Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice (% of body weight, mean ± SD).
|
|
- Kathryn Moody
- 5 years ago
- Views:
Transcription
1 Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice ( of body weight, mean ± SD). a. Steady-state, high dose T (0 mg/kg, weekly for 7 mo, n = per group) Sample F M T Kidney weight 1.19± ± ±0.13 a 1.8±0.19 b Spleen weight 0.41± ± ± ±0.03 a p < 0.001, smaller than all other groups. b p < 0.001, greater than all other groups, One-way ANOVA followed with Tukey s test. b. Short-term, high dose T (0 mg/kg, 2 injection in 2 weeks, n = 8 per group) Sample F FT T Kidney weight 1.01± ±0.23 a 0.92± ±0.2 b Spleen weight 0.39± ± ± ±0.0 a p < 0.001, FT > F; b p < 0.001, T >. One-way ANOVA followed with Tukey s test. c. Short-term low dose T ( mg/kg, 3 injections in 2 weeks, n = 7 per group) Sample F FT P, t test Kidney weight 1.0 ± ± 0.2 <0.0 Spleen weight 0.30 ± ± F: vehicle-treated female, M: vehicle-treated male, : vehicle-treated castrated male, FT: testosterone-treated female, T: testosteronetreated castrated male.
2 Supplemental Table 2. Selected hematological parameters a. Comparison between intact males and females (results are shown as mean ± SD, n = 8 for males, and n = 12 for females, t test). Female mean SD Male mean SD p value b. Comparison between castrated males with and without short-term high dose testosterone treatment (n = 8, t test). mean SD T mean SD p value c. Comparison between females with and without short-term low dose testosterone treatment (n = 7, t test). F mean SD FT mean SD p value
3 d. Comparison between females with and without long-term high dose testosterone treatment (n = 8, t test). F mean SD FT mean SD p value e. Comparison between castrated males with and without long-term high dose testosterone treatment (n = 8, t test). mean SD T mean SD p value : red blood cells, : hematocrits, : hemoglobin, : distribution width, : mean corpuscular volume, : mean corpuscular hemoglobin concentration, : hemoglobin distribution width, retic: reticulocyte count, : reticulocyte hemoglobin content. F: female, : castrated male.
4 Serum testosterone (ng/ml) * ** 0.0 control d1 d3 d Supplemental Figure 1. Serum testosterone at various time points post injection. Adult female mice were injected with testosterone propionate (0 mg/kg) on day 0. Blood was collected on day 1, 3, and (n = 3 1). Serum testosterone was analyzed by LC-MS/MS. *p < 0.001, lower than all other groups, **p<0.001, greater than all other groups, One-way ANOVA, followed with Tukey s test.
5 Erythrocyte packing difference () Whole blood viscosity (cp) B Hematocrits () A ** C # T # T. T Day 0 Day 14 T Shear rate (s -1 ) P i = Plasma viscosity (cp, 172 s -1 ) Elongation rate () D E P m = 0.96 T T Shear force (Pa) Supplemental Figure 2. Effect of short-term testosterone treatment on blood viscosity in adult castrated male mice. Adult castrated male mice were injected weekly with vehicle or testosterone propionate (0 mg/kg) for two weeks. (A) Hematocrits, (B) erythrocyte packing difference, (C) whole blood viscosity, (D) plasma viscosity, measured at shear rate of 172s -1, (E) erythrocyte elongation rate. Results are shown as mean ± SD, n = 6-8. : castrated male, T: castrated male treated with testosterone. ** p < 0.01, paired t test; # p < 0.0, p < 0.01, unpaired t test.
6 Whole blood viscosity (cp) A F FT Shear Rate (1/s) Elongation rate () B F FT Shear force (Pa) Supplemental Figure 3. Effect of short-term low dose testosterone treatment on blood viscosity in adult female mice. Adult female mice were treated with testosterone propionate ( mg/kg) on day 0, 7, and 11. Blood was collected on day 14 for the measurements. (A) whole blood viscosity, and (B) erythrocyte deformability. Results are shown are mean ± SD, n = 7 per group. F: vehicle-treated, FT: testosterone-treated.
7 Hematocrits () Whole blood viscosity (cp) A C T T P m = Shear rate (s -1 ) Plasma viscosity (cp, 172 s -1 ) Elongation () B D T T P m = Shear force (Pa) # Supplemental Figure 4. Effect of long-term testosterone treatment on blood viscosity in adult castrated male mice. Adult castrated male mice were treated weekly with testosterone propionate (0 mg/kg) for 7 months. (A) hematocrits (B) plasma viscosity,(c) whole blood viscosity, and (D) erythrocyte deformability. Results are shown are mean ± SD, n = per group. # p < 0.0, p < 0.01, unpaired t test. : castrated males, T: castrated males treated with testosterone.
8 WBV M shear rate 1/s Elongation rate () M shear rate (Pa) Supplemental Figure. Effect of long-term castration on blood viscosity and erythrocyte elongation rate in adult male mice. Results are repotted from data presented in Figure 1 (intact male) and Supplemental Figure 4, long-term castrated male). Hematopoietic indices are shown in Table 1a and Table 1e. Results are shown are mean ± SD, n = per group. M: normal males, : castrated males.
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationComparative analysis of the rheological properties of blood in patients with type 2 diabetes
Series on Biomechanics, Vol.27, No. 3-4 (2012), 80-85 Comparative analysis of the rheological properties of blood in patients with type 2 diabetes V. Kostova a, N. Antonova a, I. Velcheva b, I. Ivanov
More informationWHICH OF THE FOLLOWING COMPRISE A
HEMATOLOGY QUESTION REVIEW WHICH OF THE FOLLOWING COMPRISE A LOGICAL SEQUENCE OF VESSELS AS BLOOD EXITS THE HEART? a. capillaries; arteries; veins b. veins; capillaries; arteries c. arteries; capillaries;
More informationof 3-Aminophenol in B6D2F1 Mice
Summary of Drinking Water Carcinogenicity Study of 3-Aminophenol in B6D2F1 Mice July 2012 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationTHE UNIVERSITY OF JORDAN FACULTY OF MEDICINE DEPARTMENT OF PATHOLOGY
THE UNIVERSITY OF JORDAN FACULTY OF MEDICINE DEPARTMENT OF PATHOLOGY INTRODUCTION TO ANEMIA Third year medical students First semester 2018/2019 Dr. RBC DISORDERS Lecturer: Dr. Tariq Al-Adaily Email: TNALADILY@ju.edu.jo
More informationMCHC - Red Cell Index or Quality Control Parameter? Brian S. Bull, Raymond Aller, and Berend Houwen
Abstract MCHC - Red Cell Index or Quality Control Parameter? Brian S. Bull, Raymond Aller, and Berend Houwen Clinicians frequently review red cell indices when they are trying to diagnose a patient s anemia.
More informationIntroduction and II. Blood Cells A. Introduction
Chapter 14: Blood 1. Blood is three to four times more viscous than water. Introduction and II. Blood Cells A. Introduction 2. Most blood cells form in red bone marrow. 3. Types of blood cells are red
More informationSemi-physiologic Population PKPD Model Characterizing the Effect of Bitopertin (RG1678) Glycine Reuptake Inhibitor on Hemoglobin Turnover in Humans
Semi-physiologic Population PKPD Model Characterizing the Effect of Bitopertin (RG1678) Glycine Reuptake Inhibitor on Hemoglobin Turnover in Humans Franziska Schaedeli Stark, Meret Martin-Facklam, Carsten
More informationM. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
More informationPreferred Clinical Services for Leading Age Florida August 26-27, 2015
DIAGNOSIS CODING ESSENTIALS FOR LONG-TERM CARE: CHAPTER 3, D CODES DISEASES OF THE BLOOD AND BLOOD-FORMING ORGANS AND CERTAIN DISORDERS INVOLVING THE IMMUNE MECHANISM Preferred Clinical Services for Leading
More information-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e
-1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood
More informationI. Definitions. V. Evaluation A. History B. Physical Exam C. Laboratory evaluation D. Bone marrow examination E. Specialty referrals
I. Definitions II. III. Red blood cell life cycle Iron metabolism IV. Causes of anemia A. Kinetic approach 1. decreased production 2. increased destruction 3. blood loss B. Morphologic approach 1. normocytic
More information* imagine if the Hb is free ( e.g. hemolysis ) in the plasma what happens?
In this lecture we will talk about Some characteristics of RBC. Erythrpoiesis : * During fetal & adult life. * its regulation. RBCs : - Appear under the microscope as circular,unnucleated and biconcave
More informationCase Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
More informationNon-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice
Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice Samit Ghosh 1,2, Chibueze A. Ihunnah 2, Rimi Hazra 2, Aisha L. Walker 2, Jason M. Hansen 3, David R. Archer 4,
More informationHematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
More informationRelationship between hemoglobin concentration and transferrin saturation in iron-sufficient 2
Relationship between hemoglobin concentration and transferrin saturation in iron-sufficient 2 Martti A. Siimes,3 M. D., Ulla M. Saarinen,4 M. D., and Peter R. Dallman,5 M.D. ABSTRACT Ten groups of healthy
More informationTHE PHYSIOLOGY OF BLOOD
2 THE PHYSIOLOGY OF BLOOD Objectives 1. ERYTHROCYTES 2. ERYTHROCYTE AGGLUTINOGENES, 3. PLASMA AGGLUTININS 4. TRANSFUSION 5. Practical tasks ERYTHROCYTE COUNT BLOOD GROUPING RH FACTOR CROSSMATCHING TEST
More informationDiagnostic Approach to Patients with Anemia
J KMA Special Issue Diagnostic Approach to Patients with Anemia Seonyang Park, MD Department of Internal Medicine, Seoul National University College of Medicine E mail : seonpark@snu.ac.kr J Korean Med
More informationBone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
More informationCOEXISTENCE OF β-thalassemia AND POLYCYTHEMIA VERA: A CHICKEN-AND-EGG DEBATE?
COEXISTENCE OF β-thalassemia AND POLYCYTHEMIA VERA: A CHICKEN-AND-EGG DEBATE? M. DE SLOOVERE (1), L. HARLET (2), S. VAN STEENWEGHEN (3), E. MOREAU (1), D. DE SMET (1) (1) DEPARTMENT OF LABORATORY MEDICINE,
More informationRed Blood Cell Morphology in Sickle Cell Anemia as Determined by Image Processing Analysis: The Relationship to Painful Crises
Red Blood Cell orphology in Sickle Cell Anemia as Determined by Image Processing Analysis: The Relationship to Painful Crises AXWELL P. WESTERAN,.D. AND JAES W. BACUS, PH.D. Red blood cell morphology was
More informationHEMATOPOIESIS. HEMATOLOGY Introduction. Study of blood & its components Window of rest of body. Introduction
HEMATOLOGY/ HEMATOPOIESIS Introduction HEMATOLOGY Introduction Study of blood & its components Window of rest of body 1 BLOOD Raison d etre Delivery of nutrients Oxygen Food Vitamins Removal of wastes
More informationThe % of blood consisting of packed RBCs is known as the hematocrit. Blood s color ranges from scarlet (oxygen-rich) to dark red (oxygen poor).
Biology Blood Blood is a fluid connective tissue consisting of cells suspended in a liquid fibrous matrix. The cells are called formed elements and the liquid matrix is known as plasma. The formed elements
More information(F) Blood Physiology (I) + (M) Blood Composition
LECTURE 6 Note: a part or the Erythropoiesis lecture for boys is included here (F) Blood Physiology (I) + (M) Blood Composition Red : important Black : in male / female slides Pink : in girls slides only
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationINTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED
INTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED Rationale for Combining Iron & Vit-D Vit D deficiency and Iron deficiency Anaemia the two most menacing disorders - are inter-related
More informationORIGINAL ARTICLE. Evaluation of Effect of Ascorbic Acid on Ferritin and Erythropoietin Resistance in Patients of Chronic Kidney Disease
32 Evaluation of Effect of Ascorbic Acid on Ferritin and Erythropoietin Resistance in Patients of Chronic Kidney Disease N Nand 1, S Venu 2, AR Deshmukh 2, R Mittal 2 ORIGINAL ARTICLE Abstract This study
More informationTypes of Anaemias and their Management. S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014
Types of Anaemias and their Management S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014 Objectives At the end of the presentations participants should be able to: 1. Define
More informationHematology: Challenging Cases with Your Participation COPYRIGHT
Hematology: Challenging Cases with Your Participation Reed E. Drews, MD Beth Israel Deaconess Medical Center Harvard Medical School Boston, MA Question 1 Question 1 64-year-old man is evaluated during
More informationHEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp
I. Body H 2 O = HEMOTOLOGY A. Variable quantities 1. sweating and urination ( ) decreases H 2 O 2. drinking H 2 O increases B. Water is found in two compartments 1. contains 2/3 of all water in your body
More information(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential
SUPPLEMENTAL DATA Supplemental Figures Supplemental Figure 1 Supplemental Figure 1 Apoptotic events of stored platelets. (A and B) PRP was incubated at 37 under agitation for 0 (control) or 16 h. The pretreated
More informationINTERNATIONAL JOURNAL OF PHYTOTHERAPY RESEARCH ISSN Research article
Research article EVALUATION OF SAFETY OF VETTUMARAN GUTIKA THROUGH SUB ACUTE TOXICITY STUDY IN WISTAR RATS Sanjaya Kumar Y.R*, Sushant S Parekar, Thamizh Selvam N, Sanal Gopi C.G and Sudarsanan Nair PK
More informationDr. Shiva Nazari Assistant Professor of Pediatric Oncologist & Hematologist Shahid Beheshti Medical Science University Mofid Children s Hospital
Dr. Shiva Nazari Assistant Professor of Pediatric Oncologist & Hematologist Shahid Beheshti Medical Science University Mofid Children s Hospital Reduction in the normal red cell survival (120 days) RBC
More information2011 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia. December 12, 2011
211 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia December 12, 211 Hepcidin is Central Regulator of Iron Homeostasis Hepcidin is liver-expressed,
More informationTopics of this lecture : RBC. Structural characteristics Hemoglobin Erythropoiesis Erythrocytes destruction
Topics of this lecture : RBC Structural characteristics Hemoglobin Erythropoiesis Erythrocytes destruction Structural characteristics Its small size and biconcave shape provides more surface area than
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationSummary of Phase 3 IMPACT Trial Results Presented at AUA Meeting Webcast Conference Call April 28, Nasdaq: DNDN
Summary of Phase 3 IMPACT Trial Results Presented at AUA Meeting Webcast Conference Call April 28, 2009 Nasdaq: DNDN PROVENGE sipuleucel-t is an autologous active cellular immunotherapy that activates
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationA Mechanism-Based PK/PD Model Predicts the Time-Course of Hematological responses for Epoetin beta
A Mechanism-Based PK/PD Model Predicts the Time-Course of Hematological responses for Epoetin beta N. Hayashi, K. P. Zuideveld, P. Jordan & R. Gieschke Modeling & Simulation Group & Biometrics, F. Hoffmann-La
More informationStatistical questions for statistical methods
Statistical questions for statistical methods Unpaired (two-sample) t-test DECIDE: Does the numerical outcome have a relationship with the categorical explanatory variable? Is the mean of the outcome the
More informationApproach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital
Approach to the child with anemia Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Definition of anemia Hb< 2 SD or P2.5 below the mean for a healthy of the same gender
More informationAnnals of RSCB Vol. XVI, Issue 1
RESEARCHES REGARDING THE INFLUENCE OF APITHERAPY DIET ON ERYTHROCYTES IN WISTAR RATS WITH EXPERIMENTALLY CCl 4 INDUCED HEPATOTOXICITY C.V. Andriţoiu 1, V. Andriţoiu 2, Anca-Irina Prisăcaru 3, T. Petreuş
More informationBlood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah
Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationMed Chem 535 ~ Diagnostic Medicinal Chemistry. Hematology ~ Erythrocytes (Red Blood Cells, RBCs)
Med Chem 535 ~ Diagnostic Medicinal Chemistry Hematology ~ Erythrocytes (Red Blood Cells, RBCs) I. Tests A. Red Blood Cell Count (RBC)* B. Hemoblobin (Hb or Hgb)* C. Hematocrit (Hct)* D. Wintrobe Indices
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationHematological Effects of Cadmium in Hybrid Isa brown
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2012, 2 (6):2049-2054 Hematological Effects of Cadmium in Hybrid Isa brown * Imer Haziri 1, Bujar Mane 2, Arben
More informationSerum transferrin and ferritin in pubertal boys: relations to body growth, pubertal stage, erythropoiesis, and iron deficiency13
Serum transferrin and ferritin in pubertal boys: relations to body growth, pubertal stage, erythropoiesis, and iron deficiency13 Raija Anttila and Martti A Siimes ABSTRACT We studied serum transferrin
More informationFerrata Storti Foundation
Red blood cell aggregation, aggregate strength and oxygen transport potential of blood are abnormal in both homozygous sickle cell anemia and sickle-hemoglobin C disease Original Article Julien Tripette,
More informationLifeblood Lab Activity
History of Blood: It is the universal symbol of horror, of death, yet it is the one thing that keeps you living. It is the blood that is coursing through your veins. But, what do you really know about
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationERYTHROPOIESIS. Development of RBC s. 03-Dec-17. Before Birth (EMBRYO) Before Birth (EMBRYO) After Birth. MESOBLASTIC STAGE 1 st Trimester
Development of RBC s ERYTHROPOIESIS Before Birth (EMBRYO) Prof Dr Waqas Hameed HOD, Physiology Pak Int l Medical College After Birth Before Birth (EMBRYO) MESOBLASTIC STAGE 1 st Trimester Yolk Sac Capillary
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationMcWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
More informationHemoglobin CC Disease: Rheological Properties of Erythrocytes and Abnormalities in Cell Water
Hemoglobin CC Disease: Rheological Properties of Erythrocytes and Abnormalities in Cell Water JOHN R. MURPHY From the Department of Medicine, University Hospitals and Case Western Reserve University, Cleveland,
More informationExamination Tests from Pathological Physiology. Pavel Maruna et al. Reviewed by: Prof. MUDr. Emanuel Nečas, DrSc. Prof. MUDr. Jaroslav Veselý, CSc.
Examination Tests from Pathological Physiology Pavel Maruna et al. Reviewed by: Prof. MUDr. Emanuel Nečas, DrSc. Prof. MUDr. Jaroslav Veselý, CSc. Authors: Prof. MUDr. Pavel Maruna, CSc. Doc. MUDr. Martin
More information3/31/2014. New Directions in Aplastic Anemia Treatment: What s on the Horizon? Objectives
New Directions in Aplastic Anemia Treatment: What s on the Horizon? AA & MDS International Foundation Living with, MDS, or PNH Patient and Family Conferences in 2014 April 5, 2014 Objectives To provide
More informationMore Efficient Exchange of Sickle Red Blood Cells can be Achieved by Exchanging the Densest Red Blood Cells
More Efficient Exchange of Sickle Red Blood Cells can be Achieved by Exchanging the Densest Red Blood Cells Thibodeaux, SR, Jamensky, L, Schell K, Irwin L, O Doherty U Hospital of the University of Pennsylvania
More informationPrinciples of Anatomy and Physiology
Principles of Anatomy and Physiology 14 th Edition CHAPTER 19 The Cardiovascular System: The Blood Functions and Properties of Blood Blood is a liquid connective tissue consisting of cells surrounded by
More informationINFLUENCE OF ELECTROMAGNETIC RADIATION PRODUCED BY MOBILE PHONE ON VISCOSITY OF HUMAN BLOOD
International Journal of Science, Environment and Technology, Vol. 4, No 6, 215, 1469 1475 ISSN 2278-3687 (O) 2277-663X (P) INFLUENCE OF ELECTROMAGNETIC RADIATION PRODUCED BY MOBILE PHONE ON VISCOSITY
More informationNKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
More informationDeformability of Oxygenated Irreversibly Sickled Cells
Deformability of Oxygenated Irreversibly Sickled Cells MARGARET R. CLARK, NARLA MOHANDAS, and STEPHEN B. SHOHET, The Cancer Research Institute and Departments of Medicine and Laboratory Medicine, University
More informationSupplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
More informationRheological Properties of Erythrocytes and Lipid Profiles of Blood Plasma
IBIMA Publishing JMED Research http://www.ibimapublishing.com/journals/jmed/jmed.html Vol. 2015 (2015), Article ID 563217, 5 pages DOI: 10.5171/2015.563217 Research Article Rheological Properties of Erythrocytes
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationNKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
More informationBlood Physiology. Rodolfo T. Rafael, M.D.,CFP
Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the
More informationTranslatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal
Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related
More informationErythrocytosis in Spontaneously Hypertensive Rats
Erythrocytosis in Spontaneously Hypertensive Rats SUBHA SEN, GEORGE C. HOFFMAN, NICHOLAS T. STOWE, ROBERT R. SMEBY, and F. MERLIN BUMPUS From the Research Division and Department of Laboratory Hematology,
More informationANEMIA & HEMODIALYSIS
ANEMIA & HEMODIALYSIS The anemia of CKD is, in most patients, normocytic and normochromic, and is due primarily to reduced production of erythropoietin by the kidney and to shortened red cell survival.
More informationTR-469 Toxicology and Carcinogenesis Studies of AZT (CAS No ) and AZT/-Interferon A/D B6C3F1 Mice (Gavage Studies)
(This document has been reformatted unchanged from the original document except for the bold emphasis editing by Stuart Thomson, Director, the Gaia Research Institute. S.T.) TR-469 Toxicology and Carcinogenesis
More informationErythropoietic protoporphyria (EPP) was first described clinically in Similar to
Introduction Erythropoietic protoporphyria (EPP) was first described clinically in 1961. 1 Similar to other porphyrias, EPP is a disease in which a defect in heme synthesis causes an over-production and
More informationManagement of anemia in CKD
Management of anemia in CKD Pierre Cochat, MD PhD Professor of Pediatrics Chair, Pediatrics & Pediatric Surgery Department Head, Center for Rare Renal Diseases Néphrogones Hospices Civils de Lyon & University
More informationEvaluation of Relative Blood Viscosity During Menstruation in Reproductive Females
Full Length Research Article Available online at http://www.ajol.info/index.php/njbas/index Nigerian Journal of Basic and Applied Science (December, 2016), 24(2): 60-65 DOI: http://dx.doi.org/10.4314/njbas.v24i2.9
More informationL4-Iron Deficiency Anemia (IDA) & Biochemical Investigations
L4-Iron Deficiency Anemia (IDA) & Biochemical Investigations 1 st Year-College of Medicine Hematology Module-Biochemistry Semester II Dr. Basil OM Saleh Objectives Identify stages in development of IDA
More informationClinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock
Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric
More informationHISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM
HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM Login: http://histopath.westernu.edu Histology Atlas AND Virtual Histology links. I. HEMATOLOGY - PERIPHERAL BLOOD Purpose: To be able to identify
More informationNew Phase III Clinical Trial Enrolling Now
New Phase III Clinical Trial Enrolling Now Paroxysmal Nocturnal Hemoglobinuria (PNH) Designed for Patients 1. At least 18 years of age 2. With a primary diagnosis of PNH confirmed by high-sensitivity flow
More informationEDUCATIONAL COMMENTARY DIFFERENTIATING IMMATURE PERIPHERAL BLOOD CELLS
Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click on Continuing Education on the left side of the
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationHEMATOLOGY. General information Whole blood in EDTA (purple top tube) is the required specimen for mammalian hematology.
VETERINARY DIAGNOSTIC SERVICES CLINICAL PATHOLOGY Updated: October 1, 2014 The Clinical Pathology Section of Veterinary Diagnostic Services provides testing in the fields of hematology, urinalysis, cytology,
More informationSCIENTIFIC OPINION. Abstract
SCIENTIFIC OPINION ADOPTED: 7 March 2018 doi: 10.2903/j.efsa.2018.5233 Statement complementing the EFSA Scientific Opinion on application (EFSA-GMO-DE-2011-95) for the placing on the market of genetically
More informationChanges in Hematologic Parameters Induced by Thermal Treatment of Human Blood
Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,
More informationThe Cardiovascular System: The Blood, Heart, & Blood Vessels
The Cardiovascular System: The Blood, Heart, & Blood Vessels Fluids of the Body Cells of the body are serviced by 2 fluids 1. Blood a liquid connective tissue that consists of cells surrounded by a liquid
More informationPractical Histology. Lab 3: Connective tissue
Practical Histology Lab 3: Connective tissue Connective tissues Connective tissue provides structural support for the body by binding cells and tissues together to form organs. It also provides metabolic
More informationChapter 2. ERYTHROPOIESIS and ANEMIA
Chapter 2 ERYTHROPOIESIS and ANEMIA Red Cell Production The Production of red cells, known as erythropoiesis, is a developmental system fundamentally under genetic control but modulated and regulated by
More informationAnemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor
Anemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor Email: abdalla.awidi@gmail.com Main Hematological diseases A- Benign Hematology 1- Anemias 2- Bleeding disorders
More informationSevere proliferative retinopathy is associated with blood hyperviscosity in sickle cell hemoglobin-c disease but not in sickle cell anemia.
Severe proliferative retinopathy is associated with blood hyperviscosity in sickle cell hemoglobin-c disease but not in sickle cell anemia. Clément Lemaire, Yann Lamarre, Nathalie Lemonne, Xavier Waltz,
More informationFactors affecting oxygen dissociation curve
P a g e 1 Factors affecting oxygen dissociation curve As you know, hemoglobin contains 4 heme molecules that bind 4 oxygen molecules (8 atoms). These 4 heme molecules, however, do not bind oxygen all at
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationHematopoietic Cell Transplantation for Myelofibrosis. Outline
Hematopoietic Cell Transplantation for Myelofibrosis H.Joachim Deeg MD Fred Hutchinson Cancer Research Center & University of Washington, Seattle WA Great Debates, NY, 4/28/2012 Outline Rationale for hematopoietic
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationAnemia (3).ms Hemolytic Anemia. Abdallah Abbadi Feras Fararjeh
Anemia (3).ms4.26.2.18 Hemolytic Anemia Abdallah Abbadi Feras Fararjeh Case 3 24 yr old female presented with anemia syndrome and jaundice. She was found to have splenomegaly. Hb 8, wbc 12k, Plt 212k,
More informationCase Report: Acupuncture Treatment in Patient With Hypothyroidism and Oligoasthenoteratozoospermia
Case Report: Acupuncture Treatment in Patient With Hypothyroidism and Oligoasthenoteratozoospermia Jihe Zhu 1, Blagica Arsovska 2, Kristina Kozovska 3 1, 2, 3 Faculty of Medical Sciences, University Goce
More informationEffect of testosterone enanthate on hematopoiesis in normal men
FERTILITY AND STERILITY Copyright c; 1983 The American Fertility Society Vol. 40, No.1, July 1983 Printed in U.S.A. Effect of testosterone enanthate on hematopoiesis in normal men Anselmo Palacios, M.D.
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More information