Tips for genome-wide shrna pooled screen

Transcription

1 Tips for genome-wide shrna pooled screen 鄭金松 1

2 Approaches to large-scale RNAi screen/selection (I) Arrayed RNAi screen To address the hits by arrayed information (a) sirna / plasmid shrna (b) Arrayed viral shrna (a) Transfect into cells (b) Transduce into cells (II) Pooled RNAi selection Pooled viral shrna Transduce into cells Select cells To identify hits by barcode microarray or PCR sequencing (NGS) 2

3 Overview of RNAi pooled screening Pooled shrna library M.O.I = 0.1 to to 500 representatives Treatment/ application: Therapeu. drug (drug interaction protein), Synthetic lethal Hypoxia, Migration Virus etc Adapted from Methods Mol Biol. 2013; 980:353. 3

4 Statistic of RNAi Screen Genomics, Drug Discovery World Summer 2013 pp

5 Overview of literatures that used TRC RNAi library for screening-i 1. Highly parallel identification of essential genes in cancer cells. (45,000 shrnas/11,248 genes) Luo B et al and Root DE (TRC-Broad). Proc Natl Acad Sci U S A. 2008; 105: Systematic investigation of genetic vulnerabilities across cancer cell lines revceals lineage-specific dependentcies in ovarian cancer. (45,000 shrnas/11,248 genes). Cheung HW et al. and Hahn WC. (Dana-Farber and Harvard Medical School) PNAS 2011; 108: A genome-wide RNAi screen identifies multiple RSK-dependent regulators of cell migration. (45,000 shrnas/11,248 genes) Smolen GA et al and Haber DA (Harvard Medical School). Genes Dev. 2010; 24: CD133 protein N-glycosylation processing contributes to cell surface recognition of the primitive cell marker AC133 epitope. (45,000 shrnas/11,248 genes) Mak AB, et al and Moffat J (University of Toronto). J Biol Chem. 2011; 286:

6 Overview of literatures that used TRC RNAi library for screening-ii 4. Pooled RNAi screen identifies ubiquitin ligase Itch as crucial for influenza A virus release from the endosome during virus entry. (82,000 shrnas/16,000 geners) Su WC et al and Lai MM ( 中國醫藥 and Academia Sinica). Proc Natl Acad Sci U S A. 2013;110: RNAi screen identifies MAPK14 as a druggable suppressor of human hematopoietic stem cell expansion. (TRC-Sigma, 1000 druggable gene) Baudet A et al and Larsson J (Lund University, Lund, Sweden). Blood. 2012; 119: Functional genomic screen of human stem cell differentiation reveals pathways involved in neurodevelopment and neurodegeneration. (TRC/Sigma, 8,488 shrnas/1,801 genes, 1 of 10 pools) Zhang Y et al and Szekely AM. (Stanford University) Proc Natl Acad Sci U S A. 2013;110:

7 RNAi pooled libraries in the Core Genome-wide Scale: 1. 82K TRC1 shrna targeting 16,000 human genes K integrated TRC1&TRC2 shrna targeting 21,000 mouse genes K integrated TRC1&TRC2 shrna targeting 20,000 human genes 7

8 KD distribution of 100K genome-wide RNAi mouse pool Pool # shrna # shrna # with good KD Pool Pool Pool Pool Pool Pool Pool Pool Pool Pool

9 Tips for pooled screen Make sure that cells of shrna-expressing library carry one copy of shrna as much as possible by transducing shrna lentivirus without polybrene and low MOI; Make up representatives for each shrna; Undergo selection process with stringent condition; Prepare appropriate amounts of genomic DNA without loss of shrna complexity; Avoid creating conditions that generate sequencing bias, such as over-amplification and two rounds of PCR; Prepare half arm of shrna-containing fragments for NGS because full-length shrna may impede decoding sequence. 9

10 Distribution probability of theoretical virus numbers in infected cells m: the multiplicity of infection or MOI; n: the occurrence of event that virus(s) enters into the cells; P(n): the probability that a cell get infected by n viruses. 10

11 A Mimic library A549 AS7w.EGFP.puro AS7w.mCherry.puro Mock 0.0% with Polybrene 13.6% 46.3% 36.9% w/o Polybrene 8.5% 47.2% 39.9% MOI: 0.3 mcherry-as7w.mcherry.puro 44.9% 11.0% 40.3% 6.8% 46.2% 6.8% 42.4% 3.9% MOI: 0.2 AS7w.EGFP.puro AS7w.mCherry.puro 27.9% 48.0% 61.2% 43.2% MOI: % 95.1% FITC-AS7w.EGFP.puro MOI: 0.2 with polybrene MOI: 0.2 with polybrene 乃芝 & 宜臻 11

12 Features of shrna library-expressing cells Cells = A k shrnas; 1x10^4 shrnas/pool; 11 sub-pools M.O.I. of shrna lentivirus 0.1 (without polybrene during transduction) Representatives/coverage 500 cells/ shrna Influenza A virus used 4 sub-pools for IAV selection/ screen: (pools1, 2, 3); (pools 4, 5, 8) (pools 5, 6, 7) and (pools 10, 11, Luc976). A/WSN/1933(H1N1): M.O.I 2 A/Vienam/1194/2004-NIBRG-14 (H5N1 ): M.O.I 2 12

13 Schematic representation of primary genome- wide pooled RNAi screen Establishment of shrnaexpressing library: transduced A549 cells in the absence of polybrene M.O.I.= 0.1 A549 cells Puromycin selection of shrna positive cells Expansion of cell population and infection with IAV Infection with influenza A virus (WSN) 13

14 Amplification and Sequencing Region Sequencing fragment 300 bp Xho I EcoRI Xho I 5 U6p-all/F 352 bp LKO1&5/R Asc I Asc I 5 U6p-all/F: aggcgcgccgagggcctatttcccatg/ aggcgcgccagagagggcctatttcccatg LKO1&5/R: tgtggatgaatactgccatttgtctc

15 Annealing instead of amplification at stationary phase of PCR Amplicon of shrna#1 Amplicon of shrna#2 Annealing product of shrna#1 & shrna#2 M 15

16 Analyses of copy number of integrated shrna M S D M S D M S D S D M

17 S D Percentage of more than 1 = (7 85) 100% = 8.2% 17

18 M Ctl #8 #1 #9 #2 #10 #3 #11 #4 #12 #5 #13 #6 #14 #7 18

19 S D #68 #76 #69 #77 #70 #78 #71 #79 #72 #80 #73 #81 #74 #82 #75 #83 19

20 S D #84 #85 #86 Percentage of more than 1 = (7 85) 100% = 8.2%

21 TRC 110k shrnas-transduced A549 cells acquires resistance to A/WSN/1933(H1N1) infection Day 12 Control (Void) Pool #1,#2,#3 Pool #5,#6,#7 Pool #4,#8,#9 Pool #10,#11, and Luc976 Control (Luc976) Day 12 21

22 Titration of genomic DNA amounts gdna / Rxn (?µg/50µl) Genomic DNA 766bp 300bp 150bp 50bp 350bp 22

23 Amplification and Sequencing Region Sequencing fragment 300 bp Xho I EcoRI Xho I 5 U6p-all/F 352 bp LKO1&5/R Asc I Asc I 5 U6p-all/F: aggcgcgccgagggcctatttcccatg/ aggcgcgccagagagggcctatttcccatg LKO1&5/R: tgtggatgaatactgccatttgtctc 766bp 500bp 300bp 150bp M PCR Cycles

24 Sequencing profile on shrna region of purified DNA fragments Xho I Xho I ACCGGNNNNNNNNNNNNNNNNNNNNNCTCGAA 24

25 25