Modified Cell Entry by Exhibiting of Hemagglutinin from Avian. Influenza Virus on Pseudotyped HIV Particles

Transcription

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology (4) : HA HIV 1),2), 1),2) 3, 1),2) 1),2), ( 1), ; 2), ) HA HIV, HA ( HIVΠH52HA), RT2PCR H5N1 ( HA) pcdna311 ( + ), 2 pcmv 812 phr 2CMVLacZ 293T, LacZ HA MDCK 6 LacZ,HIVΠH52 HA, ; Western FACS, HA HA ; HIVΠH52HA, ph,ha ph : H5N1 HA, HA, ; ; ;ph Q291 Modified Cell Entry by Exhibiting of Hemagglutinin from Avian : ; : (973,No. 2005CB523003) 3 Tel : ; Fax : , E2mail : com Received : October 15, 2007 ; Accepted : December 14, 2007 Influenza Virus on Pseudotyped HIV Particles ZHANG Song2Lin 1),2), J IN Mei2Lin 1),2) 3, XIAO Ling2Yun 1),2) 1),2), CHEN Huan2Chun ( 1) Unit of Animal Infectious Diseases, National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan , China ; 2) Laboratory of Animal Virology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan , China) Abstract The pseudotyped virus ( HIVΠH52HA ) was produced into HIV particles by incorporating hemagglutinin ( HA) protein from H5N1 avian influenza virus (AIV) and its infectivity was characterized in various cell lines. The HA fragment was amplified by RT2PCR and cloned into a pcdna311 ( + ) vector, then cotransfected with retroviral producing vectors pcmv 812 and phr 2CMVLacZ into 293T cells for viral packaging. The HIVΠH52HA transduction was analysis by X2Gal Staining after infections to 293T, BHK, Vero, PK215, IBRS22 and MDCK cells. The results demonstrated that the pseudotyped viral particles possessed a wide cell tropism. The HA glycoproteins were properly decorated on the virions as determined by Western blot, FACS and EM, and were able to agglutinate chicken erythrocytes. We also found that HIVΠH52 HA entry into the infected cells required a low ph for membrane fusions. Our results showed that the HA2 presenting HIV pseudotyping system was capable to produce functional virions, and might be a useful for the study of the host immunologic response of AIV. Key words avian influenza virus ; hemagglutinin glycoprotein ; pseudotyped virus ; ph2dependent Supported by Major Basic Research Development Program of China (973 Program,No. 2005CB523003) 3 Corresponding author Tel : ; Fax : , E2mail : com

2 4 : HA HIV 367 (avian influenza,ai) A ,, 334, 205 ( http :ΠΠwww. who. intπcsrπdiseaseπ avian - influenza). (hemagglutinin,ha) ( neuraminidase, NA), 16 ( H1216,N12 9) [1 ]. (avian influenza virus,aiv) ( hemagglutinin,ha),,, [2 ]. HA 4,, [3,4 ]. HA HA0, HA0 2 HA1 HA2. HA0 HA1 HA2,HA HA1,HA2 ph., ( NH 4 Cl) [5 ]. : ; DNA RNA,,,,,,,, [6 8 ]., [9,10 ]. H5N1, AΠchickenΠHubeiΠ327Π2004 ( GenBank Accession No. AY486706) 2 pcmv 812 phr 2 CMVLacZ [11,12 ] 293T, pcdna3. 1 pbabepuro 2Galactosidase Enzyme Assay System with Reporter Lysis Buffer Promega Polybrene Sigma 1. 2 pbhha AΠchickenΠHubeiΠ327Π2004 AIV HA, Primer bp HA ( P1 : 5 2GCAAAGCTTATGGAGAAAATAGTGC23 P2 : 5 2GCAGGATCCTTAAATGCAAATTCTGC23, Hind BamH, ). Promega Total RNA Isolation System, RNA PCR. RT2PCR Hoffmann [13 ] A RT2PCR, pmd182t, Hind BamH, Hind BamH pmd2ha pcdna311 ( + ), DNA, DH5,,, pbhha HIVΠH52HA HIVΠH52HA [14 ], 40 g pieha,25 g pcmv 812,20 g phr 2CMVLacZ 293T 40 g G pvsv2g [15 ], 25 g pcmv 812, 20 g phr 2CMVLacZ 293T. 37,5 % CO 2 8 h, PBS (ph714) 15 % (VΠV), min., PBS (ph714). 10 mmolπl. 37, 5 % CO d.,3 000 rπmin, 5 min

3 368 24,0145 m, HIVΠH52HA,20 % rπmin 2 h,pbs 2 5 min, H5N1 Western, HA 1. 5 HIVΠH52HA LacZ pieha,pcmv 812,pHR 2CMVLacZ 293T 48 h PBS, 2 ml 15 min. PBS 3. 1 ml X2 Gal ( 012 % X2Gal, 2 mmolπl MgCl 2, 5 mmolπl K 4 Fe (CN) 6 3H 2 O,5 mmolπl K 3 Fe (CN) 6 ) min HIVΠH52HA HIVΠH52 HA HIVΠVSV2G( pvsv2g pcmv 812 phr 2CMVLacZ ) 1 ml 293T 3 cm, Polybrene ( 8 gπml), 1 h 1 ml 10 % DMEM h h 420 nm. 293T HIVΠH52HA 24 h, T BHK VERO PK IBRS22 MDCK 6, 1 ml, Polybrene ( 8 gπml), 1 h 1 ml 10 % DMEM h h. Promega 2Galactosidase Enzyme Assay System with Reporter Lysis Buffer 1. 6 HA ph NH 4 Cl (0 50 mmolπl) Vero 24, DMEM,37 1 h, HIVΠH52HA,12 h ;48 h, LacZ ; ph HIVΠVSV2G 1. 7 FACS Vero HA HA pbabepuro, 293 T 48 h,, 8 gπml polybrene, Vero 48 h, 5 gπml, Vero. 48 h HA 1 h,fitc IgG ( FACS) Vero HA 1. 8 HA 1 11, 50 l. HA AΠchickenΠ HubeiΠ327Π l 1, 015 % 50 l. 45 min 1. 9 HA, 2 %, SAS (8. 1), T, P < 0105, P < pbhha Hind BamH PCR pcdna311 ( + ), 1. 7 kb 5 kb, HA pcdna3. 1, pbhha ( Fig. 1)., HA AΠchickenΠHubeiΠ327Π2004 AIV HA, Fig. 1 Identify of recombinant plasmid pbhha Total RNA was extracted from AΠchickenΠHubeiΠ327Π2004 strain and cdna was performed by using universal primer sequence. The AIV HA gene was amplified by PCR, and then cloned into pcdna311 ( + ) vector to generate the plasmid pbhha. 1 : pbhha digested by Hind and BamH. M: Marker DL1500 (TaKaRa, Japan)

4 4 : HA HIV HA Western HA 3 ( Fig. 2), HA HA0 ( 76 kd) HA1 ( 47 kd) HA2 ( 29 kd), HA Fig. 2 Analysis of HIVΠH52HA by Western blotting HIVΠH52HA puried by ultracentrifugation were subjected to 8 % SDS2 PAGE, and analyzed by Western blotting. Three main bands were detected with the expression of HIVΠH52HA (lane1). But not any band was detected in 293T cells control by Western blotting (lane2). Lane 3 represented markers 2. 3 HA, 1 ml X2Gal, HA G, 293T ( Fig. 3A)., nm,293t 420 nm 01226, HIVΠ H52HA 420 nm 11886, HIVΠ VSV2G 420 nm ( Fig. 3B). T,HIVΠH52HA,HIVΠVSV2G 293T ( P ). HIVΠH52HA, HIVΠH52HA 293T BHK Vero PK IBRS22 MDCK 6,420 nm Fig. 3C,HIVΠH52HA 293T MDCK, Vero BHK, 4 ( P < ),PK ( P = ), IBRS22 HIVΠ H52HA ( P = ). Fig. 3 Analysis of infection activity of HIVΠH52HA (A) 293T cells were transfected with 40 g of pbhha plus 25 g of pcmv 812 and 20 g of phr 2CMVLacZ or 40 g of pvsv2gplus 25 g of pcmv 812 and 20 g of phr 2CMVLacZ respectively per 102cm dish by using calcium phosphate. The cells were fixed by glutaraldehyde for 48 hours later, and then stained with X2Gal for min ; (B) 293T cells were infected with HIVΠH52HA or HIVΠVSV2G respectively. Infected cells were lysed and detected LacZ expression under 420 nm A 420 value by use of 2galactosidase enzyme assay system with reporter lysis buffer ; (C) Various cell lines were infected with HIVΠH52HA. Each cell line without transfection was used as negative controls. All data represent mean SD of duplicate assays

5 HA ph 420 nm LacZ, ph,hivπh52ha, NH 4 Cl 40 mmolπl HIVΠH52HA ( Fig. 4)., HIVΠH52HA ph HIVΠVSV2G 420 nm NH4Cl ( P < ), R 2 = ( y = x ) R 2 = ( y = x ). Fig. 4 ph2dependent analyzed with linear regression analysis Vero cells treated with various concentrations of NH 4 Cl (0 50 mmolπl) were infected with HIVΠH52HA. HIVΠVSV2G was used as positive controls 2. 5 FACS HA, 15 % Vero ; Vero, 15 % HA Vero, Vero HA Vero,, HA Vero, FITC Fig. 5,A Vero FACS,B HA Vero FACS,, HA Vero Fig. 5 Expression assays of HA protein by flow cytometric HA was cloned into retroviral vector pbabepuro and transduced into Vero cells by the screening of puromycin. The survival cells were mixed with immunized rabbit sera for 1 hour, and then incubated with FITC2conjugated goat anti2rabbit IgGfor 30 min. Then the cells were analysed by FACS. (A) Vero cells without transfection. (B) Vero cells transduced with HA gene 2. 6 HA 293T, HA AIV AΠchickenΠHubeiΠ327Π2004 Fig. 6. AIV 2 8 ( 1 256),HA 2 5 ( 1 32), 293T 2. 7,, nm (Fig. 7).

6 4 : HA HIV 371 Fig. 6 Hemagglutination test on HIVΠH52HA 50 l of 1 % chicken red blood cells (RBC) suspension in PBS at V2bottomed micro well plastic plates was added to 50 l of two2fold dilutions of HIVΠH52HA from transfected 293T cells or AΠchickenΠ HubeiΠ327Π2004 strain AIV or 293T cells suspension, respectively, and the mixture was incubated at room temperature for 30 min. The HA titer was calculated as the reciprocal value of the highest virus dilution that caused complete haemagglutination Fig. 7 EM image of 293T producer cells with budding HIVΠH52HA For EM observation, HIVΠH52HA virions puried by ultracentrifugation were stained with phosphotungstic acid and subjected to EM ( Hitachi2 H7650, Japan) 3,, ;,,,,, 1,,, pcmv 8. 2 phr 2CMVLacZ H5N1 HA 293T, HIVΠH52HA. Western, 3, HA HA0 2 HA1 HA2, HA HIV (Fig. 2)., HA Vero, HA, HA. HIVΠH52HA,, nm, 110 nm, (Fig. 7)., HIVΠH52HA 293T, HIVΠVSV2G, 293T (Fig. 3A) nm ( Fig. 3B)., HIVΠH52HA, HIVΠH52HA MDCK 6,HIVΠH52HA (Fig. 3C). N2, HA HA HIV,,HIVΠH52HA

7 372 24, 2 5 ( Fig. 6), HIVΠH52 HA HA AΠchickenΠ HubeiΠ327Π2004 HA,Nefkens [16 ] H5 HA, HIVΠH52HA,, HIVΠH52 HA, HA1, HA2, ph HA2, NH4Cl, HIVΠH52HA ph, ph HA, 40 mmolπl NH 4 Cl HIVΠH52 HA ; HIVΠH52HA NH4Cl (Fig. 4),, HIVΠH52HA ph,,,, H5 HA,,,,, ( References) [ 1 ] Fouchier R A, Munster V, Wallensten A, et al. Characterization of a novel influenza A virus hemagglutinin subtype ( H16) obtained from black2headed gulls [J ]. J Virol, 2005, 79 (5) : [ 2 ] Suarez D L, Schultz2Cherry S. Immunology of avian influenza virus : a review [J ]. Dev Comp Immunol, 2000, 24(223) : [ 3 ] Bullough P A, Hughson F M, Skehel J J, et al. Structure of influenza haemagglutinin at the ph of membrane fusion [J ]. Nature, 1994, 371 (6492) : [ 4 ] Wilson I A, Skehel J J, Wiley D C. Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3 A resolution [ J ]. Nature, 1981, 289(5796) : [ 5 ] Sieczkarski S B, Whittaker G R. Dissecting virus entry via endocytosis [J ]. J Gen Virol, 2002, 83(3) : [ 6 ] Dong J, Roth M G, Hunter E. A chimeric avian retrovirus containing the influenza virus hemagglutinin gene has an expanded host range [J ]. J Virol, 1992, 66(12) : [ 7 ] Landau N R, Page K A, Littman D R. Pseudotyping with human T2 cell leukemia virus type I broadens the human immunodeficiency virus host range [J ]. J Virol, 1991, 65(1) : [ 8 ] Suomalainen M, Garoff H. Incorporation of homologous and heterologous proteins into the envelope of Moloney murine leukemia virus [J ]. J Virol, 1994, 68(8) : [ 9 ] Chan S Y, Empig C J, Welte F J, et al. Folate receptor2 is a cofactor for cellular entry by Marburg and Ebola viruses [J ]. Cell, 2001, 106 (1) : [10 ] Wool2Lewis R J, Bates P. Characterization of Ebola virus entry by using pseudotyped viruses : identification of receptor2deficient cell lines [J ]. J Virol, 1998, 72(4) : [11 ] Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector [J ]. Science, 1996, 272(5259) : [12 ] Watson D J, Kobinger G P, Passini M A, et al. Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins [J ]. Mol Ther, 2002, 5 (5) : [13 ] Hoffmann E, Stech J, Guan Y, et al. Universal primer set for the full2length amplification of all influenza A viruses [J ]. Arch Virol, 2001, 146 (12) : [14 ] Simmons G, Reeves J D, Rennekamp A J, et al. Characterization of severe acute respiratory syndrome2associated coronavirus ( SARS2 CoV) spike glycoprotein2mediated viral entry [J ]. Proc Natl Acad Sci USA, 2004, 101(12) : [15 ] Simmons G, Wool2Lewis R J, Baribaud F, et al. Ebola virus glycoproteins induce global surface protein down2modulation and loss of cell adherence [J ]. J Virol, 2002, 76(5) : [16 ] Nefkens I, Garcia J M, Ling C S, et al. Hemagglutinin pseudotyped lentiviral particles : Characterization of a new method for avian H5N1 influenza sero2diagnosis [J ]. J Clin Virol,2007,39(1) : 27233