Figure S1. Catecholamine, Thyroid Hormone and Insulin Concentrations, and Energy

Size: px

Start display at page:

Download "Figure S1. Catecholamine, Thyroid Hormone and Insulin Concentrations, and Energy"

Ross Jennings
6 years ago
Views:

1 Supplemental Information Cell Metabolism, Volume 14 Different Metabolic Responses of Human Brown Adipose Tissue to Activation by Cold and Insulin Janne Orava, Pirjo Nuutila, Martin E. Lidell, Vesa Oikonen, Tommi Noponen, Tapio Viljanen, Mika Scheinin, Markku Taittonen, Tarja Niemi, Sven Enerbäck, and Kirsi A. Virtanen Figure S1. Catecholamine, Thyroid Hormone and Insulin Concentrations, and Energy Expenditure Measured under Different Conditions (A) Concentrations of catecholamines in plasma. Results are expressed as means ± SD. 1

2 (B) Whole-body energy expenditure adjusted for fat-free mass. Results are expressed as means ± SD. (C) A decline in plasma TSH concentration in response to cold exposure when compared to basal values, which were measured in conjunction with the screening of subjects in a warm environment. Results are expressed as means ± SD. (D) Responses of free thyroid hormones to cold exposure in all subjects. Free plasma T3 was found to be slightly decreased among subjects with active BAT (marked with BAT+). Results are expressed as means ± SD. (E) A clear decrease in plasma insulin in response to continuous cold exposure. Results are expressed as means ± SD. *P < 0.05, **P < 0.01, ***P < and ****P <

3 Figure S2. Effects of Temperature Fluctuations in the Prescan Room and Cold-Water Bath on BAT Glucose Uptake during PET/CT Sessions (A and B) Variation in pre-scan room air temperature (A) or water-bath temperature (B) did not affect BAT glucose uptake during cold exposure. Pearson s correlation coefficients and respective two-tailed P values are shown. 3

4 Energy Expenditure During Cold Exposure Pearson s correlation coefficient P value (2-tailed) Plasma thyroid-stimulating hormone Free plasma thyroxine Free plasma triiodothyronine Plasma norepinephrine Plasma DHPG Plasma camp Plasma insulin BAT glucose uptake rate BAT perfusion Table S1. Correlation between Energy Expenditure and Other Parameters during Cold Exposure These results indicate that BAT perfusion is the parameter that shows the strongest association with energy expenditure during cold exposure. 4

5 Gene name Beta-actin GLUT1 GLUT4 INSR IRS1 IRS2 UCP1 Primer sequence GAGCTACGAGCTGCCTGACG GTAGTTTCGTGGATGCCACAG ACGCTGTCTTCTATTACTCCACGA GCCACGATGCTCAGATAGGAC CCGCTACCTCTACATCATCC TTCCGCTTCTCATCCTTCAG GCTGCCACCAGTACGTCATT CACCGAGTCGATGGTCTTCTC GAGGATTTAAGCGCCTATGCCA TGCATCGTACCATCTACTGATGAG CCAGCATTGACTTCTTGTCC GTTGGTGCCTCATCTAACAG CTGGAATAGCGGCGTGCTT AATAACACTGGACGTCGGGC Table S2. Primers Used for Quantitative Real-Time PCR 5

6 Supplemental Experimental Procedures Production of PET Tracers The isotope 15 O (physical half-life 123 s) was produced with a low-energy deuteron accelerator, Cyclone 3 (IBA Molecular). [ 15 O]H 2 O was synthesized in a continuously working water module (Hidex) using a diffusion membrane technique to trap radioactive water vapor into the sterile saline (Sipilä et al., 2001). [ 18 F]FDG (physical half-life 110 min) was synthesized with a computer-controlled apparatus in accordance with the standard manufacturing procedure of Turku PET Center (Hamacher et al., 1986). The radiochemical purity of [ 18 F]FDG exceeded 98 %. [ 18 F]FDG is a glucose analog that, unlike glucose, cannot be further metabolized by cells. After its uptake it becomes phosphorylated and thereby trapped in the cells (Sokoloff et al., 1977). By using [ 18 F]FDG, it is possible to study glucose uptake rate of tissue. Image Reconstruction The axial field-of-view (AFOV) of the PET/CT scanner used is divided into 47 transaxial planes with an axial interval of 3.27 mm. A low-dose CT image with the same axial interval was used for attenuation correction and as an anatomical reference for the definition of regions-of-interests (ROIs). Dynamic PET data were corrected for physical decay, dead time, scatter, and random coincidences. All PET images were reconstructed with a matrix size of 128x128 using the VUE point algorithm (GE Healthcare) with two iterations and 28 subsets. Vinci software was applied in the image analysis. For the estimation of BAT mass, additional parametric cold-exposure Ki images were calculated voxel-by-voxel to define the metabolic rate within regions of adipose tissue. These images were then fused with the CT images. Thereafter, the mass of active BAT was assessed manually. 6

7 Generation of Image-Derived-Input-Functions Image-derived-input-functions (IDIF) for [ 15 O]H 2 O and [ 18 F]FDG were generated by drawing multiple ROIs in the aortic arch in the time frame with the highest first-pass concentration of the tracer, after which arterial blood time-activity curves (TAC) were calculated for each ROI (Hoekstra et al., 1999). The TAC with high peak concentration and moderately low noise in the tail section was selected. In the case of input function of [ 18 F]FDG, ROIs were also drawn in the abdominal aorta in the second AFOV to create continuation for blood TAC. Because of the decent transaxial image resolution (approx. 8 mm) and large target size (diameter of thoracic and proximal abdominal aorta is over 20 mm), no recovery correction was necessary. In order to determine the plasma TAC of [ 18 F]FDG, rather than image-derived whole-blood TAC, an additional conversion taking account of the subject s hematocrit and continuing accumulation of [ 18 F]FDG into red blood cells was applied. The ratio of [ 18 F]FDG concentration in red blood cells to concentration in plasma was assumed to rise with a slope of /min (Phelps et al., 1979). In order to extend [ 18 F]FDG IDIFs to the third AFOV scan, IDIF TACs were extrapolated by fitting the line to the end-parts of the logarithm-transformed TACs. Because of the IDIF approach, no time delay corrections between blood sampling site and tissue of interest were needed. Indirect Calorimetry Whole-body energy expenditure (EE) was measured with an indirect calorimeter (Deltatrac II, Datex-Ohmeda) during the PET/CT sessions. In the data analysis, transient spikes due to irregular breathing which exceeded 1.5 x the standard deviation were excluded from the vo2, vco2, RQ, and EE signals. The recording failed during one cold PET/CT study. The EE values were normalized by adding residuals of the linear regression between the measured EE and fat-free mass to the mean EE value. The fat-free mass was measured using a bioimpedance-based method (Omron BF400, Omron Healthcare). 7

8 Oral Glucose Tolerance Test and Hyperinsulinemic Euglycemic Clamp A two-hour oral glucose tolerance test (OGTT) was performed after overnight fasting. The study subjects drank approx. 330 ml of liquid containing 75 g glucose. Venous blood samples for the determination of fasting glucose and insulin and glucose at 120 min were obtained. In the hyperinsulinemic euglycemic clamp, serum insulin was increased for approx. 160 min using a primed-continuous (1 mu kg -1 min -1 ) infusion of insulin (DeFronzo et al., 1979). Normoglycemia was maintained using a variable infusion rate of 20 % glucose, based on venous plasma glucose measurements. Whole-body insulin-stimulated glucose uptake (M value) was determined on a separate day or on the day of the insulin stimulation PET/CT study. Biochemical Analyses Plasma glucose was determined with a glucose oxidase method. Plasma insulin concentration was measured using the electrochemiluminescence immunoassay technique (ECLIA). ECLIA-based methods (Modular E170 automatic analyzer, Roche Diagnostics GmbH) were applied for the determination of plasma thyroid-stimulating hormone, free plasma thyroxine, and free plasma triiodothyronine concentrations. Concentration of plasma lactate was assessed photometrically. In order to assess the tonus of the sympathetic nervous system during PET/CT scanning, norepinephrine, dihydroxyphenylglycol (DHPG), and cyclic adenosine monophosphate (camp) were measured. The concentrations of norepinephrine and DHPG in EDTA plasma were determined with high performance liquid chromatography with coulometric electrochemical detection (Coulochem 5100A, ESA Inc.) (Scheinin et al., 1991). camp was measured with a commercial DELFIA assay kit (PerkinElmer DELFIA camp kit ). 8

9 Supplemental References DeFronzo R.A., Tobin J.D., and Andres R. (1979). Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am. J. Physiol. 237, E Hamacher K., Coenen H.H., and Stocklin G. (1986). Efficient stereospecific synthesis of no-carrieradded 2-[ 18 F]-fluoro-2-deoxy-D-glucose using aminopolyether supported nucleophilic substitution. J. Nucl. Med. 27, Hoekstra C.J., Hoekstra O.S., and Lammertsma A.A. (1999). On the use of image-derived input functions in oncological fluorine-18 fluorodeoxyglucose positron emission tomography studies. Eur. J. Nucl. Med. 26, Phelps M.E., Huang S.C., Hoffman E.J., Selin C., Sokoloff L., and Kuhl D.E. (1979). Tomographic measurement of local cerebral glucose metabolic rate in humans with (F-18)2-fluoro-2-deoxy-Dglucose: validation of method. Ann. Neurol. 6, Scheinin M., Karhuvaara S., Ojala-Karlsson P., Kallio A., and Koulu M. (1991). Plasma 3,4- dihydroxyphenylglycol (DHPG) and 3-methoxy-4-hydroxyphenylglycol (MHPG) are insensitive indicators of alpha2-adrenoceptor mediated regulation of norepinephrine release in healthy human volunteers. Life Sci. 49, Sipilä H.T., Clark J.C., Peltola O., and Teräs M. (2001). An automatic [O-15]H2O production system for heart and brain studies. J. Labelled Comp. Radiopharm. 44 (Suppl), S1066 S1068. Sokoloff L., Reivich M., Kennedy C., Des Rosiers M.H., Patlak C.S., Pettigrew K.D., Sakurada O., and Shinohara M. (1977). The [14C]-Deoxyglucose method for the measurement of local cerebral glucose utilization: theory, procedure and normal values in the conscious and anesthetized albino rats. J. Neurochem. 28,

Quantitation of Cerebral Glucose Utilization using the Arterial Input Function or the Standardized Uptake Value (SUV)

Quantitation of Cerebral Glucose Utilization using the Arterial Input Function or the Standardized Uptake Value (SUV) Brian R. Moyer BRMoyer & Associates, LLC, Amherst, NH 03031 http://www.brmassocllc-org.com/