Environmental and Genetic Factors Affecting on Semen Quality in Iranian Holstein Bulls

Transcription

1 Ghase and Ghorban Research Artcle Envronental and Genetc Factors Affectng on Seen Qualty n Iranan Holsten Bulls M.V. Ghase 1 and A. Ghorban 1* 1 Departent of Anal Scence, Shabestar Branch, Islac Azad Unversty, Shabestar, Iran Receved on: 27 Jan 2013 Revsed on: 29 Apr 2013 Accepted on: 1 May 2013 Onlne Publshed on: Mar 2014 *Correspondence E al: dr.ghorban@aushab.ac.r 2010 Copyrght by Islac Azad Unversty, Rasht Branch, Rasht, Iran Onlne verson s avalable on: The objectve of ths study was to evaluate the portance of envronental and genetc factors affectng seen qualty; sper volue (SV), sper concentraton (SPCO), total sper (TS), fresh sper otlty (FSM), total fresh otle sper (TFMS), post thaw sper otlty (PTSM), total post thaw otle sper (TPTMS), nuber of produced payout (NPP), nuber of fresh otle sper n each lt ejaculaton (NFMSE), otlty before and after the freezng (MBATF) and nuber of post thaw otle sper n each lt ejaculaton (NPTMSE). We used polyerase chan reacton restrcton fragent length polyorphs (PCR-RFLP) n 83 bulls belongng to two progeny test centers. The BB genotype was otted fro analyss. Season of collecton had a sgnfcant effect on sper volue (SV) (P<0.006), sper concentraton (SPCO) (P<0.0038), fresh sper otlty (FSM) (P<0.0001), post thaw sper otlty (PTSM) (P<0.001), total post thaw otle sper (TPTMS) (P<0.0075), nuber of produced payout (NPP) (P<0.0247), nuber of fresh otle sper n each lt ejaculaton (NFMSE) (P<0.0012) and otlty before and after the freezng (MBATF) (P<0.0001) but dd not sgnfcantly affect TS (P<0.438), total post thaw otle sper (TPTMS) (P<0.3606) and nuber of post thaw otle sper n each lt ejaculaton (NPTMSE) (P<0.1106). The nteracton of seasons wth follcle-stulatng horone and seen qualty trats only sgnfcantly affect sper volue (SV) (P<0.0435), sper concentraton (SPCO) (P<0.008) and nuber of produced payout (NPP) (P<0.0119). Genetcs and envronental factors clearly contrbute to seen producton n Holsten bulls. KEY WORDS envronental factor, genetc, Iranan Holsten bulls, seen qualty. INTRODUCTION FSH s a ptutary-expressed glycoproten horone that regulates gonadal functon n both sexes n aals (Moyle and Capbell, 1996). In feales, the role of FSH n regulatng follcular developent and sex sterod producton s clear and well understood, and FSH s routnely used for the treatent of feale nfertlty (Howles, 2000; Mc Gee and Hsueh, 2000). In contrast, the role of FSH n ales n regulatng testcular functon and speratogeness contnues to be debated (Moudgal and Sara, 1998; Plant and Marshall, 2001). FSH s coposed of a-subunt shared wth other glycoproten horones and a specfc b-subunt encoded by the FSHB gene. Artfcal nsenaton (AI) s a powerful botechnology that allows producers to use superor sres, prootng faster genetc proveent and ncreasng proftablty. The concepton rate wth AI depends on the characterstcs of the seen provded by AI centers: AI organzatons try to collect the axu aount of speratozoa of the hghest possble qualty at the lowest cost. Speratozoa are cryopreserved n straws, and each straw contans suffcent sper for one AI. A reducton of Iranan Journal of Appled Anal Scence (2014) 4(1),

2 Factors Affectng on Seen Qualty of Holsten Bulls sper concentraton n an AI dose would ncrease the nuber of straws produced fro an ejaculate but could also reduce the concepton rate of nsenated cows (Shannon and Vshwanath, 1995). Therefore, the nuber of otle speratozoa per straw s chosen to balance concepton rate and nuber of straws produced. The nuber of straws produced per ejaculate then depends on the volue of the ejaculate, the concentraton of speratozoa n the ejaculate, and the percentage of speratozoa that are otle. The quantty and qualty of seen produced by AI bulls are affected by envronent, anageent, physologcal status, and genetcs. The age of the bull at seen collecton affects the volue of the ejaculate, ts concentraton, and sper otlty. In general, the lterature shows that all of these ejaculate characterstcs ncrease as bull's age (Alqust et al. 1976; Fuente et al. 1984). Most studes found evdence that season of collecton sgnfcantly affects seen producton (Graffer et al. 1988; Stalhaar et al. 1988). Accordng to (Schwab et al. 1987) the hghest volue of seen, sper concentraton, and nuber of speratozoa per ejaculate are produced n wnter. Cattle reproducton can be affected by heat stress; under hgh abent teperature and/or hudty, body theroregulatory echanss are unable to ncrease body heat loss and nternal teperature ncreases above physologcal lts (Cheneau, 1994). Heat stress can decrease concepton rates and ncrease ebryonc ortalty n cows (Wolfenson et al. 2000) and decrease seen qualty n bulls (Johnston et al. 1963; Sknner and Louw, 1966). In the tropcs, sper producton and seen qualty decrease durng the hot season (Igboel and Rakha, 1971; Felds et al. 1979; Ku Daka et al. 1981; Rekwot et al. 1987) however, seasonal varatons cannot be attrbuted only to greater abent teperature. The present study was conducted to deterne envronental and genotype effects on seen qualty n Holsten bulls AI n Iran. 34 MATERIALS AND METHODS Anals 83 bulls of the North West AI center (Tabrz, Iran) and Progeny Test center of Jahed Co (Karaj, Iran), were ncluded n the study. For each bull the repeated easureents of sper qualty trats of bulls were avalable snce 1991 to 2008 (41890 records). Genotypng Blood and seen saples were collected fro the bulls. An antcoagulant (EDTA) was added to the blood saples and then stored at -20 C. Genoc DNA fro whole blood was purfed by standard protocol usng protenase K dgeston as descrbed by (Falconer et al. 1996) and fro seen by DNA extracton kt (DNPTM kt Cnnagen Co. Tehran, Iran). The qualty of the DNA was checked on 0.5% agarose gel and the quantty was easured by UV spectrophotoetry at A260 / A280 n. Genotypng for FSHβ polyorphs was deterned by polyerase chan reactonrestrcton fragent length polyorphs (PCR-RFLP) ethod. The PCR reacton condtons were approxately 100 ng of genoc DNA, 10 pol of each prer, 0.2 M of each dntp, 1.5 M of MgCl2, 1 PCR buffer [50 M of KCl and Trs-HCl (ph 8.4)] and 0.4 U of Taq polyerase n a total volue of 25 μl. The PCR was conducted on Eppendorf Gradant theral cycler, Hot Master Mx (EPPENDORF, Gerany) usng a prelnary denaturaton at 94 C for 1.5 n, 62 C for 1 n and 72 C for 1 n, followed by 48 cycles of a specfc teperature rege. Each teperature rege conssted of 94 C for 30 s, 62 C for 1 n, 72 C for 30 s and a fnal extenson at 72 C for 5 n. A 313 bp fragent of FSHB consstng part of ntron 2 and coplete codng regon of exon 3, was aplfed usng forward (5`CTTCCAGACTACTGTAACTCATC3`) and reverse (5GTAGGCAGCTCAAAGCATCCG`3`) prers (Da et al. 2009). PCR products were dgested wth 4 U of PST-I, usng the suppled buffer and antaned at 37 C for1 h. The resultng fragents were separated by vertcal electrophoress (110 W 40 n) n 3% agarose gel, staned wth ethdu brode and was vsualzed under UV lght. The A (PST-I) allele had fragent szes of 111, 202 bp, whereas the B (PST-I) allele had fragents of 111, 202 and 313 bp. Statstcal analyss Genotype frequences The FSHβ allele frequences were calculated by sple allele countng (Falconer et al. 1996). The possble devatons of allele and genotype frequences fro the Hardy- Wenberg equlbru were exaned wth PopGene.S2 software by a Pearson s Ch-square test Assocaton analyss Statstcal analyss was perfored usng the MIXED procedure of SAS software (SAS, 1999). The followng lnear odel was used to exane the assocatons between FSHβ-PSTI, polyorphss and SV, SPCO, TS, FSM, TFMS, PTSM, TPTMS, NPP, NPTMSE, MBATF and NFMSE trats: y jkl a YS S G Where: y jkl : the above trats. µ: the overall trat ean. a : the rando effect of the th anal. j k b x Iranan Journal of Appled Anal Scence (2014) 4(1), l jkl

3 Ghase and Ghorban YS j : the fxed effect of the j th year-season (j=1-68). S k : the fxed effect of the k th staton (k=1-2). G l : the fxed effect of the l th FSH genotype (l=1-3). b : the regresson coeffcent of th covarable (e.g. age). x : the fxed effect of th covarable. jkl : the resdual error. FSM and PTSM trats were categorcal varable, hence analyzed wth logstc regresson and GENMOD procedure by usng the followng odel: η jkl : MAF and MBF trats. : the overall ean n logarthc scale. a : the rando effect of the th anal. YS j : the fxed effect of the j th year season (j=1-68). S k : the fxed effect of the k th staton (k=1-2). G l : the fxed effect of the l th FSH genotype (l=1-3). b : the regresson coeffcent of th covarable (e.g. age). x : the fxed effect of th covarable. : the resdual error. jkl p /( p a YS S G b x log 1 ) kl RESULTS AND DISCUSSION Season of collecton Least square eans of sper qualty trats for Season of collecton are presented n Table 1. Analyss of varance ndcated sgnfcant assocaton wth season of collecton SV (P<0.006), SPCO (P<0.0038), FSM (P<0.0001), PTSM (P<0.001), TPTMS (P<0.0075), NPS (P<0.0247), (P<0.0012) and MBATF (P<0.0001) but dd not sgnfcantly affect TS (P<0.438), TFMS (P<0.3606) and NPTM- SE (P<0.1106). Moreover age had sgnfcant effects on SPCO, TS, FSM, NPTMSE and TPTMS trats (P<0.0001). The results show SPCO, FSM, NFMSE and PTSM trats generally hgher durng wnter than durng suer, fall and sprng and TPTMS, NPTMSE n fall and wnter, and TS and TFMS n fall and SV and MBATF n suer and NPS n sprng were hgher. j k l jkl Our fndngs agree wth those of (Sarder, 2007; Asat, 2002; Mathevon et al. 1998; Everett et al. 1978; Schwab et al. 1987; Everett and Bean, 1982) who found the sper concentraton generally hgher durng wnter than durng sprng, suer and fall. But other researchers found poorer results n sprng and wnter (Ancheta et al. 2005; Mostar et al. 2005; L junje et al. 2001; Fawzy and Rabe 1996; Shannon and Vshwanath, 1995; Usan et al. 1993; Rustenev, 1989; Zafar et al. 1988; Fuente et al. 1984). Usan et al. (1993) reported that seasonal stress had no effect on the nuber of ejaculates n crossbred (Fresan Sahwal) bulls. Javed et al. (2000) noted lowest ejaculate volue n hud suer n Nl Rav buffalo bulls and (Fonseca, 1995; Mathevon et al. (1998) reported that season had no effect on ejaculate volue for Nellore and Holsten bulls, respectvely. Soe studes reported three genotypes for FSHβ gene AB (111, 202 and 313 bp), AA (111 and 202 bp). The allele was ore frequent than B allele (0.675 vs ) and therefore ost of the bulls (65%) were heterozygous for the B allele and only 35% were hoozygous and BB genotype was not found. However reported that genotypng of FSHβ gene sgnfcantly effects on TS (P<0.0425), FSM (P<0.0001) and NPP (P<0.0302) but there was no sgnfcant assocaton wth SV, SPCO, NFMSE, TFMS, PTSM, NPTMSE, TPTMS and MBATF (P>0.05). Season can nclude any factors, such as teperature, photoperod, hudty, feed qualty and housng. Dfferences n the quantty of feed (Stalhaar et al. 1989) or n feed coposton (Sratsk, 1990) could also affect seen output. Excessve hudty durng a specfc season could also reduce producton of seen. Indeed, seen output reportedly ncreased below 50% hudty (Castllo et al. 1987). Everett and Bean (1982) reported that an abent teperature between -15 and 20 F had no practcal effect on seen producton. The nteracton of seasons wth follcle-stulatng horone n seen qualty trats Least square eans of sper qualty trats for the nteracton of seasons wth follcle stulatng horone n seen qualty trats are presented n Table 2. Table 1 Least squares eans (±SD) of sper qualty and trats for Season of collectonn Iranan Holsten bulls Trat Sprng Suer Fall Wnter SEM P-value Sper volue (L) 4.27 a 4.28 a 4.16 a 3.87 a Sper concentraton a b b ab Total sper Fresh sper otlty a b a a Nuber of fresh otle sper n each lt ejaculaton b b ab a Total fresh otle sper Post thaw sper otlty a b a a Nuber of post thaw otle sper n each lt ejaculaton Total post thaw otle sper ab b a a Motlty before and after the freezng porton 1.76 c 1.96 a 1.84 bc 1.84 bc Nuber of produced straw a b ab ab The eans wthn the sae row wth at least one coon letter, do not have sgnfcant dfference (P>0.05). SEM: standard error of the eans. 35 Iranan Journal of Appled Anal Scence (2014) 4(1), 33-37

4 Factors Affectng on Seen Qualty of Holsten Bulls Table 2 Least squares eans (±SD) the nteracton of seasons wth follcle stulatng horone n seen qualty trats Trat Sprng Suer Fall Wnter AA AB AA AB AA AB AA AB SEM P-value Sper volue (L) 3.8 ab 4.7 a 3.8 ab 4.7 a 3.5 b 4.7 a 3.1 b 4.6a Sper concentraton b a c ab a ab a a Total sper Fresh sper otlty Nuber of fresh otle sper n each lt ejaculaton b b b b a b a b Total fresh otle sper Post thaw sper otlty Nuber of post thaw otle sper n each lt ejaculaton Total post thaw otle sper Motlty before and after the freezng porton Nuber of produced straw b ab b ab a a a a The eans wthn the sae row wth at least one coon letter, do not have sgnfcant dfference (P>0.05). SEM: standard error of the eans. Analyss of varance ndcated season of collecton wth follcle stulatng horone gene only sgnfcantly affects SV (P<0.0435), SPCO (P<0.008), NFMSE (0.0117) and NPS (P<0.0119) but does not sgnfcantly affect TS, FSM, TFMS, PTSM, TPTMS, NPTMSE, MBATF trats. Coparson of the characterstc sper volue, sper concentraton, total fresh otle sper, total sper, and otlty before and after the freezng and fresh sper otlty showed that the genotype AB n sprng was hgher than the AA genotype but n suer, fall and wnter AA genotypes was hgher than AB genotype. For nuber of fresh otle sper n each lt ejaculaton trats AB genotype was hgher than AA genotype but n sprng, fall and wnter AA genotype hgher than AB genotype and for the post thaw sper otlty, nuber of post thaw otle sper n each lt ejaculaton and for total post thaw otle sper trats AA genotype hgher than AB genotype. For the nuber of produced straw trat n sprng and wnter AB genotype was hgher than AA genotype but n fall and suer AA genotype was hgher. CONCLUSION In concluson, the results of the present study showed that ncludng season can affect reproducton trats n far anals. Ths effect ay be due to changes n the concentratons of reproductve horones n anals n response to envronental condtons. The use of olecular genetcs wth favorable envronental condtons for each genotype can lead to successful breedng process. ACKNOWLEDGEMENT The authors gratefully thank the Islac Azad Unversty Shabestar Branch for fnancal support. REFERENCES Alqust J.O., Branas R.J. and Barber K.A. (1976). Postpubertal changes n seen producton of Charolas bulls ejaculated at hgh frequency and the relaton between testcular easureents and sper output. J. An. Sc. 42, Ancheta M.C., Flho V.R., Coloso E., Sapao I.B.M. and Andrade V.J. (2005). Seen dscarded and freezng ablty of Zebu and European bulls fro a Brazlan artfcal nsenaton centre. Arq. Bras. Med. Vet. Zootec. 57, Asat M.T. (2002). Studes on factors affectng the seen qualty of Sahwal bulls. MS Thess. Vet. An. Sc. Unv., Lahore, Pakstan. Castllo E., Tzol G., Alvarez J.L., Perez M. and Baez R. (1987). Reducton of the proten concentrate level n the raton for Holsten sres 1. Effect on seen qualty. Cuban J. Agrc. Sc. 21, Cheneau P. (1994). Medoabente y reproducton anal. Rev. Mund. Zootech. 77, Da L., Zhao Z., Zhao R. and Xao S. (2009). Effects of novel sngle nucleotde polyorphss of the FSH beta-subunt gene on seen qualty and fertlty n bulls. An. Reprod. Sc. 114, Everett R.W. and Bean B. (1982). Envronental nfluences on seen output. J. Dary Sc. 65, Everett R.W., Bean B. and Foote R.H. (1978). Sources of varaton of seen output. J. Dary Sc. 61, Falconer D.S. and Mackay T.F.C. (1996). Introducton to Quanttatve Genetcs. Longan Group Ltd, Essex, England. Fawzy S.A. and Rabe Z.B.H. (1996). Effect of solar radaton on body reacton and seen characterstcs of young Fresan bulls. Ann. Agrc. Sc. 34, Felds M.J., Burns W.C. and Warnck A.C. (1979). Age, season and breed effects on testcular volue and seen trats n young beef bulls. J. An. Sc. 48, Fonseca V.O. (1995). Seasonal effects on seen characterstcs and scrotal crcuference n Nelore bulls n Brazl. Brazl Reprod. An. 17, Fuente L.F., Sanchez Garca L. and Vallejo M. (1984). Reproduc 36 Iranan Journal of Appled Anal Scence (2014) 4(1), 33-37

5 Ghase and Ghorban tve characters n Galcan Blonds. I. Characters of seen used Rekwot P.I., Voh Jr., Oyedpe E.O., Opaluwa G.I., Sekon V.O. for artfcal nsenaton. Anal. Fac. Vet. Leon. 30, and Dawuda P.M. (1987). Influence of season on characterstcs of the ejaculate fro bulls n an artfcal nsenaton Graffer T., Solbu H. and Flseth O. (1988). Seen producton n artfcal nsenaton bulls n Norway. Therogenology. 30, center n Ngera. An. Reprod. Sc. 14, Rustenev A.P. (1989). Reproductve ablty and qualty of progeny Howles C.M. (2000). Role of LH and FSH n ovaran functon. Mol. Cell. Endocrnol. 161, Igboel G. and Raka A.M. (1971). Seasonal changes n the ejaculate characterstcs of Angon (short horn zebu) bulls. J. An. Sc. 33, Javed M.T., Khan A. and Kausar R. (2000). Effect of age and season on soe seen paraeters of Nl-Rav buffalo (Bubalus bubals) bulls. Vet. Arch. 70, Johnston J.E., Naelapaa H. and Frye J.B. (1963). Physologcal responses of Holsten, Brown Swss and Red Sndh crossbreed bulls exposed to hgh teperatures and hudty. J An. Sc. 22, Ku Daka J., Nagaratna V. and Rwuaan J.S. (1981). Seasonal and age-related changes n seen qualty and testcular orphology of bulls n a tropcal envronent. Vet. Rec. 108, L Junje Runz S., Shujun T., Xuyng Z., Sang R.Z., Tan S.J. and Zhao X.Y. (2001). Influence of heat stress on seen qualty and seru bochecal ndex of breedng beef bulls. J. Hebe. Agrc. Unv. 25, Mathevon M., Buhr M.M. and Dekkers J.C.M. (1998). Envronental, anageent and genetc factors affectng seen producton n Holsten bulls. J. Dary Sc. 81, McGee E.A. and Hsueh A.J. (2000). Intal and cyclc recrutent of ovaran follcles. Endocrnol. Rev. 21, Mostar M.P., Hasnat M., Azal S.A., Munra K.N. and Khatun H. (2005). Effect of seasonal varaton on seen qualty and herd fertlty. Pakstan J. Bol. Sc. 8, Moudgal N.R. and Sara M.R. (1998). Is there a true requreent for follcle stulatng horone n prootng speratogeness and fertlty n prates? Hu. Reprod. 13, Moyle W.R. and Capbell R.K. (1996). Gonadotropns.Pp n Reproductve Endocrnology, Surgery and Technology. E.Y. Adash, J.A. Rock and Z. Rosenwaks, Eds. Phladelpha: Lppncott-Raven Publshers, New York, YK. Plant T.M. and Marshall G.R. (2001). The functonal sgnfcance of FSH n speratogeness and the control of ts secreton n ale prates. Endocrnol. Rev. 22, of prover bulls. Byull. Vses. Nauch. Issled. Inst. Razveden. Genet. Sel Skokhozyastvennykh Zhvotnykh. 109, Sarder M.J.U. (2007). Envronent related varatons n the seen characterstcs of bulls used for artfcal nsenaton (AI) prograe n Bangladesh. Unv. J. Zool. Rajshah. 26, Schwab W., Kupfersched H. and Bachann P. (1987). Factors affectng seen producton n bulls. Zuchthygene. 22, Shannon P. and Vshwanath R. (1995). The effect of optal and suboptal concentratons of sper on the fertlty of freshand frozen bovne seen and a theoretcal odel to explan the fertlty dfferences. An. Reprod. Sc. 39, Sratsk I.Z. (1990). Inhertance of reproductve ablty of bulls. Tstol. Genet. 24, Sknner J.D. and Louw G.N. (1966). Heat stress and speratogeness n Bos ndcus and Bos taurus cattle. J. Appl. Physol. 21, Stalhaar E.M., Janson L. and Phlpsson J. (1989). Genetc studes on fertlty n AI. bulls. I. Age, season and genetc effects on seen characterstcs n young bulls. An. Reprod. Sc. 19, Stalhaar E.M., Janson L. and Phlpsson J. (1988). Genetc and envronental studes on seen characterstcs and fertlty n young AI. bulls. Pp n Proc. 6 th Wld. Conf., An. Prod. Helsnk. Fnland. Usan R.H., Shah S.K. and Zafar A.H. (1993). Seasonal effect on seen producng ablty of Holsten Fresan and crossbred bulls under sub tropcal envronent of Punjab. Pakstan Vet. J. 13, Wolfenson D., Roth Z. and Medan R. (2000). Ipared reproducton n heat-stressed cattle: basc and appled aspects. An. Reprod. Sc. 60, Zafar A.H., Ahad N. and Shah S.K. (1988). Effect of seasonal varatons on seen producton of Nl-Rav buffalo bulls. Buff. J. 1, Iranan Journal of Appled Anal Scence (2014) 4(1), 33-37