Applied Microbiology and Biotechnology. Supplementary Material

Transcription

1 Applied Microbiology and Biotechnology Supplementary Material Biochemical characterization of a GH70 protein from Lactobacillus kunkeei DSM with two catalytic domains involving branching sucrase activity Xiangfeng Meng a, b, *, Joana Gangoiti b,1, Xiaofei Wang a, Pieter Grijpstra b, Sander S. van Leeuwen b, 1, Tjaard Pijning c, Lubbert Dijkhuizen b,2,* a State Key Laboratory of Microbial Technology, Shandong University, No. 72 Binhai Road, Qingdao, P.R. China b Microbial Physiology, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen,Nijenborgh 7, 9747 AG Groningen, The Netherlands c Biophysical Chemistry, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen,Nijenborgh 7, 9747 AG Groningen, The Netherlands 1 Current address: Laboratory Medicine, University Medical Center Groningen (UMCG), Hanzeplein 1, 9713 GZ, Groningen, The Netherlands 2 CarbExplore Research BV, Zernikepark 12, 9747 AN Groningen, The Netherlands * Correspondence to: Xiangfeng Meng at State Key Laboratory of Microbial Technology, Shandong University, No. 72 Binhai Road, Qingdao, P.R. China; x.meng@sdu.edu.cn Lubbert Dijkhuizen at CarbExplore Research BV, Zernikepark 12, 9747 AN Groningen, The Netherlands; l.dijkhuizen@rug.nl

2 Table S1 Detailed information of GH70 enzymes used in the phylogenetic analysis Enzyme Strains GenBank Polysaccharide GH70 glucansucrase Gtf1971 Lactobacillus animalis TMW CCK Dextran GtfKg3 Lactobacillus fermentum KG3 AAU Dextran Gtf33 Lactobacillus parabuchneri 33 AAU Dextran Gtf180 Lactobacillus reuteri 180 AAU Dextran GtfML1 Lactobacillus reuteri ML1 AAU Mutan GtfA Lactobacillus reuteri 121 AAU Reuteran GtfO Lactobacillus reuteri ATCC AAY Reuteran Gtf106A Lactobacillus reuteri TMW ABP Dextran GtfKg15 Lactobacillus sakei KG15 AAU Dextran DsrS Leuconostoc mesenteroides NRRL B-512F AAD Dextran DsrT Leuconostoc mesenteroides NRRL B-512F BAA Dextran Asr Leuconostoc mesenteroides NRRL B-1355 CAB Alternan DsrE-CD1 Leuconostoc mesenteroides NRRL B-1299 CAD Dextran Dsr-M Leuconostoc mesenteroides NRRL B-1299 CDX Dextran DsrBCB4 Leuconostoc mesenteroides NRRL B-1299CB4 ABF Dextran GtfS Streptococcus downei MFE 28 AAA Dextran GtfI Streptococcus downei MFE 28 AAC Mutan GtfD Streptococcus mutans UA159 AAN Dextran GtfB Streptococcus mutans UA159 AAN Mutan GtfC Streptococcus mutans UA159 AAN Mutan GtfR Streptococcus oralis ATCC10557 BAA Dextran Gtf-I Streptococcus sobrinus BAA Mutan DsrWC Weissella cibaria CMU ACK Dextran WcCab3-DSR Weissella confusa Cab3 AKE Dextran DsrC39-2 Weissella confusa LBAE C39-2 CCF Dextran GtfZ-CD1 Lactobacillus kunkeei DSM KRK GH70 Branching sucrase DsrE-CD2 Leuconostoc citreum NRRL B-1299 CAD (α1 2) Bsr-A Leuconostoc citreum NRRL B-1299 CDX (α1 2) Bsr-B Leuconostoc citreum NRRL B-742 CDX (α1 3) Bsr-C Leuconostoc fallax KCTC3537 WP_ (α1 3) Bsr-D Lactobacillus kunkeei EFB6 WP_ (α1 2) GtfZ-CD2 Lactobacillus kunkeei DSM KRK (α1 3) GH70 α-glucanotransferase GtfB Lactobacillus reuteri 121 AAU , 6-α-glucanotransferase GtfML4 Lactobacillus reuteri ML1 AAU , 6-α-glucanotransferase GtfW Lactobacillus reuteri DSM ABQ , 6-α-glucanotransferase 4, 3-α-glucanotransferase Lactobacillus fermentum NCC 2970 AOR , 3-α-glucanotransferase

3 Table S2 Primers used in the cloning of GtfZ of L. kunkeei Primer Application Sequence (5-3 ) GtfZ-full-F GtfZ-full-R Forward primer for cloning GtfZ full protein Reverse primer for cloning GtfZ full protein CAGGGACCCGGTGTGCAATCATATGAATCGGTTTC CGAGGAGAAGCCCGGTTAGTGATGGTGATGGTGATG TTTTTTCTTACTTTTCATAGAAGAG GtfZ-CDl-F Forward primer for cloning GtfZ-CD1 CAGGGACCCGGTAACAACACATACTATTATTTTGGAC GtfZ-CDl-1209-R GtfZ-CDl-1147-R Reverse primer for cloning GtfZ-CD1 truncated at 1209 in the C-terminal Reverse primer for cloning GtfZ-CD1 truncated at 1209 in the C-terminal CGAGGAGAAGCCCGGTTAGTGATGGTGATGGTGATGAATAAA ATCGTCTTTTACTTCAG CGAGGAGAAGCCCGGTTAGTGATGGTGATGGTGATGCAATAC AAAACTATTTTTATAAAG GtfZ-CD2-F Forward primer for cloning GtfZ-CD2 CAGGGACCCGGTGATGACAAAGAATATTATGCGGAC GtfZ-CD2-R Reverse primer for cloning GtfZ-CD1 CGAGGAGAAGCCCGGTTAGTGATGGTGATGGTGATGATCATC truncated at 2264 in the C-terminal AAAACTATTTCTATAAG *The underlined sequences represent the 5 extension of primers that facilitated the cloning of target genes in the pet15b-lic vector using Ligation Independent Cloning procedures.

4 Table S3 1 H and 13 C chemical shifts a (D 2 O, 298 K) of Glc residues present in oligosaccharides produced by incubation of 200 mm sucrose (oligosaccharides 1, 2, 3 and 4) or 100 mm sucrose plus 33.3 mm isomaltotriose (oligosaccharide 5 and 6), and branched dextran polysaccharide generated by incubation of 200 mm sucrose plus 20 g/l 70 kda dextran with the GtfZ-CD2 of L. kunkeei DSM Compound H-1 (a) C-1 H-1b H-2 C-2 H-3 C-3 H-4 C-4 H-5 C-5 H-6a C-6 H-6b 1 -(1 2, 6)-β-D-Fruf (f) D-Glcp-(1 2)-f (A) D-Glcp-(1 6)- (B) (1 5)-β-D-Frup (f) (1 3)- -D-Glcp-(1 5)-f (A) D-Glcp-(1 3)- (B) (1 2)-β-D-Fruf (f) (1 3)- -D-Glcp-(1 2)-f (A) D-Glcp-(1 3)- (B) (1 6)- -D-Glcp (R ) (1 6)- -D-Glcp (Rβ) (1 6)- -D-Glcp-(1 6)- (A)

5 (1 3)- -D-Glcp-(1 6)- (B) D-Glcp-(1 3)- (C) (1 6)- -D-Glcp (R ) (1 6)- -D-Glcp (Rβ) (1 3, 6)- -D-Glcp-(1 6)- (A) (1 3)- -D-Glcp-(1 6)- (B) D-Glcp-(1 3)- (C) D-Glcp-(1 3)- (D) GtfZ-CD2 polysaccharides -(1 6)- -D-Glcp-(1 6)- (A) (1 3, 6)- -D-Glcp-(1 6)- (B) D-Glcp-(1 3)- (C) a In ppm relative to the signal of internal acetone (δ for 1 H and δ for 13 C).

6 Fig. S1 Phylogenetic analysis of GtfZ-CD1 (amino acid residues ) and -CD2 (amino acid residues ) together with representative GH70 glucansucrase and branching sucrase enzymes, using GH70 GtfB-like α-glucanotransferases as the root. The phylogenetic analysis was performed by using the Maximum Likelihood method based on the JTT matrix-based model. The bar corresponds to a genetic distance of 0.20 substitutions per position (20% amino acid sequence difference). Each sequence is labelled with the enzyme name, the type of α-glucan polysaccharides (i.e. dextran, mutan, reuteran and alternan) synthesized, and its derived bacterial strain.

7 Fig. S2 SDS-PAGE analysis of the expression and purification of GtfZ-CD2 in E.coli BL21 Star (DE3). Lane M: protein molecular mass standards; lane 1: cell free extract; lane 2: pooled protein fractions after Ni-NTA affinity chromatography.

8 Fig. S3 Determination of optimum ph (a) and temperature (b) of GtfZ-CD2. The effects of ph on enzyme activity with 200 mm sucrose and 20 g/l 70 kda dextran were studied at 30 C using 5-20 µg/ml of purified enzyme in various buffers ranging from ph All buffers had a concentration of 50 mm and were supplemented with 1 mm CaCl 2. The buffers tested included sodium acetate (ph ) and MES (ph ). The optimum temperature was determined in sodium acetate buffer ph 5.5 at various temperatures ranging from 15 to 50 C. All activity assays were performed in triplicates.

9 Fig. S4 1D 1 H NMR spectra (300K) of oligosaccharides produced by incubation of 200 mm sucrose (oligosaccharides 1, 2, 3 and 4) or 100 mm sucrose plus 33.3 mm isomaltotriose (oligosaccharides 5 and 6) with the GtfZ-CD2 of L. kunkeei DSM

10 Fig. S5 500-MHz 1 H NMR spectrum, 2D 1 H- 1 H COSY spectrum and TOCSY spectrum (mixing time 150 ms) and 2D 13 C- 1 H HSQC spectrum of branched dextran polysaccharides produced by incubation of 200 mm sucrose plus 20 g/l 70 kda

11 dextran with GtfZ-CD2 of L. kunkeei DSM Signals of non-anomeric protons of different building blocks (A-C) in COSY and TOCSY spectra and cross peaks between proton and corresponding carbon in 13 C- 1 H HSQC were assigned based on the previously established structural-reporter-group for α-glucans (van Leeuwen SS et al., 2008a, b). The structural model and building blocks are indicated in the figure.

12 Fig. S6 1 H NMR analysis analysis (300K) of isolated polysaccharides produced by incubation of 200 mm sucrose and 20 g/l 10.2 kda dextran (a) or 260 kda dextran (b) with the GtfZ-CD2 of L. kunkeei DSM

13 References van Leeuwen SS, Kralj S, van Geel-Schutten IGH, Gerwig GJ, Dijkhuizen L, Kamerling JP (2008a) Structural analysis of the α-d-glucan (EPS180) produced by the Lactobacillus reuteri strain 180 glucansucrase GTF180 enzyme. Carbohydr Res 343(7): doi: /j.carres van Leeuwen SS, Leeflang BR, Gerwig GJ, Kamerling JP (2008b) Development of a 1 H NMR structural-reporter-group concept for the primary structural characterisation of α-d-glucans. Carbohydr Res 343(6): doi: /j.carres