activating transcription factor-3 [2], in the development of neuropathic pain following glial-derived neurotrophic factor (GDNF) protein peripheral nerve injury [10,11]. The data also [3], and nnos [4] have been implicated in the indicate that Homer proteins play roles in this pathogenesis of this process. Changes in the process [7,12]. expression of many genes [5], which underlie injuryelicited plasticity in the spinal dorsal horn, may (Homer1a) and long (Homer1b/c, Homer2, and Homer proteins are classified as short contribute to neuronal hyperexcitability and neuropathic pain. Homer1, recent identified, appears to discovered after induction of excitatory synaptic Homer3) isoforms. Homer1a was the first isoform play a critical role in the expression of synaptic activity in cerebellar granule neurons [13]. Similar plasticity in the spinal dorsal horn [6,7]. to other immediate early genes (IEGs), Homer1a responds rapidly to neuronal activity [14]. Unlike Address correspondence to Dr. Zheng-Liang Ma, Department most IEGs that encode transcription factors, the of Anesthesiology, Drum Tower Hospital, Medical Department of Nanjing University, Nanjing , Jiangsu unique regulation of Homer1a provides important Province, China; tel ; fax ; insights into glutamatergic synaptic plasticity [15]. mazhengliang1964@yahoo.com.cn. Recently, Homer1a has received increasing attention /09/ $ by the Association of Clinical Scientists, Inc.

2 72 Annals of Clinical & Laboratory Science, vol. 39, no. 1, 2009 because of its action on post-synaptic structure and function [12,16,17]. A striking functional feature of Homer1a is that it contains the N-terminal Ena/ VASP Homology 1 (EVH1) domain but lacks the coiled-coil domain that mediates multimerization, so it likely functions as a naturally occurring dominant-negative form of Homer [18]. In the present study, we used the wellestablished chronic compression of dorsal root ganglion (CCD) model of neuropathic pain [19] and focused on changes in the early expression of Homer1a during CCD treatment. We also studied the potential relationship between the expression of Homer1a and the behavioral hyperalgesia elicited by CCD treatment. Methods Animal preparation. This study was performed on adult, male Sprague-Dawley rats (n = 60, g at the start of each experiment). Rats were divided randomly into three groups as follows: Control group (n = 20), CCD group (n = 20), and Sham group (n=20). The rats were kept individually in pathogen-free conditions with a 12 hr light/dark cycle and were fed sterile food and water. All experiments were approved by the Animal Care and Use Committee of the university and were in accordance with the guidelines for the use of laboratory animals [20]. All efforts were made to minimize animal suffering and to reduce the number of animals used. Surgical procedures. In the Control group (n = 20), the surgical procedure was performed aseptically under pentobarbital anesthesia (30 mg/kg, ip). The estimated levels of Homer1a mrna in these animals served as reference baseline controls. In the CCD group (n = 20), the right L4 and L5 intervertebral foramens were exposed and a stainless steel sil (4 mm in length, 0.7 mm in diameter) was inserted to provide steady compression on the L4 and L5 dorsal root ganglia [19]. In the Sham group (n = 20), the right L4 and L5 intervertebral foramens were exposed without compression. In each group, there were 4 time points, selected as 48 hr before operation, and 4 hr, 8 hr, and 24 hr after operation, for behavioral testing and Homer1a analysis. Behavioral testing. Thermal hyperalgesia was assessed by the paw withdrawal thermal latency (PWTL) to radiant heat according to the protocol of Hargreaves et al [21]. Rats were placed in clear plastic cages on an elevated glass plate and allowed to acclimatize for 30 min before testing. A radiant thermal stimulator (BME410A, Institute of Biological Medicine, Academy of Medical Science, China) was focused onto the plantar surface of the hindpaw through the glass plate. The nociceptive endpoints in the radiant heat test were the characteristic lifting or licking of the hindpaw, and the time to the endpoint was considered the PWTL [22]. To avoid tissue damage, a cut-off time of 30 sec was used [23]. There were 5 trials per rat and 5-min intervals between trials. The mean PWTL was obtained from the last 3 stimuli. Real time PCR. All animals used for Homer1a analysis were anesthetized with pentobarbital sodium at 48 hr before operation and at 4 hr, 8 hr, and 24 hr after operation. The lumbar spinal cords of all animals were exposed by laminectomy at vertebral level L1 2 (spinal cord L4 5), excised, divided into dorsal and ventral halves, and the dorsal halves further subdivided into ipsilateral and contralateral quadrants. The quadrants were kept at -80 C until analysis. Homer1a expression in individual dorsal horn quadrants was determined by real time PCR based on TaqMan fluorescence methodology to quantify the full range of Homer1a mrna copy numbers. Briefly, total RNA was isolated from homogenized tissues using 1 ml of Trizol Reagent (Invitrogen, Carlsbad, CA). The total RNA (1 µg) was used for cdna synthesis. PCR primers and probes for Homer1a and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were designed with Primer Express 2.0 software (Applied Biosystems, Foster City, CA) (Table 1) and synthesized by Genecore (Shanghai, China). For amplification of Homer1a and GAPDH genes, real-time PCR was performed in triplicate for each sample in a 20 μl reaction mixture, which consisted of template DNA (2 µl), primers (900 nmol), probe (250 nmol), Mg 2+ (5 mmol), and HoTaq PCR Reaction Mix. PCR was performed in a Stratagene Mx3005P instrument using the following thermal cycles: one cycle of 10 min at 95 C, and 55 cycles of 5 sec at 95 C and 30 sec at 60 C. Amplification efficiency of each individual sample was calculated by version Table 1. Sequences of primers and probes used in this study. Gene and oligonucleotide Sequence PCR product size (bp) GAPDH 149 Upper primer 5 -CAAGTTCAACGGCACAGTCAA-3 Lower primer 5 -TGGTGAAGACGCCAGTAGACTC-3 Probe 5 -(FAM)FTCTTCCAGGAGCGAGATCCCGCTAACP(TAMRA)-3 Homer1a 123 Upper primer 5 -CCAGAAAGTATCAATGGGACAGATG-3 Lower primer 5 -TGCTGAATTGAATGTGTACCTATGTG-3 Probe 5 -(FAM)FTGAGAGAACACCCGATGTGACACAGAACTCP(TAMRA)-3

3 Homer1a expression after compression of dorsal root ganglion of LinRegPCR program (a gift from amc. uva.nl). According to the method tested by Pfaffl [24], the relative expression ratio (RR) of a targeted gene was calculated based on Eff and the Ct compared to the reference gene (GAPDH). Statistical analysis. Differences in values for paw withdrawal thermal latency (PWTL) and expression of Homer1a over time were tested by one-way ANOVA followed by Newman- Keuls post-tests. Student s t-test was used to identify the significant differences in PTWL and Homer1a mrna between the controls and the operated groups. All data were reported as means ± SE; p <0.05 was considered the criterion for statistical significance. Results The level of Homer1a expression of the CCD group increased significantly at 4 and 8 hr post-operation, compared to the Control group (p <0.01) and Sham group (p <0.01), respectively (Fig.1). The Homer1a expression of the CCD group was greatly increased at 4 and 8 hr post-operation compared to 48 hr pre-operation. At 24 hr post-operation, the Homer1a expression in the CCD group decreased to the baseline level at 48 hr pre-operation. Homer1a expression in the Control or Sham-operated groups did not show significant changes at the four specified time points (p >0.05). The expression of Homer1a in the contralateral side of the CCD, Control, and Sham-operated groups did not change significantly at any of the time points (p >0.05). At 4 and 8 hr post-operation, PWTL showed no significant differences in the CCD, Sham, and Control groups (p >0.05) (Fig. 2). PWTL was significantly decreased at 24 hr post-operation in the CCD group compared to 48 hr pre-operation (p <0.01), and there was also a significant decrease of PWTL compared to the Sham and Control groups (p <0.01). PWTL in the Control and Shamoperated groups showed no significant changes at 24 hr after operation. The PWTL on the contralateral side of the CCD, Control, and Sham groups did not change significantly at any of the time points (p >0.05). Discussion Glutamatergic signaling and intercellular calcium mobilization in the spinal cord are crucial for the development of nociceptive plasticity, which is associated with chronic pathological pain [4,25]. Homer1a, the short, activity-dependent splice variant of Homer1b/c, lacks the ability of linking mglur1/5 to synaptic proteins and functions as an endogenous negative modulator of the mglur1/5 inositol-1,4,5-trisphosphate (IP3) receptor signaling complex [14,26-30]. Recent investigations showed that Homer1a may be selectively expressed as an immediate early gene after synaptic activity [14,15,17]. The main goal of this study was to detect Fig. 1. Comparison of Homer1a mrna in CCD, Control, and Sham-operated rats at 48 hr pre-operation, 4 hr, 8 hr, and 24 hr post-operation (n = 5); Stars = p <0.01 vs CCD group at 48 hr pre-operation; ## = p<0.01 vs Control group; triangles = p<0.01 vs Sham-operated group. Data are presented as means ± SE. Fig. 2. Comparison of paw withdrawal thermal latency (PWTL) in CCD, Control, and Sham-operated rats at 48 hr pre-operation, 4 hr, 8 hr, and 24 hr post-operation (n = 5); Stars = p <0.01 vs CCD group at 48 hr pre-operation; ## = p <0.01 vs Control group; triangles = p <0.01 vs Sham-operated group. Data are presented as means ± SE.

4 74 Annals of Clinical & Laboratory Science, vol. 39, no. 1, 2009 the gene expression of Homer1a in an earlier period of CCD, which would in part reflect the change of Homer1a protein levels. In our current study, we demonstrated that CCD treatment induces Homer1a rapid expression in the spinal dorsal horn. The time-dependence of changes in expression of Homer1a was similar to that reported for cerebellar granule cells in which the induction of Homer1a mrna appeared slower (peak at 4 hr) and was sustained longer than typical immediate early genes such as c-fos. Miyabe et al [6] also showed that changes in the expression of Homer1a may underlie injury-elicited plasticity in the spinal dorsal horn. Our work showed some association between the expression of thermal hyperalgesia and changes in the level of Homer1a message in the spinal dorsal horn. The Homer1a expression increased at 4 and 8 hr, but returned to baseline values at 24 hr after CCD. On the contrary, thermal withdrawal latencies were unchanged at 4 and 8 hr, but decreased significantly at 24 hr after CCD. A previous study showed that activity-dependent upregulation of Homer1a is needed to promote its accumulation at post-synaptic sites to facilitate the redistribution of Homer1b/c and reorganize postsynaptic structures to promote enhancement of synaptic function [31], ie, synaptic plasticity, and to facilitate synaptic remodeling and contribute to the long-lasting increases in synaptic efficacy. Furthermore, the endogenous Homer1a may bind directly to G-protein-coupled receptors (GPCR), such as metabotropic glutamate receptors (mglur) [32]. Homer1a may also protect inflammatory pain in a manner that attenuates calcium mobilization as well as MAP kinase activation induced by glutamate receptors and reduce synaptic contacts on spinal cord neurons that process pain inputs [12]. In conclusion, CCD elicits early and transient up-regulation of Homer1a gene expression, which may play a role, at least in part, in the production of thermal hyperalgesia. As an immediate early gene, Homer1a may facilitate synaptic remodeling, mutate GPCR, and attenuate calcium mobilization that underlie the subsequent induction and development of pain. Acknowledgement This study was supported by the Department of Education Foundation of Jiangsu Province (Grant 02KJB320012). References 1. White FA, Sun J, Waters SM, Ma C, Ren D, Ripsch M, Steflik J, Cortright DN, Lamotte RH, Miller RJ. Excitatory monocyte chemoattractant protein-1 signaling is up-regulated insensory neurons after chronic compression of the dorsal root ganglion. PNAS USA 2005;102: Huang WL, Robson D, Liu MC, King VR, Averill S, Shortland PJ, Priestley JV. Spinal cord compression and dorsal root injury cause up-regulation of activating transcription factor-3 in large-diameter dorsal root ganglion neurons. Eur J Neurosci 2006;23: Chao T, Pham K, Steward O, Gupta R. Chronic nerve compression injury induces a phenotypic switch of neurons within the dorsal root ganglia. J Comp Neurol 2008;506: Ma ZL, Zhang W, Gu XP, Yang WS, Zeng YM. Effects of intrathecal injection of prednisolone acetate on expression of NR2B subunit and nnos in spinal cord of rats after chronic compression of dorsal root ganglia. Ann Clin Lab Sci 2007;37: Xiao L, Ma ZL, Li X, Lin QX, Que HP, Liu SJ. cdna microarray analysis of spinal cord injury and regeneration related genes in rat. Sheng Li Xue Bao 2005;57: Miyabe T, Miletic G, Miletic V. Loose ligation of the sciatic nerve in rats elicits transient up-regulation of Homer1a gene expression in the spinal dorsal horn. Neurosci Lett 2006;398: Tappe A, Klugmann M, Luo C, Hirlinger D, Agarwal N, Benrath J, Ehrengruber MU. Synaptic scaffolding protein Homer1a protects chronic inflammatory pain. Nat Med 2006;12: De Bartolomeis A, Iasevoli F. The homer family and the signal transduction system at glutamatergic postsynaptic density: potential role in behavior and pharmacotherapy. Psychopharmacol Bull 2003;37: Yang L, Mao L, Tang Q, Samdani S, Liu Z, Wang JQ. A novel Ca 2+ -independent signaling pathway to extracellular signal-regulated protein kinase by coactivation of NMDA receptors and metabotropic glutamate receptor 5 in neurons. J Neurosci 2004;24: Ji RR, Kohno T, Moore KA, Woolf CJ. Central sensitization and LTP: do pain and memory share similar mechanisms? Trends Neurosci 2003;26: Ji RR, Strichartz G. Cell signaling and the genesis of neuropathic pain. Sci STKE 2004;252:reE14.

5 Homer1a expression after compression of dorsal root ganglion Ehrengruber, MU, Kato A, Inokuchi K, Hennou S. Homer/Vesl proteins and their roles in CNS neurons. Mol Neurobiol 2004;29: Kato A, Ozawa F, Saitoh Y, Fukazawa Y, Sugiyama H, Inokuchi K. Novel members of the Vesl/Homer family of PDZ proteins that bind metabotropic glutamate receptors. J Biol Chem 1998;273: Xiao B, Tu JC, Petralia RS, Yuan JP, Doan A, Breder CD, Ruggiero A, Lanahan AA, Wenthold RJ, Worley PF. Homer regulates the association of group 1 metabotropic glutamate receptors with multivalent complexes of homer-related, synaptic proteins. Neuron 1998;21: Brakeman PR, Lanahan AA, O Brien R, Roche K, Barnes CA, Huqanir RL, Worley PF. Homer: a protein that selectively binds metabotropic glutamate receptors. Nature 1997;386: Tu JC, Xiao B, Yuan JP, Lanahan AA, Leoffert K, Li M, Linden DJ, Worley PF. Homer binds a novel proline-rich motif and links group 1 metabotropic glutamate receptors with IP3 receptors. Neuron 1998;21: Feng W, Tu J, Yang T, Vernon PS, Allen PD, Worley PF, Pessah IN. Homer regulates gain of ryanodine receptor type 1 channel complex. J Biol Chem 2002:277: Xiao B, Tu JC, Worley PF. Homer: a link between neural activity and glutamate receptor function. Curr Opin Neurobiol 2000;10: Song, XJ, Hu SJ, Greenquist KW, Zhang JM, LaMotte RH. Mechanical and thermal hyperalgesia and ectopic neuronal discharge after chronic compression of dorsal root ganglia. J. Neurophysiol 1999;82: Zimmermann M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983; 16: Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 1988;32: Chen J, Luo C, Li H, Chen H. Primary hyperalgesia to mechanical and heat stimuli following subcutaneous bee venom injection into the plantar surface of hindpaw in the conscious rat: a comparative study with the formalin test. Pain 1999;83: Ji GC, Ma F, Zhang YQ, Wu GC. Thermal hyperalgesic effects induced by intracerebroventricular injection of interleukin-1beta in rats. Sheng Li Xue Bao 2002;54: Pfaffl MW. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Res 2001;29:e Sun YY, Luo C, Li Z, Chen J. Differential actions of intrathecal nociceptin on persistent spontaneous nociception, hyperalgesia and inflammation produced by subcutaneous bee venom injection in conscious rats. Sheng Li Xue Bao 2004;56: Sandkuhler J. Learning and memory in pain pathways. Pain 2000;88: Woolf CJ, Salter MW. Neuronal plasticity: increasing the gain in pain. Science 2000;288: Tu JC, Xiao B, Naisbitt S, Yuan JP, Petralia RS, Brakeman P, Doan A, Aakalu VK, Lanahan AA, Sheng M, Worley PF. Coupling of mglur/homer and PSD-95 complexes by the Shank family of postsynaptic density proteins. Neuron 1999;23: Yuan JP, Kiselyov K, Shin DM, Chen J, Shcheynikov N, Kang SH, Dehoff MH, Schwarz MK, Seeburg PH, Muallem S, Worley PF. Homer binds TRPC family channels and is required for gating of TRPC1 by IP3 receptors. Cell 2003;114: Fagni L, Chavis P, Ango F, Bockaert J. Complex interactions between mglurs, intracellular Ca 2+ stores and ion channels in neurons. Trends Neurosci 2000; 23: Inoue Y, Honkura N, Kato A, Ogawa S, Udo H, Inokuchi K, Sugiyama H. Activity-inducible protein Homer1a/Vesl-1S promotes redistribution of postsynaptic protein Homer1c/Vesl-1L in cultured rat hippocampal neurons, Neurosci Lett 2004;354: Ango F, Prézeau L, Muller T, Tu JC, Xiao B, Worley PF, Pin JP, Bockaert J, Fagni L. Agonist-independent activation of metabotropic glutamate receptors by the intracellular protein Homer. Nature 2001;411: