Sequencing as a Typing Tool

Transcription

1 Sequencing as a Typing Tool 6/4/2018 RCPA Workshop Ms Leah Roberts PhD candidate University of Queensland

2 Outline Sequencing in response to outbreaks Sequencing to characterise complex regions Sequencing for epidemiological surveillance Sequencing for rapid response in the clinic

3 Enterobacter cloacae ConsMtutes normal gut flora Clinically significant opportunismc pathogen: Urinary tract infecmons SepMcemias Post- surgical peritonims Carbapenem- producing Enterobacteriaceae (CPE) increasingly isolated in nosocomial se9ngs

4 InvesMgate suspected CRE outbreak using whole genome sequencing 2015 May June July August November A Pathology Results: Enterobacter cloacae Carbapenemase IMP4 (PCR) Where did this infecmon come from? How similar are these isolates? What is the context of the IMP gene? Chromosome? Plasmid? Integron?

5 Sequencing - from isolates to finished report in 48h Isolates received & DNA extracted (4 hours) DNA libraries prepared (4 hours) Illumina NextSeq Sequencing (30 hours) Data analysis & ReporMng (8 hours) Slide adapted from Patrick Harris Highly dependent on: Clinic and lab infrastructure Sequencing facility Analysis team

6 A 10 isolates from 3 paments Patient 1: 2 isolates Patient 2: 4 isolates Patient 3: 4 isolates June/July August CTACGATCGATCGTACGTACG AAGCTGCTCGACTACGATCGAT Illumina Sequencing CTCGACTACGATCGATCGTACGTACG CGTACG AAGCTGCTCGACTACGATCGATCGTACGTACG AAGCTGCTCGACTTCGATCG CGATCGTACGTACG CTGCTCGACTTCGATCGATCGTACGTACG AAGCTGCTCGACTTCGATCGATCGT AAGCTGCTCGACTACGATCGATCGTACGTACG CORE

7 SNP comparison and core regions E. cloacae E. cloacae E. cloacae Large core genome Small number of SNPs = closely related

8 SNP comparison and core regions E. cloacae E. cloacae E. cloacae Small core genome Small number of SNPs =?? Choose a be^er reference Try a different tree method first Always keep in mind what the tree is being used for

9 A SNP analysis confirms outbreak Patient 1: 2 isolates Patient 2: 4 isolates Patient 3: 4 isolates June/July August Figure removed Persistent CPE in environment since at least 2013 Importance of data in the public domain

10 Finding anmbiomc resistance genes Can use assemblies or raw reads Gene 1 Gene 2 Gene 3 Gene 4 Hit Hit False posimve Pros: Quick tools available Cons: Requires compute power can give false posimves can report contaminants

11 Finding anmbiomc resistance genes Can use assemblies or raw reads Raw Illumina reads assemble BLASTn Drad assembly Gene 1 Gene 2 Gene 3 Gene 4 Hit Hit False posimve Pros: Very fast (once you have the assembly) tools available Easily stored and used on web servers Cons: Requires compute power for assembly Takes Mme to generate and QC assembly can report contaminants (if haven t QC d)

12 Finding anmbiomc resistance genes Always database dependent: ResFinder ARG- ANNOT CARD ncbi betalactamases Virulence factor database (VFDB) Plasmidfinder Manually curated databases

13 Was this outbreak associated with other local incidences of carbapenemase- producing E. cloacae? 2015 May June July August November A B C

14 Hospital A strains unrelated to surrounding cases of E. cloacae A B C IMP4 IncHI2 IMP4 IncHI2 IMP4 IncHI2 Figure removed IMP4 IMP4 IncHI2 IncHI2 IMP4 IncHI2 IMP4 IncHI2 E. coli IMP4 IncHI2 IncHI2 plasmid circulamng in South- East QLD carrying IMP4?

15 Plasmids and other horizontally acquired DNA Two types of transmission events to consider: DOI: /MA17047

16 Plasmids and other horizontally acquired DNA MGE transmission not always easy to invesmgate Ver1cal transmission: Looking for clonal spread Not interested in MGE Including recombinant regions, phage, genomic islands MGE transmission: Can help further deduce transmission Important elements, like anmbiomc resistance, usually on MGE BUT need a good reference /

17 IdenMfied widespread plasmid- mediated outbreak using Illumina and PacBio sequencing

18 Sequencing for epidemiological surveillance: IncHI2 plasmid widespread in E. cloacae isolates from South- East QLD Figure removed Sequenced all CPE between in South- East QLD Findings: Types of E. cloacae different, but same IncHI2 plasmid

19 IncHI2 plasmid from Sydney idenmcal Easyfig:

20 ConMnued surveillance using Oxford Nanopore MinION

21 Timeline Nanopore MinION: Total Mme ~19 hours DNA extracmon and QC Library prep sequencing assembly Analysis 2-3 hours 3 hours 12 hours (rapid 10 min) (2-48 hours) 1 hour 30 minutes Illumina NextSeq 150 bp PE: Total Mme ~42 hours DNA extracmon and QC Read Library prep sequencing Analysis handling 2-3 hours 5 hours (1.5 days full plate) 29 hours (high output) 26 hours (mid output) 2 hours 2-3 hours

22 Illumina confirms that E. cloacae strain is unrelated to ST90 outbreak Overall: Slides removed Fastest turn- around Mme Not always the most accurate Requires interpretamon by microbiologist Nanopore Minion good at detecmng species level, but difficult to then look at strain level or SNP differences If you provide enough context (eg. Other complete sequences of the same species), you can use the resulmng phylogeny to determine if your new strain clusters with previous strains of interest (eg. Outbreak strains). Always best to confirm with Illumina unml you become familiar enough with Nanopore minon and its limits

23 Outcomes Sequencing in response to outbreaks E. cloacae IMP- 4 outbreak Sequencing to characterise complex regions pms7884a IncHI2 plasmid carrying IMP- 4 Sequencing for epidemiological surveillance ConMnued surveillance in the hospital using Illumina sequencing Sequencing for rapid response in the clinic Rapid sequencing of IMP- 4 E. cloacae in response to urgent bacteremia

24 Clinical Outcomes Detailed reconstrucmon of strain relatedness and resistance genes Demonstrated how all three sequencing technologies can be used in clinical surveillance Sequencing Tradi1onal Methods Species SensiMvity tesmng PCR detecmon Can elucidate spread of mobile genemc elements AB resistance gene context As more data is generated can rapidly place new strains into context Genomic Context Mobile Elements

25 Acknowledgements UQ: Sco^ Beatson Mark Schembri Brian Forde ACE: Serene Low Nicola Angel UQCCR: David Paterson Patrick Harris Pathology QLD: Graeme Nimmo Narelle George Claire Heney Haakon Berg Elizabeth Catchpoole John McNamara Holly Sinclair Anna Hume Paul Chapman RBWH: Jeffrey Lipman Krispin Hajkowicz Marion Woods InfecMon Control Team LEAH beatsonlab.ecogenomic.org