IDENTIFICATION OF MAREK S DISEASE VIRUS (MDV) AND HERPESVIRUS OF TURKEY (HVT) USING DUPLEX POLYMERASE CHAIN REACTION (PCR) APPROACH

Size: px

Start display at page:

Download "IDENTIFICATION OF MAREK S DISEASE VIRUS (MDV) AND HERPESVIRUS OF TURKEY (HVT) USING DUPLEX POLYMERASE CHAIN REACTION (PCR) APPROACH"

Duane Weaver
5 years ago
Views:

1 IDENTIFICATION OF MAREK S DISEASE VIRUS (MDV) AND HERPESVIRUS OF TURKEY (HVT) USING DUPLEX POLYMERASE CHAIN REACTION (PCR) APPROACH RISZA HARTAWAN Indonesian Research Center for Veterinary Science Jl. R.E. Martadinata No. 30, Bogor 16114, Indonesia rjoss.dvm@gmail.com ABSTRACT Outbreaks of Marek s disease in all over the world have resulted in considerable economic loss in affected layer or breeding farms. Fortunately, the vaccination programs have generated satisfactions outcome to reduce the number of outbreak despite a few number of cases have still occurred. In Indonesia, two kind master seeds of vaccine are extensively applied in the field; including attenuated MDV-1 CVI988 and HVT strain FC128, either as single or combination vaccine. The objective of the current study is to identify and differentiate these two strain of virus using polymerase chain reaction test that are faster and reliable. While the test of strain MDV-1 is targeted on the meq gene as gene marker, the sorf 1 gene are used for the identification strain HVT. As a result, PCR for these genes are successfully used to differentiate these two strains of virus, either as in single assay or in duplex assay platform. This outcome is beneficial for the next stage of Marek s disease study. Key words: Marek s Disease Virus, Herpesvirus of Turkey, PCR, Duplex, Meq Gene, Sorf 1 Gene INTRODUCTION Marek s disease is infectious disease in poultry (Gallus sp.) with limphoproliferative disorder that induced T cell tumorigenesis development in many tissues such as lymphoid organ, liver, peripheral nervous system and other internal organs (Baigent and Davidson, 2004; Biggs, 2001; Calnek, 2001; Calnek and Witter, 1991). The clinical signs maybe vary depend on the strain of virus and host resistance; however, paralysis occurs because of tumor formation on the ischiadic nervous (Calnek, 2001). The causative agent is Marek s disease virus, which is double-stranded linear DNA virus belonging to Mardivirus genus of Alphaherpesvirinae subfamily (Davison, 2010). Three members of the Mardivirus are Marek s disease virus (MDV), Gallid herpesvirus 3 (GaHV3) and herpesvirus of turkeys (HVT) (Osterrieder and Vautherot, 2004). The MDV infection spreads to all flocks via either direct or indirect contact, including infected chickens, premises, litter, dust and chopped feathers (Baigent and Davidson, 2004; Calnek, 2001; Calnek et al., 1970; Jurajda and Klimes, 1970). Therefore, the distribution of disease has been found in many regions all over the world that caused significant economic loss to affected breeder and/or layer farms (MacLachlan and Dubovi, 2011). Successful story of vaccination program against the disease has been achieved using several kinds of vaccines, including attenuated MDV, GaHV3 and HVT (Biggs and Nair, 2012). Despite application of vaccination reduce outbreak of disease significantly, several strain of virus could survive from the pressure of vaccination that lead to more pathogenic strains (Gimeno, 2008). The MDV mutation was supported by the evolution of MDV into several group levels from classical mild, virulent (v), very virulent (vv), very virulent plus (vv+) viruses (Witter, 1997; 1998). These new strains may cause the vaccination program become ineffective so the outbreak may still occur in the field. Therefore, a reliable detection technique is indispensible for monitoring disease situation in the field. Diagnosis is usually established based on flock history confirmed with clinical sign that supported by anatomy and histo-pathology examination (MacLachlan and Dubovi, 2011). Several diagnostic techniques can be used 395

confirmatory test, including virus isolation, immunofluorescence test, agar gel precipitation test, electron microscopy examination and molecular identification (Sharma, 1998).

2 confirmatory test, including virus isolation, immunofluorescence test, agar gel precipitation test, electron microscopy examination and molecular identification (Sharma, 1998). Therefore, polymerase chain reaction (PCR) offers faster and more reliable test as diagnostic tool of Marek s disease (Baigent et al., 2005; Handberg et al., 2001; Islam et al., 2004; Islam et al., 2006; Renz et al., 2006). The objective of this study was to establish diagnostic test of Marek s disease using PCR based on several previous studies (Islam et al., 2004; Islam et al., 2006). Identification of these Mardivirus members was accomplished by employing different markers, which are meq and sorf1 gene for MDV and HVT, respectively. For economical motivation, a duplex PCR platform was trialed by joining the PCR test for both MDV and HVT in single assay (Miesfield, 1999). This, this duplex approach of PCR assay was expected to become an essential diagnostic tool for monitoring Marek s disease circumstances in the field. MATERIALS AND METHODS Virus standard and DNA extraction for the PCR assay The vaccine viruses utilized as antigen standard for positive control within the PCR est were obtained from the commercial resource (PT ROMINDO), including CVI988 (MDV-1) (Rispen et al., 1972) and HVT (MDV-3) (Okazaki et al., 1970). The vaccine of GaHV3 was excluded from the study because this kind of master seed has been no longer used in Indonesia. The viral appearance of both MDV and HVT virions is illustrated on Figure 1, while the clinical symptoms of Marek s disease in the infected chicken are shown in Figure 2. The material genetic of these viruses was extracted using a QIAamp DNA mini kit (QIAGEN ) according to the manufacturer s instructions. Subsequently, the DNA was quantified using NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc.) and preserved at -20 o C until further uses. Primer design for MDV and HVT As the same member of Mardivirus genus, MDV and HVT share an extensive homology in the genomic content and organization except encoded gene for pathogenicity (Afonso et al., 2001; Kingham et al., 2001). With approximately 150 kilo base pair (kbp) as an entire genome, their genomes are arranged in a similar pattern that consists of a unique long region (UL) and a unique short region (US) bound by inverted repeat (Fauquet et al., 2005). However, each serotype retains several distinctive genes that can be exploited for identification and differentiation. For example, Figure 1. The virions appearance of MDV and HVT with electron microscope examination in the cell culture. (A) Virus particle of MDV in the nucleus and cytoplasm (B) Virus particle of HVT in the cytoplasm. Adapted from Okada et al. (1972) 396

3 Figure 2. The clinical symptoms of Marek s disease in the infected chicken. (A) Typical posture of paralysis caused by MDV infection. (B) Inflammation and enlargement of the left sciatic plexus caused by tumor inflammation. (C) Enlargement of liver with numerous tumor lesions. (D) Infiltration of tumor in the liver and spleen. Adapted from Vegad (2007) the meq gene of MDV encodes a 339-amino acid bzip transactivator associated with oncogenicity factor (Kung et al., 2001). Thus, the meq gene is an excellent marker for specific detection of MDV since this gene is absent in the other serotypes. Meanwhile, sorf1 gene is a unique putative gene within HVT genome that a suitable candidate for specific detection for HVT (Kingham et al., 2001). Therefore, two sets of primers employed for MDV and HVT within study were chosen from previous study (Islam et al., 2004). These designed primers are suitable for the research purpose in term of gene target and size of amplification. The detail of oligo primer used within the study was showed in Table 1. Table 1. Oligonucleotide primers used in amplification of fragments of meq and sorf1 genes Target gene Primer Primer sequence (5 3 ) Expected amplification size meq gene (MDV) meq F GAATCTTCCCTGCATTGTGTC meq R ATCTGGCCCGAATACAAGGAA 196 bp sorf1 gene (HVT) sorf1 F AAGCGCTTGTATGTGTAGG sorf1 R TATGGACGTCATGCAGTTGG 350 bp 397

4 PCR protocol for amplification for either meq or sorf1 gene The PCR assay was performed using HotStarTaq Plus (QIAGEN ) as per manufacturer s instruction. Briefly, the PCR for individual gene was carried out in a 20 μl mixture containing 2 µl of HotStarTaq Plus Master mix (2x), 2 μl of CoralLoad concentrate (10x), 0.5 μl of each respective forward and reverse primer (20 μm), 6 μl of RNase free water and 1 μl of respective DNA template. The thermal cycling profile was designed at the same conditions for amplification for either meq or sorf1 gene, which was 95 C for 5 min (initial DNA denaturation), 30 cycles of 94 C for 90 s (denaturation), 60 C for 60 s (annealing) and 72 C for 60 s (extension), and followed by 72 C for 10 min as final extension (Islam et al., 2006). The PCR products were visualized by electrophoresis (100 Volts, 30 min) in 2% Agarose gels stained with ethidium bromide in 1x Tris-Borate-EDTA (TBE) buffer. The molecular weight markers for DNA gel analysis were a 100 bp DNA ladder (QIAGEN ). Duplex PCR protocol for amplification for both meq and sorf1 gene The protocol for duplex PCR assay for both meq and sorf1 gene is almost similar with PCR assay for single gene amplification of meq or sorf1 gene, except the number of primer used within the reactions. Two set of primer for amplification of these genes are included on the PCR test. Briefly, the duplex PCR for the genes was carried out in a 20 μl mixture containing 2 µl of HotStarTaq Plus Master mix (2x), 2 μl of Coral Load concentrate (10x), 0.5 μl of each forward and reverse primer for amplification meq gene (20 µm), 0.5 μl of each forward and reverse primer for amplification sorf1 gene (20 µm), 5 μl of RNase free water and 1 μl of respective DNA template. The thermal cycling profile was designed at the same conditions for single amplification of meq or sorf1 gene. The PCR products were visualized by electrophoresis (100 Volts, 30 min) in 2% agarose gels stained with ethidium bromide in 1xTBE buffer with 100 bp DNA ladder (QIAGEN ) as the molecular weight markers. RESULTS AND DISCUSSION Outcome of DNA extraction from the standard antigens The DNA for template of PCR assay was extracted from commercial live vaccine for Marek s disease, including live vaccine MDV serotype 1 Rispens CVI 988 (Merial JA199) and live vaccine Marek s serotype 3 HVT (Merial A9333). Both viruses were propagated in cell culture and preserved as lyophilized form. Therefore, QIAamp DNA mini kit (QIAGEN ) is a suitable reagent to extract the material genetic for the kind of sample. As a result, the template DNA was successfully extracted with expected concentration. See Table 2 for detail result of the DNA extraction. As the viruses are highly cell associated (Baigent and Davidson, 2004; Calnek, 2001), the outcome of extraction process is a total DNA of host cell and virus genome. Due to this limitation, it was impossible to quantify number of DNA of viral genome since the DNA of host cells is also abundant within extracted DNA. Actually, the number of viral genome DNA can be determined by calculating relative number between virus genome and Table 2. Quantity of extracted DNA from standard antigens (MDV and HVT) using QIAamp DNA mini kit (QIAGEN ) Virus Strain of virus Source of virus (PT ROMINDO) Replicate DNA Quantity MDV Rispens CVI 988 Live vaccine MDV serotype 1 Replicate ng/ul (Merial JA199) Replicate ng/ul HVT FC126 Live vaccine Marek s serotype 3 Replicate ng/ul (Merial A9333) Replicate ng/ul 398

5 host DNA by quantifying the α2 (VI) collagen chicken (host DNA) using qpcr (Islam et al., 2004). Another approach is by cloning targeted gene into suitable cloning vector for quantification purpose (Baigent et al., 2005; Islam et al., 2006). However, these approaches were beyond the current stage of study. PCR assay for either MDV or HVT The PCR assay designed for either MDV or HVT was successfully amplified targeted marker genes with expected size of amplification products that are 196 bp and 350 bp for meq and sorf1 gene, respectively. These PCR protocols for both genes are proven specific with no cross amplification between these targeted genes. See Figure 3 for supported evidence of specific amplification of either meq or sorf1 gene. The templates were not diluted in the PCR assay since because the quantification of total DNA do not reflect virus contain. Therefore, sensitivity of the PCR assay cannot be determined because of this limitation. Duplex PCR platform for both MDV and HVT The individual PCR assay for either MDV or HVT was capable to identify and differentiate the presence of MDV and HVT by detecting targeted genes. Since the size of amplification product of the PCR assay is quite small and in different proportion, the duplex platform of PCR assay for both virus at the same time can be designed using the same protocol and reagents as the individual assay. The differentiation was performed by observing the size of DNA product, which is 196 bp and 350 bp for MDV and HVT, respectively. The successful trial of duplex PCR assay for both MDV and HVT is illustrated on Figure 4. CONCLUSION In conclusion, the PCR assay by using marker gene of meq and sorf1 gene for MDV and HVT respectively either in individual or in duplex platform was able to detect, identify and differentiate these two members of Mardivirus in the presence of abundance of host genome. This duplex assay will facilitate a large-scale investigation of Mardivirus in a more straightforward and time-cost effective manner. However, several directions for future works are important to be concerned to address problems arisen from the field. Firstly, the duplex test needs to broaden into triplex assay that able to detect another member of Mardivirust (GaHV3) as well. Secondly, the PCR assay needs to be optimized to deal with several type of field sample including tissue/organ, peripheral blood lymphocyte (PBL), feather follicle and dust as Figure 3. Identification and differentiation of either MDV or HVT using the individual PCR assay. (A) Amplification of meq gene (196 bp) for specific detection of MDV for DNA template of MDV and HVT. (B) Amplification of sorf1 gene (350 bp) for specific detection of HVT for DNA template of MDV and HVT 399

Figure 4. Identification and differentiation of MDV and/or HVT using the duplex PCR assay by amplifying meq and sorf1 gene environmental sample.

6 Figure 4. Identification and differentiation of MDV and/or HVT using the duplex PCR assay by amplifying meq and sorf1 gene environmental sample. Finally, there is a demand for an assay that capable to differentiate between field and vaccine strain of MDV. ACKNOWLEDGEMENT This study was financially funded by Australian Centre for International Agricultural Research (ACIAR) under the scheme of The Small Project Award for John Allwright Fellowship Returnees with the title Establishing a PCR diagnostic protocol for Marek s disease in IRCVS ), for which the author is grateful. REFERENCES Afonso, C.L., E.R. Tulman, Z. Lu, L. Zsak, D.L. Rock and G.F. Kutish The genome of turkey herpesvirus. J. Virol. 75: Baigent, S.J. and F. Davidson Marek's disease virus: biology and life cycle. In: Marek's Disease: An Envolving Problem, Davison, F. and V. Nair (Eds.). Elseiver Academic Press, London. pp Baigent, S.J., L.J. Petherbridge, K. Howes, L.P. Smith, R.J.W. Currie and V.K. Nair Absolute quantitation of Marek s disease virus genome copy number in chicken feather and lymphocyte samples using real-time PCR. J. Virol. Methods 123: Biggs, P.M. and V. Nair The long view: 40 years of Marek's disease research and Avian Pathology. Avian Pathol. 41: 3 9. Biggs, P.M The History and Biology of Marek's Disease Virus. In: Marek's Disease, K. Hirai (Ed.). Springer, Berlin. pp Calnek, B.W. and R.L. Witter Marek's Disease. In: Disease of Poultry, 9 th ed. Calnek, B.W., H.J. Barnes, C.W. Beard, W.M. Reid and J.H.W. Yoder (Eds.). Iowa State University Press, Iowa. pp Calnek, B.W Pathogenesis of Marek's Disease Virus Infection. In: Marek's Disease. K. Hirai (Ed.). Springer, Berlin. pp Calnek, B.W., H.K. Adldinger, and D.E. Kahn Feather follicle epithelium: a source of enveloped and infectious cell-free herpesvirus from Marek's disease. Avian Dis. 14: Davison, A.J Herpesvirus systematics. Vet. Microbiol. 143(1): Fauquet, C.M., M.A. Mayo, J. Maniloff, U. Desselberger and L.A. Ball Virus Taxonomy: Classification and Nomenclature of Viruses. Eighth report of the International Committee on the Taxonomy of Viruses. Elsiever Academic Press, San Diego. Gimeno, I.M Marek's disease vaccines: A solution for today but a worry for tomorrow? Vaccine 26: C31 C

7 Handberg, K.J., O.L. Nielsen and P.H. Jorgensen, The use of serotype 1 and serotype 3 specific polymerase chain reaction for the detection of Marek s disease virus in chickens. Avian Pathol. 30: Islam, A., B.F. Cheetham, T.J. Mahony, P.L.Young and S.W. Walkden-Brown Absolute quantitation of Marek s disease virus and herpesvirus of turkeys in chicken lymphocyte, feather tip and dust samples using real-time PCR. J. Virol. Methods. 132 p. Islam, A., B. Harrison, B.F. Cheetham, T.J. Mahony, P.L. Young and S.W. Walkden- Brown, Differential amplification and quantitation of Marek s disease viruses using real-time polymerase chain reaction. J. Virol. Methods. 119 p. Jurajda, V. and B. Klimes Presence and survival of Marek's disease agent in dust Avian Dis. 14: Kingham, B.F., V. Zelník, J. Kopáček, V. Majerčiak, E. Ney and C.J. Schmidt, The genome of herpesvirus of turkeys: comparative analysis with Marek s disease viruses. J. Gen. Virol. 82: Kung, H.-J., L. Xia, P. Brunovskis, D. Li, J.-L. Liu and L.F. Lee Meq: an MDV specific bzip transactivator with transforming properties. Curr. Top Micrbiol. Immunol. 255: MacLachlan, N.J. and E.J. Dubovi Fenner's Veterinary Virology. Academic Press, London. Miesfield, R.L Applied molecular genetics. A John Willey and Sons Inc., New York. Okada, K., Y. Fujimoto, T. Mikami and K. Yonehara The fine structure of Marek's disease virus and herpesvirus of turkey in cell culture. Jpn. J. Vet. Res. 20: Okazaki, W., H.G. Purchase and B.R. Burmester Protection against Marek's disease by vaccination with a herpesvirus of turkeys. Avian Dis. 14: Osterrieder, K. and J.F. Vautherot The Genome Content of Marek's Disease-like Viruses. In: Marek's Disease: An Envolving Problem. Davison, F. and V. Nair (Eds.). Elseiver Academic Press, London. pp Renz, K.G., A. Islam, B.F. Cheetham and S.W. Walkden-Brown Absolute quantification using real-time polymerase chain reaction of Marek s disease virus serotype 2 in field dust samples, feather tips and spleens. J. Virol. Methods. 135 p. Rispen, B.H., J. van Volten, N. Mastenbroek, H.J.L. Maas and K.A. Schat Control Marek s disease in The Netherlands. I. Isolation of an avirulent Marek s disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis. 16: Sharma, J.M Marek's Disease. In: A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 4 th Ed. Swayne, D.E., J.R. Glisson, M.W. Jackwood, J.E. Pearson and W.M. Reed (Eds.). American Association of Avian Pathologist Inc., Pennsylvania. pp Vegad, J.L A colour atlas of poultry disease: an aid to farmers and professionals. International Book Distributing Co., Charbagh. Witter, R.L Increased virulence of Marek's disease virus field isolates. Avian Dis. 41: Witter, R.L The changing landscape of Marek's disease. Avian Pathol. 27: S46 S53. DISCUSSION Question: How many viral copy is measured Answer: Not many samples due to lack of budget 401

Hartawan, Dharmayanti. Identification of mardivirus serotypes circulating in poultry farms in Sukabumi and Cianjur District

Hartawan, Dharmayanti. Identification of mardivirus serotypes circulating in poultry farms in Sukabumi and Cianjur District Identification of Mardivirus Serotypes Circulating in Poultry Farms in Sukabumi and Cianjur District, West Java, 2011 using Multiplex Polymerase Chain Reaction (mpcr) Approach Hartawan R, DharmayantI NLPI