Cone-Rod Degeneration with Sensorineural Hearing Loss

Size: px
Start display at page:

Download "Cone-Rod Degeneration with Sensorineural Hearing Loss"

Transcription

1 The American Journal of Human Genetics, Volume 99 Supplemental Data Bi-allelic Truncating Mutations in CEP78, Encoding Centrosomal Protein 78, Cause Cone-Rod Degeneration with Sensorineural Hearing Loss Prasanthi Namburi, Rinki Ratnapriya, Samer Khateb, Csilla H. Lazar, Yael Kinarty, Alexey Obolensky, Inbar Erdinest, Devorah Marks-Ohana, Eran Pras, Tamar Ben-Yosef, Hadas Newman, Menachem Gross, Anand Swaroop, Eyal Banin, and Dror Sharon

2 SUPPLEMENTAL NOTE: CASE REPORTS Clinical data were collected in two medical centers: Hadassah-Hebrew University Medical Center located in Jerusalem (families MOL0679, MOL0773, and MOL1310) and Tel Aviv Sourasky Medical Center (families TB279 and TB365). At Hadassah-Hebrew University Medical Center- International Society for Clinical Electrophysiology of Vision (ISCEV) standard full-field electroretinography (fferg) was performed using monopolar corneal electrodes (Henkes type; Medical Workshop B.V., Groningen, The Netherlands) and a computerized system (UTAS 3000; LKC, Gaithersburg, MD, USA). Cone responses to 30-Hz flashes of white light were acquired under a background light of 21 cd/m 2. Scotopic responses, including a rod response to a dim blue flash and a mixed cone rod response to a standard white flash, were acquired after minute of dark adaptation. Between 2 and 4 sets of responses were recorded in each condition for reproducibility. All ERG responses were filtered at 0.3 to 500 Hz, and signal averaging was applied. Color fundus photos were obtained using a Zeiss fundus camera (model FF450PLUS; Carl Zeiss Meditec, Dublin, CA, USA). Wide angle color and autofluorescence fundus photos were obtained using an OPTOS system (OPTOS, Dunfermline, Scotland, United Kingdom). At Tel Aviv Sourasky Medical Center ff-erg recordings were conducted according to an expanded protocol of the ISCEV ERG guidelines using an Espion Eᵌ Electrophysiology System (Diagnosys, Lowell, MA, USA) and bipolar Burian-Allen corneal electrodes (Hansen Ophthalmic Development Lab, Coralville, IA, USA). Light-adapted ERG responses were recorded under white background illumination of 30 cd/m 2, using white light stimuli of different energies covering about 3.3 log units ( cd-s/m 2 ) and 30 Hz flicker (3 cds/m 2 ). Following 20 minutes of dark adaptation, scotopically matched dim blue and bright red light stimuli were used to record isolated rod response and cone response. Then, a series of

3 increasing white light stimuli of energy covering 4.6 log units (0.005 to 200 cd-s/m 2 ) were used. Fundus photography was obtained with a fundus camera (FF450 plus fundus camera, ZEISS). Family MOL0679 includes two affected brothers (Figure 1A, III:1 and III:2). The index case (MOL0679 III:1) was known to have visual impairment since the age of 10, including photophobia, poor day vision and relatively preserved night vision. ERG recording performed at 37 years of age revealed nondetectable cone and reduced rod function (Table 1), leading to the clinical diagnosis of CRD. Interestingly, at age 44, peripheral Goldmann visual fields were preserved using the III4e and V4e targets. Visual acuity (VA) at ages 37 and 44 was 0.08 (earlier measurements are not available) and funduscopy at these ages showed mild macular retinal pigment epithelium (RPE) changes, ring of atrophy along the vascular arcades surrounding the macula, and subtle peripheral salt and pepper changes with no bone-spiculelike pigmentation (BSP) (Figure 2D-F; note relatively minimal changes on color images), with more prominent findings evident on fundus autofluorescence (FAF) imaging (Figure 2F). Optical coherence tomography (OCT) shows thinning of the ONL without edema (data not shown). Mild hearing loss appeared only at the age of 45 years. Tinnitus and occasional vertigo were also reported. Audiometry at the age of 47 years revealed mild SNHL at high frequencies, with a notch in the right ear at 3,000 Hz (Figure S1A). MRI and CT were normal. While we presume this hearing loss is associated with his disease, injury related to noise exposure or past head injury cannot be ruled out. His medical history is significant for diabetes mellitus diagnosed at the age of 35 years, hypertension and obesity. His brother (MOL0679 III:2) was found on a screening test to have hearing impairment at the age of 11 years, with SNHL at high frequencies. MRI at the age of 30 years was within normal limits. Began using hearing aids at the age of 38 years, and reported that the hearing level is relatively stable since. Audiometry at the age of 47 years revealed

4 bilateral down-slopping SNHL at middle and high frequencies (Figure S1B). Tinnitus and vertigo were not reported. Visual impairment was first noticed at age 15, with difficulty particularly under high levels of ambient light and good function at night. His VA at the age of 30 was 0.15, but he reported severe deterioration in his forties and at the age of 47 only light perception with partial projection was measured in BE. At the age of 33, photopic and scotopic ERG responses were nondetectable. At the age of 30 the fundus was reported as normal, and at age 47 small anterior capsular cataracts, hypermetropic optic discs, mild macular RPE changes and atrophy along the vascular arcades were apparent. The peripheral retina showed mild salt and pepper changes, without BSPs or overt pigmentary changes (Figure 2J-L). Changes on FAF imaging (Figure 2L) were more prominent than in his brother (Figure 2F). His general health is good, with hypercholesterolemia and benign prostatic hyperplasia (BHP). The four remaining affected individuals were isolate cases (Figure 1A): MOL0773 II:1 underwent repeated electroretinography (ERG) tests at ages 29, 33, 43, and 48 showing progressive loss of cone, followed by rod, photoreceptor function (Table 1). Her VA is very low (Table 1) and she suffered from photophobia and mild cataract with preserved night vision. Fundoscopic changes are minimal but changes can be seen by FAF (Figure 2M-O). She reported hearing impairment since the age of 42 years, without tinnitus or vertigo. Disequilibrium was reported by the affected individuals. Audiometry at 47 year showed bilateral flat curve (Figure S1C) indicating SNHL at low, medium, and high frequencies. Individual MOL1310 II:1 reported mild hearing loss and visual impairment since the age of 35 years. Visual symptoms included photophobia, difficulties in night vision, and constricted visual fields. Ocular examination revealed quite anterior segment with mild central posterior sub-capsular cataract in both eyes. Fundus examination showed atrophic

5 macular changes, very mild peripheral salt and pepper pigmentation with no BSPs, and attenuated blood vessels. Individual TB279 II:1 reported non-progressive hearing loss since the age of 20 years as well as tinnitus in the right ear. He underwent audiometry testing at the age of 48 years which showed bilateral down-slopping SNHL affecting the middle and high frequencies (Figure S1D). He is not using hearing aids. He reported central progressive visual loss and photophobia since age 30. At 47 years of age, he had nystagmus and BCVA of in both eyes. ERG responses were consistent with severe generalized cone-rod dysfunction, accompanied by an electronegative pattern (reduced b/a ratio) and a reduced Arden ratio on electrooculography (EOG) (Table 1). Funduscopy showed pale optic discs, epiretinal membranes (ERM) in both eyes with a lamellar hole in the right eye, and atrophic changes along the vascular arcades. FAF imaging revealed hypo-autofluorescence along the vascular arcades with a macular hyper-autofluorescent ring (Figure 2G-I). Individual TB365 II:1 reported hearing loss since the age of 10 years and had photophobia and progressive deterioration of central vision since age 28. Audiometry at the age of 39 years showed bilateral down-slopping SNHL affecting the middle and high frequencies (Figure S1E). He is using hearing aids. Tinnitus and dis-equilibrium were reported. ERG responses, recorded at 37 years of age, were consistent with generalized conerod dysfunction, accompanied by an electronegative pattern (Table 1). At the age of 38 years, his BCVA was 0.13 in the RE, and 0.1 in the LE. Funduscopy showed pale optic discs, mild macular RPE changes and subtle atrophic changes along the vascular arcades with no BSPs. FAF imaging revealed hypo-autofluorescence at the vascular arcades with a subtle macular hyper-autofluorescent ring (Figure 2A-C).

6 Figure S1- Audiometry of five individuals with bi-allelic CEP78 mutations. (A) MOL0679 III:1 (age 45 years), (B) MOL0679 III:2 (47 years), (C) MOL0773 II:1 (47 years), (D) TB279 II:1 (48 years), (E) TB365 II:1 (39 years).

7 Figure S2- Homozygosity mapping of MOL0679 III:2. Homozygosity mapping of MOL679 III:2 was performed using whole genome single nucleotide polymorphism (SNP) microarray (Affymetrix 6.0) and analyzed using the HomozygosityMapper server (Berlin, Germany [03/2016]): the x-axis represents the chromosome number and y-axis represents the threshold for the Homozygosity score as a ratio over the maximum score.

8 Figure S3- RT-PCR analysis of CEP78 in leukocytes. (A-B) RT-PCR products of different individuals using primers CEP78-CDS-E3F and CEP78- CDS-E5R (see Table S3) amplifying a 180 bp amplicon (exons 3 through 5) were run on an agarose gel in the following order: WT individuals (lanes 1 and 2), individuals who are homozygous for c.893-1g>a (lane 3- MOL0679 III:1; lane 4- MOL0679 III:2; lane 5- MOL0773 II:1), heterozygotes for c.893-1g>a (lane 6- MOL0773 III:2, lane 7- TB365 I:2), compound heterozygote (lane 8- TB365 II:1), heterozygous for c.534delt (lane 9- TB365 I:1), homozygous for c.534delt (lane 10- TB279 II:1), and a negative control (lane 11). M- represents a Kb marker. (C-D) RT-PCR of the same samples using primers PGM1- CDS-6&7F and PGM1-CDS-10R (see Table S3) of the housekeeping gene PGM1.

9 Figure S4- Semi-quantitative RT-PCR analysis of CEP78. (A-C) Expression level of CEP78 versus PGM1 (MIM: ) in different human tissues (Clontech; cat #636643, lot No A) using two sets of primers amplifying exons 6 through 9 and exons 14 through 16. Lane 1: bone marrow, 2: brain (whole), 3: fetal brain, 4: fetal liver, 5: heart, 6: kidney, 7: liver, 8: lung, 9: placenta, 10: prostate, 11: spleen, 12: thymus, 13: uterus, 14: small intestine, 15: spinal cord, 16: stomach, 17: retina, 18: negative control and M: kb DNA ladder. PGM1 servers as a housekeeping control. (D) A high resolution image of an agarose gel showing the presence of two different transcripts in the human retina (lane 1) and thymus (lane 3) using primers CEP78-CDS-E14-F and CEP78- CDS-E16-R. Lane 2 is a negative control. The upper band (438 bp) includes exon 15 and the lower band (390 bp) lacks this exon, as verified by Sanger sequencing. A faint intermediate band is evident due to heteroduplex PCR products including both transcripts. (E) Expression of Cep78 in the mouse retina and inner ear. Lane 1- mouse retina age E14, 2- mouse retina age P0, 3- mouse retina age P30, 4- mouse inner ear age P30, 5- negative control. Pgk1 servers as a housekeeping control.

10 Figure S5- CEP78 immunolocalization in the mouse retina using immunohistochemical (IHC) analysis. Low (A) and high (B)-magnification images (20X and 40X respectively) of control retina showing double staining with anti-cep78 (green) and anti-s-opsin (red) antibodies. Blue staining represents DAPI labeling. GCL- ganglion cell layer; IPL- inner plexiform layer; INL- inner nuclear layer; OPL- outer plexiform layer; ONL- outer nuclear layer; IS- inner segments of photoreceptors; OS- outer segments of photoreceptors; RPE- retinal pigment epithelium layer. Yellow bars show the scale (panel A- 100 m, panel B- 25 m).

11 Figure S6- Evolutionary analysis of CEP78. Schematic representation of the CEP78 is presented in the upper panels: a yellow box represents the Leucine-rich repeats (LRR) region, a gray box represents a coiled-coil domain. The exon boundaries are shown below. An amino acid sliding window (length of 30 amino acids) comparing the human protein sequence to selected orthologs (macaca, dog, mouse, chicken, frog and zebrafish) is shown. X-axis: amino acid number; Y-axis: percentage of the

12 mean amino acid identity in a 30 amino acid window. The lower left graph represents a summary of the data in mammalian sequences (red) versus all eight sequences (blue), with a cumulative sliding window analysis of data points that are above the average percentage of amino acid identity for each studied sequence (chimp 99%, macaca 97%, dog 87%, cow 86%, rat 77%, mouse 77%, chicken 62%, frog 57%, zebrafish 50%). Amino acid sequences of CEP78 orthologs were extracted from the Homologene database at NCBI and aligned using the phylogeny server (at Marseille, France [03/2016]) multiple alignment tool. (B) A phylogenetic tree of CEP78 using the neighbor joining procedure with the Drosophila willistoni Dwil\GK14449 sequence serving as an outgroup. (C) A comparison of amino acid identity levels (comparing the human protein sequence to its ortholog in each of the eight species) of 14 USH-associated proteins as well as all 55 known ARRP proteins. The results obtained for CEP78 are marked in red.

13 Table S1- A list of variants identified in the shared homozygous region on chromosome 9 in family MOL0679 Chromosome position Gene Name Gene region ANKRD20A4 exonic ANKRD20A4 exonic CBWD3 exonic MAMDC2 exonic TRPM3 exonic TRPM3 exonic C9orf57 exonic ANXA1 exonic PRUNE2 exonic PRUNE2 exonic PRUNE2 exonic PRUNE2 exonic Transcript #: cdna, protein variant name NM_ : c.1117c>g, p.(q373e) NM_ : c.2088a>t, p.(q696h) NM_ : c.840a>c, p.(e280d) NM_ : c.881g>a, p.(s294n) NM_ : c.5009g>a, p.(r1670q) NM_ : c.4023g>a, p.(s1341s) NM_ : c.204a>g, p.(k68k) NM_ : c.t198c:p.(i66i) NM_ : c.8058g>a, p.(l2686l) NM_ : c.5914a>g, p.(t1972a) NM_ : c.1632c>g, p.(t544t) NM_ : c.1575t>c, p.(s525s) MAF value SIFT score Polyphen2 score Mutation Taster score T B P 0 T B P T B P T B P D (LC) PD P NA NA P NA NA p NA NA p NA NA P T B P NA NA P 0.79 NA NA P

14 CEP78 splicing TLE1 exonic TLE1 exonic NM_ : c.893-1g>a, p.(d298vfs*17) NM_ : c.1689c>t, p.(t563t) NM_ : c.354a>g, p.(e118e) 0 NA NA NA NA NA P NA NA P MAF - minor allele frequency, NA not available D- deleterious, T- tolerated, D (LC)- deleterious with low confidence, PD- probably damaging, B- benign, P- polymorphism. Home pages: SIFT- Polyphen2- Mutationtasrer-

15 Table S2: SNP makers used for haplotype reconstruction SNP # Chr. 9 Position (bp) Alleles (major/m inor) MAF MOL 0679 III:1 MOL 0679 III:2 MOL 0773 II:1 MOL 1310 II:1 TB279 II:1 TB365 II:1 rs A/T 0 A/A A/A A/A A/A A/A A/A rs G/C C/C C/C G/G C/C G/G C/G rs T/C 0.06 C/C C/C T/T T/T C/C C/T rs C/T T/T T/T C/C C/C C/C C/T rs A/G G/G G/G G/G A/A A/A A/G rs A/G G/G G/G A/A A/A A/A A/G rs T/C C/C C/C T/T T/T T/T C/T rs C/T 0.31 C/C C/C T/T C/C C/C C/C rs C/T 0.33 C/C C/C C/C C/C C/C C/C rs A/C 0.37 A/A A/A A/A C/C C/C A/C rs C/T 0.42 T/T T/T T/T C/C C/C T/C rs C/G 0.46 C/C C/C C/C G/G G/G C/G rs G/T 0 T/T T/T T/T T/T T/T T/T rs A/C 0.35 A/A A/A A/A A/A A/A A/A c.534delt T/- 0 T/T T/T T/T -/- -/- -/T c.893-1g>a G/A 0 A/A A/A A/A G/G G/G A/G rs C/T T/T T/T T/T C/C C/C C/T rs A/G A/A A/A A/A G/G A/G A/G rs C/A 0.32 A/C A/A A/C C/C A/C A/C rs /TTT /TTT -/- -/TTT -/TTT -/TTT TTT/T TT rs G/A A/A A/A A/A A/A A/A A/A rs C/T C/T C/C C/T T/T T/T T/T rs T/C C/C C/T C/T C/C C/C C/C Chromosome positions are based on hg19 assembly of the human genome. MAF- minor allele frequency (based on ExAC). Shared homozygous regions are colored in light blue (for the c.893-1g>a haplotype) or pink (for the c.534delt haplotype).

16 Table S3: Primers sequences used in the current study Primer Name Region Species Oligonucleotide Sequence 5'-3' Product Size (bp) CEP78-E1-F GACTCAGCGTTCTTGGGTG Exon1 Human CEP78-E1-R AAAACCCACTTCGCCGC 376 CEP78-E2&3-F AAAGGACATGGCTCATTTCTATG Exon2 & 3 Human CEP78-E2&3-R AAGGTACAGACAGGAATTAACATGG 527 CEP78-E4-F TCAAGACTGACTAGGTTGTATATGCTC Exon4 Human CEP78-E4-R TCAAAATATTAACGTGTGGCAATC 231 CEP78-E5-F TGGTGTGTGTGTAAAGCTCTG Exon5 Human CEP78-E5-R CTTCGGACAACATTACTGTGC 368 CEP78-E6-F CGGAGATAGTGCCACTGC Exon6 Human CEP78-E6-R ACAAAAGTGTAAGATTAGGGAAGG 351 CEP78-E7-F GGGAATAGCCACTCATTGGG Exon7 Human CEP78-E7-R AGGCTGGGCAGTACAGTGAG 202 CEP78-E8-F GGTCCCAGAACTGCTGATTG Exon8 Human CEP78-E8-R GACCTCATAATATGCACGGAGTC 359 CEP78-E9-F CATGTGCCTATTCATCTGTAGACC Exon9 Human CEP78-E9-R CCAAAATAAAGAATTTTGAATCCC 265 CEP78-E10-F TTATTACCTAGTGTTAACTGGTGGTG Exon10 Human CEP78-E10-R ATCTTCCACCCTTCCCATTC 172 CEP78-E11-F CACTTCAGAAAGATCACTTTGATTAG Exon11 Human CEP78-E11-R GAATTCCCATGCAAGCTGTC 319 CEP78-E12-F TTCACTTCTGGCTCTGTCCC Exon12 Human CEP78-E12-R TGACCATTTGCAATACACTATATTTTC 309 CEP78-E13-F GATCCAGGTATGTATTTAAGCTGTTAG Exon13 Human CEP78-E13-R TACAGGTGCAAACCACCAAG 670 CEP78-E14-F GGTTTGGGGAAATGTAAGCTG Exon14 Human CEP78-E14-R AGATGCTTCTGGTCCCTGAG 364 CEP78-E15-F CTTGGCAACTGACGACTTGA Exon15 Human CEP78-E15-R CAGAATGTTCTAGTGGACTGGATTT 845 CEP78-E16-F Exon 16 Human GGGGTCCTTTCCAAGACTGA 444

17 CEP78-E16-R GTCAGTTGCCAAGACCAGTC CEP78-CDS-E3F Exon3 TTTGGTGCACCTGTCTCTTG Human CEP78-CDS-E5R Exon5 TCATGCCTTCTCATGGTCTG 180 CEP78-CDS-E6-F Exon6 CACCAATGAAGGAGCAAAGG Human CEP78-CDS-E9-R Exon9 CAGGTTTCTTTGTAGCCAATCC 290 CEP78-CDS-E14-F Exon14 CCACAATGGCTGGGATAGAT 390 Human CEP78-CDS- 16-R Exon 16 TGCTATTTCTGGACAACTCCTC 438 Cep78-CDS-E2-F Exon2 GCTTAAGTGTATCAGGGGTGCT Mouse Cep78-CDS-E5-R Exon5 CCTGGTCACCAATGAGTGTG 387 PGM1-CDS-6&7F Exon 6&7 TGGTGCTCTGGACCGGGTGG Human PGM1-CDS-10R Exon 10 GCACTCCCAGTGCCGCTCAG 516 Pgk1-E3F Exon3 GATCAAGGCTGCTGTTCCA Mouse Pgk1-E5R Exon 5 GCAGTCCCAAAAGCATCATT 390 Primer sequences are based on following accession numbers: CEP78- NM_ and NM_ , PGM1- NM_ , Cep78 - NM_ , Pgk1- NM_

18 Table S4: A list of genes used for Figure S6C Phenotype Gene Names Total arush ABHD12, CDH23, CEP250, CIB2, CLRN1, DFNB31, GPR98, 14 HARS, MYO7A, PCDH15, USH1C, USH1G, USH2A, PDZD7 arrp ABCA4, ARL6, ARL2BP, BBS1, BBS2, BEST1, C2orf71, C8orf37, CERKL, CLRN1, CNGA1, CNGB1, CRB1, CYP4V2, DHDDS, DHX38, EMC1, EYS, FAM161A, GPR125, HGSNAT, IDH3B, IFT140, IFT172, IMPG2, KIAA1549, KIZ, LRAT,MAK, MERTK, MVK,NEK2, NEUROD1, NR2E3, NRL, PDE6A, PDE6B, PDE6G, PRCD, PROM1, RBP3, RGR, RHO, RLBP1, RP1, RP1L1, RPE65, SAG, SLC7A14, SPATA7, TTC8, TULP1, USH2A, ZNF408, ZNF513 55

19 REFERENCES 1. Priya, R.R., Rajasimha, H.K., Brooks, M.J., and Swaroop, A. (2012). Exome sequencing: capture and sequencing of all human coding regions for disease gene discovery. Methods Mol Biol 884, Brooks, M.J., Rajasimha, H.K., and Swaroop, A. (2012). Retinal transcriptome profiling by directional next-generation sequencing using 100 ng of total RNA. Methods Mol Biol 884,

Phenotype Report. Num. Positions Not Called (Missing data) Num. Variants Assessed

Phenotype Report. Num. Positions Not Called (Missing data) Num. Variants Assessed Report Date: August 19, 2015 Software Annotation Version: 8 Report Name: NA12144 NW European Genome : NA12144_S1 Sequencing Provider: Illumina Sequencing Type: Exome : Retinitis Pigmentosa Description:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION A Homozygous Founder Missense Variant in Arylsulfatase G Abolishes its Enzymatic Activity Causing Atypical Usher Syndrome in Humans Short title: Arylsulfatase G Dysfunction Causes

More information

UKGTN Testing Criteria

UKGTN Testing Criteria UKGTN Testing Criteria Approved name and symbol of disease/condition(s): Retinal Degeneration panel test Approved name and symbol of gene(s): a panel of 105 genes, variants of which have been shown to

More information

Supplementary appendix

Supplementary appendix Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ellingford JM, Sergouniotis PI, Lennon R, et

More information

Variant prioritization

Variant prioritization Variant prioritization University of Cambridge Marta Bleda Latorre Cambridge, UK mb2033@cam.ac.uk 30th September 2014 Research Assistant at the Department of Medicine University of Cambridge Cambridge,

More information

Variant association and prioritization

Variant association and prioritization Variant association and prioritization Edinburgh Genomics Marta Bleda Latorre Edinburgh, UK mb2033@cam.ac.uk 23rd October 2015 Research Assistant at the Department of Medicine University of Cambridge Cambridge,

More information

Unravelling the genetic basis of simplex Retinitis Pigmentosa cases

Unravelling the genetic basis of simplex Retinitis Pigmentosa cases SUPPLEMENTARY INFORMATION Unravelling the genetic basis simplex Retinitis Pigmentosa cases Nereida Bravo-Gil 1,2#, María González-del Pozo 1,2#, Marta Martín-Sánchez 1, Cristina Méndez-Vidal 1,2, Enrique

More information

Genetic Defect Underlying Progressive Blindness Uncovered by Strand s Clinical Exome Test

Genetic Defect Underlying Progressive Blindness Uncovered by Strand s Clinical Exome Test CASE STUDY Genetic Defect Underlying Progressive Blindness Uncovered by Strand s Clinical Exome Test Patient Profile Swati Koparkar*, a 33-year-old owner of a handicrafts boutique had been experiencing

More information

한국인망막색소변성증환자에서발견한복합이형접합 EYS 변이 1 예보고

한국인망막색소변성증환자에서발견한복합이형접합 EYS 변이 1 예보고 편지 Lab Med Online Vol. 8, No. 2: 66-70, April 2018 진단유전학 한국인망막색소변성증환자에서발견한복합이형접합 EYS 변이 1 예보고 Identification of Compound Heterozygous EYS Variants in a Korean Patient with Retinitis Pigmentosa 김형태 1 장자현

More information

Fundus Autofluorescence. Jonathan A. Micieli, MD Valérie Biousse, MD

Fundus Autofluorescence. Jonathan A. Micieli, MD Valérie Biousse, MD Fundus Autofluorescence Jonathan A. Micieli, MD Valérie Biousse, MD The retinal pigment epithelium (RPE) has many important functions including phagocytosis of the photoreceptor outer segments Cone Rod

More information

Advances in assessing and managing vision impairment

Advances in assessing and managing vision impairment Advances in assessing and managing vision impairment John Grigg Associate Professor and Head Discipline of Ophthalmology Consultant Ophthalmologist Sydney Eye Hospital and The Children s Hospital at Westmead

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Ku CA, Hull S, Arno G, et al. Detailed clinical phenotype and molecular genetic findings in CLN3-associated isolated retinal degeneration. JAMA Ophthalmol. Published online

More information

Ganglion cell analysis by optical coherence tomography (OCT) Jonathan A. Micieli, MD Valérie Biousse, MD

Ganglion cell analysis by optical coherence tomography (OCT) Jonathan A. Micieli, MD Valérie Biousse, MD Ganglion cell analysis by optical coherence tomography (OCT) Jonathan A. Micieli, MD Valérie Biousse, MD Figure 1. Normal OCT of the macula (cross section through the line indicated on the fundus photo)

More information

Year 4 Results For a Phase 1 Trial of Voretigene Neparvovec in Biallelic RPE65- Mediated Inherited Retinal Disease

Year 4 Results For a Phase 1 Trial of Voretigene Neparvovec in Biallelic RPE65- Mediated Inherited Retinal Disease 8:00 AM Year 4 Results For a Phase 1 Trial of Voretigene Neparvovec in Biallelic RPE65- Mediated Inherited Retinal Disease Albert M. Maguire, MD OBJECTIVE Assess maintenance of functional vision/visual

More information

Retinal dystrophies, genomic applications in diagnosis and prospects for therapy

Retinal dystrophies, genomic applications in diagnosis and prospects for therapy Review Article Retinal dystrophies, genomic applications in diagnosis and prospects for therapy Benjamin M. Nash 1,2,3, Dale C. Wright 2,3, John R. Grigg 1, Bruce Bennetts 2,3, Robyn V. Jamieson 1,3 1

More information

Pearls, Pitfalls and Advances in Neuro-Ophthalmology

Pearls, Pitfalls and Advances in Neuro-Ophthalmology Pearls, Pitfalls and Advances in Neuro-Ophthalmology Nancy J. Newman, MD Emory University Atlanta, GA Consultant for Gensight Biologics, Santhera Data Safety Monitoring Board for Quark AION Study Medical-legal

More information

OCT Image Analysis System for Grading and Diagnosis of Retinal Diseases and its Integration in i-hospital

OCT Image Analysis System for Grading and Diagnosis of Retinal Diseases and its Integration in i-hospital Progress Report for1 st Quarter, May-July 2017 OCT Image Analysis System for Grading and Diagnosis of Retinal Diseases and its Integration in i-hospital Milestone 1: Designing Annotation tool extraction

More information

Clinical Trial Endpoints for Macular Diseases

Clinical Trial Endpoints for Macular Diseases Clinical Trial Endpoints for Macular Diseases Developed in collaboration Learning Objective Upon completion, participants should be able to: Summarize types of biomarkers of progression and treatment response

More information

Address City State Zip Phone. the hospital/facility:

Address City State Zip Phone. the hospital/facility: PATIENT INFORMATION (COMPLETE ONE FORM FOR EACH PERSON TESTED) Patient Last Name Patient First Name MI Date of Birth (MM / DD / YYYY) Address City State Zip Phone Patient discharged from Biological Sex:

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Choroideremia OMIM number for disease 303100 Disease alternative names please

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: 1. Disease/condition approved name and

More information

Basic Electrophysiology, the Electroretinogram (ERG) and the Electrooculogram (EOG) - Signal origins, recording methods and clinical applications

Basic Electrophysiology, the Electroretinogram (ERG) and the Electrooculogram (EOG) - Signal origins, recording methods and clinical applications Basic Electrophysiology, the Electroretinogram (ERG) and the Electrooculogram (EOG) - Signal origins, recording methods and clinical applications The body is a complex machine consisting of the central

More information

Cirrus TM HD-OCT. Details define your decisions

Cirrus TM HD-OCT. Details define your decisions Cirrus TM HD-OCT Details define your decisions 2 With high-definition OCT Carl Zeiss Meditec takes you beyond standard spectral domain Built on 10 years experience at the vanguard of innovation, Carl Zeiss

More information

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

More information

Optical Coherence Tomography: Pearls for the Anterior Segment Surgeon Basic Science Michael Stewart, M.D.

Optical Coherence Tomography: Pearls for the Anterior Segment Surgeon Basic Science Michael Stewart, M.D. Optical Coherence Tomography: Pearls for the Anterior Segment Surgeon Basic Science Michael Stewart, M.D. Disclosure OCT Optical Coherence Tomography No relevant financial relationships I will refer to

More information

Funduscopic Interpretation Understanding the Fundus: is that normal?

Funduscopic Interpretation Understanding the Fundus: is that normal? Funduscopic Interpretation Understanding the Fundus: is that normal? Gillian McLellan BVMS PhD DVOphthal DECVO DACVO MRCVS With thanks to Christine Heinrich and all who contributed images Fundus Retina

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative

More information

8/6/17. Disclosures Aerie Pharmaceuticals Alcon BioTissue Diopsys Optovue Shire

8/6/17. Disclosures Aerie Pharmaceuticals Alcon BioTissue Diopsys Optovue Shire Nathan Lighthizer, O.D., F.A.A.O. Associate Professor Assistant Dean for Clinical Care Director of Continuing Education Chief of Specialty Care Clinics Oklahoma College of Optometry Tahlequah, OK lighthiz@nsuok.edu

More information

Novel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas

Novel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas Novel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas Julius T. Oatts 1, Sarah Hull 2, Michel Michaelides 2, Gavin Arno 2, Andrew R. Webster 2*, Anthony T. Moore 1,2* 1. Department

More information

The Quick Guide to OCT Mastery 50 Real Cases with Expert Analysis

The Quick Guide to OCT Mastery 50 Real Cases with Expert Analysis OPTICAL COHERENCE TOMOGRAPHY The Quick Guide to OCT Mastery 50 Real Cases with Expert Analysis VOL 1 Sanjay Sharma, MD, FRCS, MSc (Epid), MBA Ophthalmologist, Epidemiologist Queen s University, Canada

More information

Yasser R. Serag, MD Tamer Wasfi, MD El- Saied El-Dessoukey, MD Magdi S. Moussa, MD Anselm Kampik, MD

Yasser R. Serag, MD Tamer Wasfi, MD El- Saied El-Dessoukey, MD Magdi S. Moussa, MD Anselm Kampik, MD Microperimetric Evaluation of Brilliant Blue G- assisted Internal Limiting Membrane Peeling By Yasser R. Serag, MD Tamer Wasfi, MD El- Saied El-Dessoukey, MD Magdi S. Moussa, MD Anselm Kampik, MD The internal

More information

Frequency & Amplitude Ranges for Bioelectric Signals

Frequency & Amplitude Ranges for Bioelectric Signals Frequency & Amplitude Ranges for Bioelectric Signals Signal Frequency range (Hz) Amplitude range(mv) ECG 0.01 300 0.05 3 EEG 0.1 100 0.001 1 EOG 0.1 10 0.001 0.3 EMG 50 3000 0.001 100 Electro-oculogram

More information

Kamron N Khan PhD, FRCOphth [1-3], Keren Carss [5], F. Lucy Raymond [5], Farrah Islam

Kamron N Khan PhD, FRCOphth [1-3], Keren Carss [5], F. Lucy Raymond [5], Farrah Islam Title: Vitamin A deficiency - there's more to it than meets the eye. Kamron N Khan PhD, FRCOphth [1-3], Keren Carss [5], F. Lucy Raymond [5], Farrah Islam FCPS, FRCS [2], Anthony T Moore FRCS, FRCOphth

More information

Next generation sequencing identified novel heterozygous nonsense mutation in CNGB1 gene associated with retinitis pigmentosa in a Chinese patient

Next generation sequencing identified novel heterozygous nonsense mutation in CNGB1 gene associated with retinitis pigmentosa in a Chinese patient /, 2017, Vol. 8, (No.51), pp: 88345-88350 Next generation sequencing identified novel heterozygous nonsense mutation in CNGB1 gene associated with retinitis pigmentosa in a Chinese patient Santasree Banerjee

More information

Cirrus TM HD-OCT. Details defi ne your decisions

Cirrus TM HD-OCT. Details defi ne your decisions Cirrus TM HD-OCT Details defi ne your decisions 2 With high-defi nition OCT Carl Zeiss Meditec takes you beyond standard spectral domain Built on 10 years experience at the vanguard of innovation, Carl

More information

Optical Coherence Tomograpic Features in Idiopathic Retinitis, Vasculitis, Aneurysms and Neuroretinitis (IRVAN)

Optical Coherence Tomograpic Features in Idiopathic Retinitis, Vasculitis, Aneurysms and Neuroretinitis (IRVAN) Columbia International Publishing Journal of Ophthalmic Research (2014) Research Article Optical Coherence Tomograpic Features in Idiopathic Retinitis, Vasculitis, Aneurysms and Neuroretinitis (IRVAN)

More information

From last week: The body is a complex electrical machine. Basic Electrophysiology, the Electroretinogram ( ERG ) and the Electrooculogram ( EOG )

From last week: The body is a complex electrical machine. Basic Electrophysiology, the Electroretinogram ( ERG ) and the Electrooculogram ( EOG ) From last week: Differential Amplification This diagram shows a low frequency signal from the patient that differs between the two inputs and is therefore amplified, with an interfering high frequency

More information

4/19/2018 FUNDUS AUTOFLUORESCENCE. Fluorescence Imaging. Fundus Autofluorescence (FAF) Fluorescence. Fluorescence

4/19/2018 FUNDUS AUTOFLUORESCENCE. Fluorescence Imaging. Fundus Autofluorescence (FAF) Fluorescence. Fluorescence I have no financial or proprietary interest in the subject matter of this presentation. FUNDUS AUTOFLUORESCENCE Timothy J. Bennett, CRA, OCT-C, FOPS Penn State Eye Center Hershey, PA Fluorescence Imaging

More information

Visual Physiology. Perception and Attention. Graham Hole. Problems confronting the visual system: Solutions: The primary visual pathways: The eye:

Visual Physiology. Perception and Attention. Graham Hole. Problems confronting the visual system: Solutions: The primary visual pathways: The eye: Problems confronting the visual system: Visual Physiology image contains a huge amount of information which must be processed quickly. image is dim, blurry and distorted. Light levels vary enormously.

More information

1.! Yes I do. 2.! No I don t. COPE Approved: COPE # PD! " !! What is electrodiagnostics testing? !! Visual Pathway Basic Understanding !!

1.! Yes I do. 2.! No I don t. COPE Approved: COPE # PD!  !! What is electrodiagnostics testing? !! Visual Pathway Basic Understanding !! 1.! Yes I do 2.! No I don t Nathan Lighthizer, O.D., F.A.A.O Assistant Professor, NSUOCO Chief of Specialty Care Clinics Chief of Electrodiagnostics Clinic COPE Approved: COPE # 3132-PD #$ #$! " 1.! Monthly

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Applying structure-function to solve clinical cases

Applying structure-function to solve clinical cases Applying structure-function to solve clinical cases Professor Michael Kalloniatis Centre for Eye Health, and, School of Optometry and Vision Science Acknowledgements Some material prepared by Nayuta Yoshioka

More information

CHAPTER IV RESULTS Microcephaly General description

CHAPTER IV RESULTS Microcephaly General description 47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified

More information

Assessing Photoreceptor Structure in Retinitis Pigmentosa and Usher Syndrome

Assessing Photoreceptor Structure in Retinitis Pigmentosa and Usher Syndrome Retina Assessing Photoreceptor Structure in Retinitis Pigmentosa and Usher Syndrome Lynn W. Sun, 1 Ryan D. Johnson, 1 Christopher S. Langlo, 2 Robert F. Cooper, 3 Moataz M. Razeen, 1,4 Madia C. Russillo,

More information

OCT Interpretation in Retinal Disease

OCT Interpretation in Retinal Disease OCT Interpretation in Retinal Disease Jay M. Haynie, OD, FAAO Financial Disclosure I have received honoraria or am on the advisory board for the following companies: Carl Zeiss Meditec Advanced Ocular

More information

Flore De Bats, 1 Benjamin Wolff, 2,3 Martine Mauget-Faÿsse, 2 Claire Scemama, 2 and Laurent Kodjikian Introduction

Flore De Bats, 1 Benjamin Wolff, 2,3 Martine Mauget-Faÿsse, 2 Claire Scemama, 2 and Laurent Kodjikian Introduction Case Reports in Medicine Volume 2013, Article ID 260237, 7 pages http://dx.doi.org/10.1155/2013/260237 Case Report B-Scan and En-Face Spectral-Domain Optical Coherence Tomography Imaging for the Diagnosis

More information

Electroretinographic abnormalities and advanced multiple sclerosis

Electroretinographic abnormalities and advanced multiple sclerosis Electroretinographic abnormalities and advanced multiple sclerosis James Pitzer Gills, Jr. Reduced electroretinographic responses were present in patients with advanced multiple sclerosis. The observed

More information

Non-arteritic anterior ischemic optic neuropathy (NAION) with segmental optic disc edema. Jonathan A. Micieli, MD Valérie Biousse, MD

Non-arteritic anterior ischemic optic neuropathy (NAION) with segmental optic disc edema. Jonathan A. Micieli, MD Valérie Biousse, MD Non-arteritic anterior ischemic optic neuropathy (NAION) with segmental optic disc edema Jonathan A. Micieli, MD Valérie Biousse, MD A 75 year old white woman lost vision in the inferior part of her visual

More information

Supplementary information Novel VCP modulators mi2gate major pathologies of rd10, a mouse model of re2ni2s pigmentosa

Supplementary information Novel VCP modulators mi2gate major pathologies of rd10, a mouse model of re2ni2s pigmentosa Supplementary information Novel VCP modulators mi2gate major pathologies of rd1, a mouse model of re2ni2s pigmentosa Hanako Ohashi Ikeda, Norio Sasaoka, Masaaki Koike, Noriko Nakano, Yuki Muraoka, Yoshinobu

More information

Optical Coherence Tomography in Diabetic Retinopathy. Mrs Samantha Mann Consultant Ophthalmologist Clinical Lead of SEL-DESP

Optical Coherence Tomography in Diabetic Retinopathy. Mrs Samantha Mann Consultant Ophthalmologist Clinical Lead of SEL-DESP Optical Coherence Tomography in Diabetic Retinopathy Mrs Samantha Mann Consultant Ophthalmologist Clinical Lead of SEL-DESP Content OCT imaging Retinal layers OCT features in Diabetes Some NON DR features

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Measuring of the fovea and foveola using line scans and 3D Macular scans obtained with spectral domain optical coherent tomography.

Measuring of the fovea and foveola using line scans and 3D Macular scans obtained with spectral domain optical coherent tomography. Measuring of the fovea and foveola using line scans and 3D Macular scans obtained with spectral domain optical coherent tomography. Vakhrameeva O.A. 1, Moiseenko G.A. 1, Maltsev D.S. 2, Sukhinin M.V. 2,

More information

Retina Conference. Janelle Fassbender, MD, PhD University of Louisville Department of Ophthalmology and Visual Sciences 09/04/2014

Retina Conference. Janelle Fassbender, MD, PhD University of Louisville Department of Ophthalmology and Visual Sciences 09/04/2014 Retina Conference Janelle Fassbender, MD, PhD University of Louisville Department of Ophthalmology and Visual Sciences 09/04/2014 Subjective CC/HPI: 64 year old Caucasian female referred by outside ophthalmologist

More information

Understanding how the ERG is generated helps immensely to interpret what it means.

Understanding how the ERG is generated helps immensely to interpret what it means. LECTURE 7 THE ELECTRORETINOGRAM (ERG) The electroretinogram is a field potential recorded from the cornea of the intact eye in response to light. It represents the total electrical activity of all the

More information

Génétique des DCP. Deciphering the molecular bases of ciliopathies. Estelle Escudier, INSERM U 681 Serge Amselem, INSERM U 654

Génétique des DCP. Deciphering the molecular bases of ciliopathies. Estelle Escudier, INSERM U 681 Serge Amselem, INSERM U 654 Génétique des DCP Estelle Escudier, INSERM U 681 Serge Amselem, INSERM U 654 Deciphering the molecular bases of ciliopathies Linkage analyses Candidate gene approaches Chromosome abnormalities Comparative

More information

Diagnosis in AMD. Managing your AMD Patients

Diagnosis in AMD. Managing your AMD Patients Managing your AMD Patients Robert W. Dunphy, O.D., F.A.A.O. Diagnosis in AMD Have suspicion Identify relative risk Conduct surveillance Biometry Utilize technology to facilitate detection of change / stability

More information

ZEISS AngioPlex OCT Angiography. Clinical Case Reports

ZEISS AngioPlex OCT Angiography. Clinical Case Reports Clinical Case Reports Proliferative Diabetic Retinopathy (PDR) Case Report 969 PROLIFERATIVE DIABETIC RETINOPATHY 1 1-year-old diabetic female presents for follow-up of proliferative diabetic retinopathy

More information

Course C21. Visual Electrophysiology in Children. 12 June, :15-17:45 hrs. Room 118/119 HAND-OUTS

Course C21. Visual Electrophysiology in Children. 12 June, :15-17:45 hrs. Room 118/119 HAND-OUTS Course C21 Visual Electrophysiology in Children 12 June, 2017 16:15-17:45 hrs Room 118/119 HAND-OUTS Introducing visual electrophysiology tests and results Ruth Hamilton - A description of paeditaric tests

More information

Electrodiagnostics Alphabet Soup

Electrodiagnostics Alphabet Soup Nathan Lighthizer, O.D., F.A.A.O Assistant Professor, NSUOCO Chief of Specialty Care Clinics Chief of Electrodiagnostics Clinic What is electrodiagnostics testing? Visual Pathway Basic Understanding VEP

More information

OCT Angiography in Primary Eye Care

OCT Angiography in Primary Eye Care OCT Angiography in Primary Eye Care An Image Interpretation Primer Julie Rodman, OD, MS, FAAO and Nadia Waheed, MD, MPH Table of Contents Diabetic Retinopathy 3-6 Choroidal Neovascularization 7-9 Central

More information

Usher Syndrome: When to Suspect it and How to Find It

Usher Syndrome: When to Suspect it and How to Find It Usher Syndrome: When to Suspect it and How to Find It Margaret Kenna, MD, MPH Katherine Lafferty, MS, CGC Heidi Rehm, PhD Anne Fulton, MD Harvard Medical School Harvard Medical School Center for Hereditary

More information

Vision Research 75 (2012) Contents lists available at SciVerse ScienceDirect. Vision Research. journal homepage:

Vision Research 75 (2012) Contents lists available at SciVerse ScienceDirect. Vision Research. journal homepage: Vision Research 75 (2012) 71 76 Contents lists available at SciVerse ScienceDirect Vision Research journal homepage: www.elsevier.com/locate/visres Combination of retinitis pigmentosa and hearing loss

More information

2/3/17. Visual System I. I. Eye, color space, adaptation II. Receptive fields and lateral inhibition III. Thalamus and primary visual cortex

2/3/17. Visual System I. I. Eye, color space, adaptation II. Receptive fields and lateral inhibition III. Thalamus and primary visual cortex 1 Visual System I I. Eye, color space, adaptation II. Receptive fields and lateral inhibition III. Thalamus and primary visual cortex 2 1 2/3/17 Window of the Soul 3 Information Flow: From Photoreceptors

More information

Evolving glaucoma management True diagnostic integration for the preservation of vision

Evolving glaucoma management True diagnostic integration for the preservation of vision Evolving glaucoma management True diagnostic integration for the preservation of vision // GLAUCOMA MANAGEMENT MADE BY ZEISS The moment you are certain it is glaucoma. This is the moment we work for. There

More information

!! INL!!!! ONL!! IS/OS!!

!! INL!!!! ONL!! IS/OS!! SUPPLEMENTARY FIGURES GCL INL ONL IS/OS RPE Choroid GR MR A B C HSD2 Cc RPE CV D Cc RPE CV E RPE Cc CV F RPE Cc CV Figure S1 Figure S1: Immunohistochemistry eidence for glucocorticoid receptor (GR), mineralocorticoid

More information

Fundus Autofluorescenceclinical applications

Fundus Autofluorescenceclinical applications Northwestern University Feinberg School of Medicine Fundus Autofluorescenceclinical applications Amani A. Fawzi, MD Associate Professor of Ophthalmology Northwestern University, Feinberg School of Medicine

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Voretigene Neparvovec-rzyl (Luxturna) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: voretigene_neparvovec_rzyl_luxturna 1/2018 N/A 6/2018 2/2018 Description

More information

Introduction to Full Field ERGs

Introduction to Full Field ERGs Introduction to Full Field ERGs ISCEV Full Field ERG Standard (Recording protocols and their physiological basis) Laura J. Frishman, PhD University of Houston October 17, 2016 Cellular origins and mechanisms

More information

Title: NLRP3 plays a protective role during the development of age related macular degeneration through the induction of IL-18 by drusen components.

Title: NLRP3 plays a protective role during the development of age related macular degeneration through the induction of IL-18 by drusen components. Title: NLRP3 plays a protective role during the development of age related macular degeneration through the induction of IL-18 by drusen components. Sarah L. Doyle 1*, Matthew Campbell 2*, Ema Ozaki 2,

More information

Autoimmune retinopathy associated with colonic adeno. The original publication is available at Instructions for use

Autoimmune retinopathy associated with colonic adeno. The original publication is available at  Instructions for use Title Autoimmune retinopathy associated with colonic adeno Author(s)Saito, Wataru; Kase, Satoru; Ohguro, Hiroshi; Ishida CitationGraefe's Archive for Clinical and Experimental Ophth Issue Date 2013-05

More information

The lowest level of stimulation that a person can detect. absolute threshold. Adapting one's current understandings to incorporate new information.

The lowest level of stimulation that a person can detect. absolute threshold. Adapting one's current understandings to incorporate new information. absolute threshold The lowest level of stimulation that a person can detect accommodation Adapting one's current understandings to incorporate new information. acuity Sharp perception or vision audition

More information

San Jose Mercury News Lisa Krieger

San Jose Mercury News Lisa Krieger San Jose Mercury News Lisa Krieger lkriger@mercurynews.com 650-793-0720 Human Positive Selection Human Positive Selection Loci Positive selection regions Mostly changes in expression. Only 35 affect protein

More information

Neural circuits PSY 310 Greg Francis. Lecture 05. Rods and cones

Neural circuits PSY 310 Greg Francis. Lecture 05. Rods and cones Neural circuits PSY 310 Greg Francis Lecture 05 Why do you need bright light to read? Rods and cones Photoreceptors are not evenly distributed across the retina 1 Rods and cones Cones are most dense in

More information

Advances in Drug Therapy for Usher Syndrome. Jennifer J. Lentz Usher Syndrome Family Conference July 11, 2015

Advances in Drug Therapy for Usher Syndrome. Jennifer J. Lentz Usher Syndrome Family Conference July 11, 2015 Advances in Drug Therapy for Usher Syndrome Jennifer J. Lentz Usher Syndrome Family Conference July 11, 2015 Ø Overall goal Ø Usher syndrome update and current hypotheses Ø New therapeuec approaches Ø

More information

The Visual System. Retinal Anatomy Dr. Casagrande February 2, Phone: Office: T2302 MCN

The Visual System. Retinal Anatomy Dr. Casagrande February 2, Phone: Office: T2302 MCN The Visual System Retinal Anatomy Dr. Casagrande February 2, 2004 Phone: 343-4538 Email: vivien.casagrande@mcmail.vanderbilt.edu Office: T2302 MCN Reading assignments and Good Web Sites Chapter 2 in Tovée,

More information

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Test of visual pathway function

Test of visual pathway function The visual system Test of visual pathway function Suppose you have a patient who may have some damage to the visual pathways leading to visual cortex, for example from multiple sclerosis. How could you

More information

Carlson (7e) PowerPoint Lecture Outline Chapter 6: Vision

Carlson (7e) PowerPoint Lecture Outline Chapter 6: Vision Carlson (7e) PowerPoint Lecture Outline Chapter 6: Vision This multimedia product and its contents are protected under copyright law. The following are prohibited by law: any public performance or display,

More information

8 NeuroMeeting Riparare il cervello: nuove frontiere terapeutiche. Napoli 12 e 13 Maggio La terapia genica. Francesca Simonelli

8 NeuroMeeting Riparare il cervello: nuove frontiere terapeutiche. Napoli 12 e 13 Maggio La terapia genica. Francesca Simonelli 8 NeuroMeeting Riparare il cervello: nuove frontiere terapeutiche Napoli 12 e 13 Maggio 2016 La terapia genica Francesca Simonelli Direttore clinica oculistica Seconda Universita degli Studi di Napoli

More information

LUXTURNA (voretigene neparovec-rzyl)

LUXTURNA (voretigene neparovec-rzyl) LUXTURNA (voretigene neparovec-rzyl) Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical

More information

Detection of Glaucoma and Diabetic Retinopathy from Fundus Images by Bloodvessel Segmentation

Detection of Glaucoma and Diabetic Retinopathy from Fundus Images by Bloodvessel Segmentation International Journal of Engineering and Advanced Technology (IJEAT) ISSN: 2249 8958, Volume-5, Issue-5, June 2016 Detection of Glaucoma and Diabetic Retinopathy from Fundus Images by Bloodvessel Segmentation

More information

THE EYE: RETINA AND GLOBE

THE EYE: RETINA AND GLOBE Neuroanatomy Suzanne Stensaas February 24, 2011, 10:00-12:00 p.m. Reading: Waxman Ch. 15. Your histology and gross anatomy books should be useful. Reading: Histology of the Eye from any histology book

More information

PRIMUS 200 from ZEISS The essential OCT

PRIMUS 200 from ZEISS The essential OCT PRIMUS 200 from ZEISS The essential OCT Seeing beyond the surface. ZEISS PRIMUS 200 // INNOVATION MADE BY ZEISS Clear Visualization. Advanced Technology. Reliability. Essential elements of your first OCT.

More information

NIH Public Access Author Manuscript Retin Cases Brief Rep. Author manuscript; available in PMC 2012 January 1.

NIH Public Access Author Manuscript Retin Cases Brief Rep. Author manuscript; available in PMC 2012 January 1. NIH Public Access Author Manuscript Published in final edited form as: Retin Cases Brief Rep. 2011 ; 5(1): 46 48. doi:10.1097/icb.0b013e3181cafc49. Intact Retinal Tissue and Retinal Pigment Epithelium

More information

Variable Retinal Phenotypes Caused by Mutations in the X-Linked Photopigment Gene Array METHODS

Variable Retinal Phenotypes Caused by Mutations in the X-Linked Photopigment Gene Array METHODS Biochemistry and Molecular Biology Variable Retinal Phenotypes Caused by Mutations in the X-Linked Photopigment Gene Array Liliana Mizrahi-Meissonnier, 1 Saul Merin, 1 Eyal Banin, 1,2 and Dror Sharon 1,2

More information

Vision I. Steven McLoon Department of Neuroscience University of Minnesota

Vision I. Steven McLoon Department of Neuroscience University of Minnesota Vision I Steven McLoon Department of Neuroscience University of Minnesota 1 Eye Cornea Sclera Conjunctiva 2 Eye The conjunctiva lines the inner surface of the eyelids and outer surface of the sclera. 3

More information

The Cellular Basis of Electroretinogram (ERG) Signals

The Cellular Basis of Electroretinogram (ERG) Signals The Cellular Basis of Electroretinogram (ERG) Signals Laura J. Frishman, PhD University of Houston October 19, 2015 Cellular origins and mechanisms of generation of the various waves of the ERG Sherry,

More information

R&M Solutions

R&M Solutions Mohamed Hosny El-Bradey, MD., Assistant Professor of Ophthalmology, Tanta University. Wael El Haig, MD., Professor of Ophthalmology. Zagazeeg University. 1 Myopic CNV is considered the most common vision

More information

Mark Dunbar: Disclosure

Mark Dunbar: Disclosure Important Things to Understand About OCT Mark T. Dunbar, O.D., F.A.A.O. Bascom Palmer Eye Institute University of Miami, School of Medicine Mark Dunbar: Disclosure Optometry Advisory Board for: Allergan

More information

The importance of electrophysiological and imaging methods in the diagnostics of inherited retinal degenerations: Genotype-phenotype correlations

The importance of electrophysiological and imaging methods in the diagnostics of inherited retinal degenerations: Genotype-phenotype correlations The importance of electrophysiological and imaging methods in the diagnostics of inherited retinal degenerations: Genotype-phenotype correlations PhD thesis Annamária Ditta Zobor MD Doctoral School of

More information

Psy393: Cognitive Neuroscience. Prof. Anderson Department of Psychology Week 3

Psy393: Cognitive Neuroscience. Prof. Anderson Department of Psychology Week 3 Psy393: Cognitive Neuroscience Prof. Anderson Department of Psychology Week 3 The Eye: Proof for the existence of God? And then there was light Optics Perception Absorption Eye is receiver not sender Plato

More information

International Journal of Basic and Applied Physiology

International Journal of Basic and Applied Physiology Multifocal Electroretinography in Assessment Of Diseases Of Posterior Pole Of Retina JagdeepKaur S. Dani*, Mitesh M. Sinha**, Archana H. Patel**, Anju B. Mehta ***, Geeta B. Nair**** *Associate Professor,

More information

Neuroscience - Problem Drill 13: The Eye and Visual Processing

Neuroscience - Problem Drill 13: The Eye and Visual Processing Neuroscience - Problem Drill 13: The Eye and Visual Processing Question No. 1 of 10 needed, (3) Pick the answer, and (4) Review the core concept tutorial as needed. 1. Which of the following statements

More information

Construction of the Visual Image

Construction of the Visual Image Construction of the Visual Image Anne L. van de Ven 8 Sept 2003 BioE 492/592 Sensory Neuroengineering Lecture 3 Visual Perception Light Photoreceptors Interneurons Visual Processing Ganglion Neurons Optic

More information

The Genetics of Usher Syndrome

The Genetics of Usher Syndrome The Genetics of Usher Syndrome Heidi L. Rehm, PhD, FACMG Assistant Professor of Pathology, BWH and HMS Director, Laboratory for Molecular Medicine, PCPGM DNA is Highly Compacted into Chromosomes The DNA

More information

Stargardt Disease Caused by a Rare Combination of Double Homozygous Mutations

Stargardt Disease Caused by a Rare Combination of Double Homozygous Mutations 386 CONTINUING MEDICAL EDUCatION :386-91 Stargardt Disease Caused by a Rare Combination of Double Homozygous Mutations Danielius Serapinas, Viltautė Obrikytė, Raimundas Sakalauskas Department of Pulmonology

More information

Biological Bases of Behavior. 6: Vision

Biological Bases of Behavior. 6: Vision Biological Bases of Behavior 6: Vision Sensory Systems The brain detects events in the external environment and directs the contractions of the muscles Afferent neurons carry sensory messages to brain

More information

7. Sharp perception or vision 8. The process of transferring genetic material from one cell to another by a plasmid or bacteriophage

7. Sharp perception or vision 8. The process of transferring genetic material from one cell to another by a plasmid or bacteriophage 1. A particular shade of a given color 2. How many wave peaks pass a certain point per given time 3. Process in which the sense organs' receptor cells are stimulated and relay initial information to higher

More information

CHAPTER 13 CLINICAL CASES INTRODUCTION

CHAPTER 13 CLINICAL CASES INTRODUCTION 2 CHAPTER 3 CLINICAL CASES INTRODUCTION The previous chapters of this book have systematically presented various aspects of visual field testing and is now put into a clinical context. In this chapter,

More information