N. Lal Mahammed et al. Int. Res. J. Pharm. 2013, 4 (12) INTERNATIONAL RESEARCH JOURNAL OF PHARMACY
|
|
- Arabella Holland
- 5 years ago
- Views:
Transcription
1 INTERNATIONAL RESEARCH JOURNAL OF PHARMACY ISSN Research Article EFFECT OF TELMISARTAN AND RUTIN IN ALCOHOL PLUS HIGH FRUCTOSE DIET INDUCED METABOLIC DYSFUNCTION IN RATS N. Lal Mahammed 1 *, P. Sireesha 2, E. Supraja 3, B. Pooja 3 1 Department of Pharmacology, KLR Pharmacy College, Paloncha, Andhrapradesh, India 2 Department of Pharmaceutics, Sri Lakshmi Venkateswara Institute of Pharmaceutical Sciences, Prodattur, Andhrapradesh, India 3 Department of Pharmacology, SIMS College of Pharmacy, Guntur, Andhrapradesh, India *Corresponding Author rahultej245@gmail.com Article Received on: 28/10/13 Revised on: 30/11/13 Approved for publication: 26/12/13 DOI: / ABSTRACT The objective of the study was to investigate the effect of telmisartan and rutin in High Fructose Diet plus alcohol induced metabolic syndrome in rats. Our study demonstrated the beneficial effects of telmisartan and rutin on both abnormal metabolic characters and vascular dysfunction in insulin resistant rats. Initially we have validated the pre diabetic metabolic syndrome rat model by feeding high fructose diet to the male Sprague Dawley rats. Development of metabolic syndrome and glucose intolerance was assessed by performing the plasma biochemical analysis such as plasma glucose, triglyceride, insulin and total cholesterol levels. Glucose intolerance was assessed by performing an intra peritoneal glucose tolerance test and Histopathological studies of Liver were conducted. In the present study, we examined the effect telmisartan and rutin and the relationship between the plasma adiponectin concentration and adiposity, body fat distribution, lipid profile, renal profile, liver enzymes, Cardio vascular parameters, histopathology of Liver, in high fructose diet fed Sprague-dawley rats. It was concluded that telmisartan and rutin are effective in treating metabolic dysfunction and alcohol induced liver toxicity Further studies are needed to explore the underlying mechanisms. Keywords: High fructose diet, Termisartan, Rutin, Alcohol. INTRODUCTION Metabolic syndrome is a set of risk factors that includes: abdominal obesity, a decreased ability to process glucose (increased blood glucose and/or insulin resistance), dyslipdemia, and hypertension. Metabolic syndrome is thought to be caused by adipose tissue dysfunction and insulin resistance. Dysfunctional adipose tissue also plays an important role in the pathogenesis of obesity-related insulin resistance 1. Both adipose cell enlargement and infiltration of macrophages into adipose tissue result in the release of proinflammatory cytokines and promote insulin resistance. Insulin resistance appears to be the primary mediator of metabolic syndrome. Insulin promotes glucose uptake in muscle, fat, and liver cells, and can influence lipolysis and production of glucose by hepatocytes 2. Additional contributors to insulin resistance include abnormalities in insulin secretion and insulin receptor signaling, impaired glucose disposal, and pro-inflammatory cytokines. These abnormalities, in turn, may result from obesity with related increases in free fatty acid levels and changes in insulin distribution (insulin accumulates in fat). To mimic this non genetic pre diabetic insulin resistance condition in rats, we are feeding the rats with a high calorie food in the form of high fructose diet (HFD) 3. Development of vascular dysfunction was reported in HFD fed insulin resistant animals, further PPAR- γ agonists such as telmisartan had shown promising improvement in the metabolic abnormalities associated with insulin resistant. In addition to its effect on metabolic parameters the vascular protective nature has been demonstrated in several experiments, these agents performing the vascular protection through anti oxidative, anti-inflammatory and anti proliferative mechanisms. But the conventional TZDs are well known for their side effects such as weight gain and heart failure; hence these compounds are not advisable to obese patients who are already at great risk for CVDs. Therefore there is a tremendous need to develop a drug to treat metabolic syndrome and associated CVDs and it should be free of above mentioned side effects 4. On the other side, RAS has identified as a key player in the development of CVDs associated with diabetes, most of the deleterious effects of RAS are mediated through AT 1 receptor stimulation by Ang II. Blockade of RAS is found to be beneficial in these situations, but multidimensional therapeutic interventions are required to combat coexisting diabetes and CVDs, till now there is no single drug available to treat the above condition, so there is a need of combination regimen to treat metabolic and cardiovascular disorders effectively 5. Fortunately the serendipitous discovery of some of the ARBs for their additional PPAR- γ agonistic property has given the idea for the development of new and evaluation of existing drugs in metabolic syndrome. This discovery raised the hope for the development of new dual pharmacophores in future. Telmisartan is reported to be a dual pharmacophore (ARB/ PPAR- γ) 6. Some studies have demonstrated the beneficial effects of telmisartan on metabolic profile in insulin resistant and diabetic conditions, but there are no systematic studies carried out to evaluate the beneficial role of these dual pharmacophore on vascular protection in metabolic syndrome. In this present work we studied the effect of telmisartan on both vascular and metabolic parameters. Administration of alcohol at this condition further increases the risk. Combination of HFD and alcohol may increase reactive oxygen species this will damage the liver 7. Some studies shows that rutin a Flavonoid glycoside having powerful anti oxidant as well as powerful anti inflammatory property in the present work we studied the effect of rutin on vascular and metabolic parameters 8. Page 57
2 MATERIALS AND METHODS Animals Male Sprague Dawley (SD) rats of g body weight were procured from the national institute of nutrition, Hyderabad, India. The animals were maintained under controlled room Temperature (22 ± 2 C) and humidity (55 ± 5 %) with a 12-h light / dark cycle. Animals were housed in three animals per cage and allowed to food and water ad libitum 9. Rats were grouped and fed with either standard chow diet (NPD) or high fructose diet (HFD). All experiments and protocols described in present study were approved by the Institutional Animal Ethical Committee (IAEC) of KLR Pharmacy College, Paloncha, Khammam (No.1516/PO/a/11/CPCSEA). Chemicals Telmisartan and Rutin were procured from sigma chemicals, St Louis, USA. Alcohol was purchased from neon labs, Mumbai, India. All other chemicals and reagents were used of analytical grade. Dose Selection In the present study treatment control groups 10 % HFD (high fructose diet), alcohol at a dose of (20 % v/v) and the treatment groups telmisartan dose (5 mg/kg), rutin (50 mg/kg) were administered by per oral route in morning throughout the study period. Experimental Design High Fructose Diet Induced Metabolic Dysfunction: Experimental study was carried out using adult Male Sprague Dawley rats weighing between g. The animals were housed in polypropylene cages of dimension The cages were maintained under clean and hygienic conditions 10. Animals were acclimatized to light and temperature with a 12 h - 12 h dark-light cycle; the rats were fed with commercial pelleted rat feed and water ad libitum. Total 60 adult male rats were selected for the study and divided into 10 groups each containing 6 rats. Group 1 is the Control (fed with normal pellets chows). Group 2 rats have received HFD (10 % v/v.p.o.) with normal pellets). Group 3 animals have received Alcohol (20 % v/v p.o) with normal pellets. Group 4 animals were fed on HFD (10 % v/v) + Alcohol (20 % v/v) with normal pellets. Group 5 animals received HFD + telmisartan (5 mg/kg) p.o with normal pellets. Group 6 animals received Alcohol + telmisartan (5 mg/kg) p.o with normal pellets. Group 7 animals received HFD + alcohol + telmisartan (5 mg/kg) p.o with normal pellets. Group 8 animals received HFD + rutin (50 mg/kg) p.o with normal pellets. Group 9 animals received Alcohol + rutin (50 mg/kg) p.o with normal pellets. Group 9 animals received HFD + alcohol + rutin (50 mg/kg) p.o with normal pellets. Composition of the Atherogenic Diet: 1 % Cholesterol (Sd fine-chem limited), 0.5 % Cholic acid (LOBA CHEMIE), 5 % Lard oil (Open Market). These diets were provided in addition to normal pellet chow 11. Treatment Protocol: Induction of metabolic syndrome in the experimental animals was carried out by feeding the animals with the high fructose diet. Induction of liver toxicity in the experimental animals was carried out by feeding the animals with the alcohol. Telmisartan was administered orally in a dose of 5 mg/kg, p.o. daily for the entire study period. Rutin was administered orally in a dose of 50 mg/kg, p.o. daily for the entire study period. 24 h before the sacrifice of the study animals, they were kept on fast but they had access to water. The blood samples were collected in eppendroffs tubes by puncturing the retro orbital plexus for biochemical estimation. Then experimental animals were sacrificed and the liver was collected and was kept in 15 % V/V formalin solution for histopathological examination. Statistical Analysis All results are expressed as mean ± SEM. Statistical analysis was performed using the Graph pad prism 5, Graph pad software. One-way ANOVA followed by Dunnett s test was performed. Histopathological Examination The liver was fixed in 10 % formalin and embedded in paraffin. Five-micron thick sections were prepared and stained with hematoxylin and eosin (H and E) 12. The tissue sections were evaluated under light microscopy by a blinded pathologist. RESULTS AND DISCUSSION Initially we have validated the pre diabetic metabolic syndrome rat model by feeding high fructose diet to the male Sprague Dawley rats. The metabolic syndrome rats showed a significant increase in the activity of serum LDL VLDL levels and Treated rats showed significant results. It was observed from the Tables 1-3. The metabolic syndrome rats showed a significant increase in the activity of serum LDL VLDL levels. The increased blood levels of total cholesterol, LDL, VLDL as well as lowered levels of HDL in high fructose diet rat have been identified in the development of hypercholestremia, which is one of the risk factors for CAD. Administration of telmisartan and rutin produces a significant decrease in the activity of LDL VLDL Our findings showed that obese rats treated with the telmisartan and rutin exhibited significant decreases in LDL, VLDL activity from Table 3. The telmisartan and rutin could prevent the development of atherosclerosis through regulating vascular inflammatory processes in rats fed with a high fructose diet. The current data showed a significant increase in the activity of enzymes AST and ALT in the metabolic syndrome rats compared with control rats from Table 3. Liver is bombarded by the free fatty acids (FFA) that pour out of the adipose tissue into the portal blood. This can directly cause inflammation within the liver cells, which then release further pro-inflammatory cytokines, leading to more hepatocyte injury and affecting the integrity of liver cells. The present results demonstrate that the telmisartan and rutin showed a significant decrease in the activity of both AST and ALT from Table 3 and showing a hepatic protective action. The results obtained showed significant correlation between adiponectemia and adiposity, body fat distribution, in atherogenic diet fed obese animals. The preliminary investigation of effects of telmisartan and rutin showed to improve the overall picture of metabolism especially the fatty acid metabolism. The plasma adiponectin levels were found to be significantly decreased in HFD group (p < 0.001), and a significant increase was observed in HFD + Telmisartan (5 mg/kg) groups (p < 0.001), Alcohol + Telmisartan (5 mg/kg) (obese + treated) group (p < 0.01), HFD + Rutin (50 mg/kg) group (p < 0.01), Alcohol + Rutin (50 mg/kg) group (p < 0.01), when compared to control group. Page 58
3 Table 1: Effect of Telmisartan and Rutin on Body Weight and Glucose Levels in HFD Plus Alcohol Induced Metabolic Dysfunction in Rats Body weight Glucose Levels (Mean ±SEM) Control ± ± 1.35 HFD ± 3.32 a*** ± 1.47 a*** Alcohol (20 %V/V) ± 0.91 a*** ± 2.58 a*** HFD + Alcohol (20 %V/V) ± 1.82 a*** ± 0.96 a*** HFD + Telmisartan (5 mg/kg) ± 0.85 b*** ± 2.08 b*** Alcohol (20 %v/v) + Telmisartan (5 mg/kg) ± 1.29 b*** ± 2.43 c*** HFD + Alcohol (20 %v/v) + Telmisartan (5 mg/kg) ± 0.64 b*** ± 2.17 d*** HFD + Rutin (50 mg/kg) ± 1.47 b*** ± 2.86 b*** Alcohol (20 %v/v) + Rutin (50 mg/kg) ± 1.54 b*** ± 1.54 c*** HFD + Alcohol (20 %v/v)+ Rutin (50 mg/kg) ± 1.04 b*** ± 1.96 d*** Table 2: Effect of Telmisartan and Rutin on Total Cholesterol, HDL and LDL Levels in HFD plus Alcohol Induced Metabolic Dysfunction in Rats Total Cholesterol Levels (Mean ±SEM) HDL Levels LDL Levels Control ± ± ± 1.17 HFD ± 1.60 a*** ± 0.88 a*** ± 1.85 a*** Alcohol (20 %V/V) ± 1.23 a*** ± 0.88 a*** ± 0.57 a*** HFD + Alcohol (20 %V/V) ± 1.24 a*** ± 0.76 a*** ± 0.76 a*** HFD + Telmisartan (5 mg/kg) ± 0.89 b*** 36.16± 1.10 b*** ± 0.74 b*** Alcohol (20 %v/v) + Telmisartan (5 mg/kg) ± 1.42 c*** ± 0.86 c*** ± 0.71 c*** HFD + Alcohol (20 %v/v) + Telmisartan (5 mg/kg) ± 1.66 d*** ± 0.86 d*** ± 0.84 d*** HFD + Rutin (50 mg/kg) ±1.54 b*** ± 0.89 b*** ± 0.60 b*** Alcohol (20 %v/v) + Rutin (50 mg/kg) ± 1.29 c*** ± 1.26 c*** ± 0.51 c*** HFD + Alcohol (20 %v/v) + Rutin (50 mg/kg) ± 1.25 d*** ± 0.79 d*** ± 0.70 d*** Table 3: Effect of Telmisartan and Rutin on Liver Weight, SGPT and SGOT Levels in HFD plus Alcohol Induced Metabolic Dysfunction in Rats Liver Weight ALT (SGOT) Levels AST (SGPT) Levels Control 2.57 ± ± ± 0.19 HFD 3.28 ± 0.12 a*** ± 0.45 a*** ± 1.06 a*** Alcohol (20 %V/V) 3.18 ± 0.26 a*** ± 0.76 a*** ± 0.60 a*** HFD + Alcohol (20 %V/V) 3.92 ± 0.17 a*** ± 1.25 a*** ± 0.67 a*** HFD + Telmisartan (5 mg/kg) 2.90 ± 0.08 b*** ± 1.53 b*** ± 2.16 b*** Alcohol (20 %v/v) + Telmisartan (5 mg/kg) 2.92 ± 0.09 c** ± 0.89 c*** ± 0.54 c*** HFD + Alcohol (20 %v/v) + Telmisartan (5 mg/kg) 2.79 ± 0.10 d*** ± 0.77 d*** ± 0.70 d*** HFD + Rutin (50 mg/kg) 2.83 ± 0.06 b** ± 0.52 b*** ± 0.58 b*** Alcohol (20 %v/v) + Rutin (50 mg/kg) 2.87 ± 0.02 c*** ± 0.26 c*** ± 0.07 c*** HFD + Alcohol (20 %v/v) + Rutin (50 mg/kg) 2.80 ± 0.06 d*** ± 1.58 d*** ± 0.74 d*** (Figure 1a, H and E, x 400) (Figure 1b, H and E, x 400) Figure 1: High Fructose Diet Section shows liver parenchyma with partially effaced architecture Page 59
4 . (Figure 2a, H and E, X 400) (Figure 2b, H and E, x 400) Figure 2: Alcohol + Telmisartan [5 mg/kg]: Section studied shows liver parenchyma with intact architecture (Figure 3a, H and E, x 400) (Figure 3b, H and E, x 400) Figure 3: Alcohol + Rutin [50 mg/kg]. Section studied shows liver parenchyma with intact architecture (Figure 4a, H and E, x 400) (Figure 4b, H and E, x 400) Figure 4: Control: Section studied shows liver parenchyma with intact architecture Histopathology Report Histopathological studies of Liver were conducted. The results found are highly encouraging. The regenerative changes were observed in the group of animals treated with the telmisartan and rutin the tissue elements lost due to the induction of disease condition namely metabolic syndrome and alcohol induced liver toxicity, the cardiovascular comorbidity were regenerated and restored in the treated animals. High Fructose Diet Section studied shows liver parenchyma with partially effaced architecture. Most of the hepatocytes show apoptotic changes (Short-arrow, Figure 1), while some show cytoplasmic vacuolations (Long-arrow, Figure 2). Most of the central veins (Long-arrow, Figure 1) and sinusoids are dilated and congested (Short-arrow, Figure 2). Alcohol + Telmisartan [5 mg/kg]: Section studied shows liver parenchyma with intact architecture. Some of the hepatocytes show regenerative changes (Arrow, Figure 1), while few show regenerative changes (Arrow, Figure 1). Most of the central veins are dilated and congested (Arrow, Figure 2). There are seen scattered mononuclear inflammatory infiltrations within parenchyma. Alcohol + Telmisartan [5 mg/kg]: Section studied shows liver parenchyma with intact architecture. Some of the hepatocytes show regenerative changes (Arrow, Figure 1), while few show regenerative changes (Arrow, Figure 1). Most of the central veins are dilated and congested (Arrow, Figure 2). There are seen scattered mononuclear inflammatory infiltrations within parenchyma. Alcohol + Rutin [50 mg/kg]. Section studied shows liver parenchyma with intact architecture. Few of the central veins (Short-Arrow, Figure 1) and sinusoids show congestion (Long-Arrow, Figure 1). Some of the hepatocytes show regenerative changes (Arrow, Figure 2). There are seen few mononuclear inflammatory infiltration within parenchyma. Control Section studied Page 60
5 shows liver parenchyma with intact architecture. Most of the perivenular hepatocytes and periportal hepatocytes appear normal. Within the hepatic parenchyma are seen few scattered mononuclear inflammatory cells [Figure 2, arrow]. The study showed that telmisartan and rutin significantly counters the high fructose diet and alcohol induced cardiovascular properties and improves the lipid profile in the experimental animals. Adiponectin is a protein hormone that modulates a number of metabolic processes, including glucose regulation and fatty acid catabolism. In the present study, we examined the effect telmisartan and rutin and the relationship between the plasma adiponectin concentration and adiposity, body fat distribution, lipid profile, renal profile, liver enzymes, CVS parameters, histopathology of Liver, in high fructose diet fed Spraguedowley rats. CONCLUSION The results obtained in our study of weight gain/loss, weight of liver, fat distribution, lipid profile, liver enzymes, glucose, histopathology and the plasma adiponectin concentration, in the treated and untreated experimental animals indicate that properties of telmisartan and rutin improve the overall health. However, further extensive investigation is needed to understand the overall mechanisms of improving overall metabolic changes. Thus telmisartan and rutin are effective in treating metabolic dysfunction and alcohol induced liver toxicity Further studies are needed to explore the underlying mechanisms. ACKNOWLEDGEMENTS The Authors are thankful to Mr. K. Lakshma Reddy, Chairman-KLR Institutes, Paloncha, Andhrapradesh, India for providing necessary facilities and Dr. Nagarjuna Reddy, Principal, KLR College of Pharmacy, Paloncha, Andhrapradesh, India for his support to carry out this Research Project. REFERENCES 1. Sobel BE, Schneider DJ. Cardiovascular complications in diabetes mellitus. Current Opinion in Pharmacology 2005; 5: doi.org/ /j.coph PMid: Reimann M, Bonifacio E, Solimena M, Schwarz PEH, Ludwig B, Hanefeld M, Bornstein SR. An update on preventive and regenerative therapies in diabetes mellitus. Pharmacology and Therapeutics 2009; 121: PMid: Virally M, Blickl JF, Girard J, Halimi S, Simon D, Guillausseau PJ. Type 2 diabetes mellitus:epidemiology, pathophysiology, unmet needs and therapeutical perspectives. Diabetes and Metabolism 2007; 33: PMid: Dapagliflozin trial results indicate improvement in key glycemic measures in treatment-naive type 2 diabetes.the Medical News; p Palumbo PJ. Metformin: Effects on Cardiovascular Risk Factors in Patients with Non insulin Dependent Diabetes Mellitus. Journal of Diabetes and Its Complications 1998; 12: Tahrani AA, Piya MK, Barnett AH. Saxagliptin: a new DPP4 inhibitor for the treatment of type 2 diabetes mellitus. Advanced Therapeutics 2009; 26(3): PMid: Neumiller JJ, White JR and Campbell RK. Sodium glucose transport inhibitors progress and therapeutic potential in type 2 diabetes mellitus. Drugs 2010; 70(4): PMid: Bloomgarden ZT. Diabetes treatment. Diabetes Care 2009; 32(3): PMid: PMCid:PMC Shih Li S. Sodium Glucose transporter. Formos J Endocrin Metab 2009; 1(1): Drug Report: Dapagliflozin. Thomsan Pharma Reuters; Tahrani AA, Piya MK, Barnett AH. Glycaemic control in type 2 diabetes: targets and new therapies. Pharmacology and Therapeutics 2010; 125: PMid: Cite this article as: N. Lal Mahammed, P. Sireesha, E. Supraja, B. Pooja. Effect of Telmisartan and Rutin in alcohol plus high fructose diet induced metabolic dysfunction in rats. Int. Res. J. Pharm. 2013; 4(12): Source of support: Nil, Conflict of interest: None Declared Page 61
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationHypoglycemic Activity of Seerankottai Thiravam (Semicarpus Anacardium. Linn) in Alloxan Induced Diabetic Rats
Research Article Hypoglycemic Activity of Seerankottai Thiravam (Semicarpus Anacardium. Linn) in Alloxan Induced Diabetic Rats P. Parthiban 1, K. Kanagavalli 1, P. Sathiya Rajeswaran 2, J. Anbu 3, A. Chinnasamy
More informationA COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS
A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And
More informationPharmacologyonline 1: (2011) Antihyperlipidemic Activity of Rimonabant on High Cholesterol Diet Induced Hyperlipidemia in Rats
Antihyperlipidemic Activity of Rimonabant on High Cholesterol Diet Induced Hyperlipidemia in Rats Arshad Ali oorani 1*, Gaurav Dwivedi 1 and M. K. Kale 2 1 Department of Pharmacology, Mandsaur Institute
More informationResearch Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats
Research Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats Nimmy Chacko*, Shastry CS, Prerana shetty, Prasanna Shyamma, Ullas D souza and Patel Maulika
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationAntiobesity effect of Lipovedic formulation in rats fed on atherogenic diet
ISPUB.COM The Internet Journal of Nutrition and Wellness Volume 8 Number 2 Antiobesity effect of Lipovedic formulation in rats fed on B Suresha, M Hariprasad, R Rema, U Imran Citation B Suresha, M Hariprasad,
More informationA comparative study on the fasting and post prandial lipid levels as a cardiovascular risk factor in patients with type 2 diabetes mellitus
Original Research Article A comparative study on the fasting and post prandial lipid levels as a cardiovascular risk factor in patients with type 2 diabetes mellitus Deepa Kalikavil Puthenveedu 1, Sundaraj
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationTHE EFFECT OF VITAMIN-C THERAPY ON HYPERGLYCEMIA, HYPERLIPIDEMIA AND NON HIGH DENSITY LIPOPROTEIN LEVEL IN TYPE 2 DIABETES
Int. J. LifeSc. Bt & Pharm. Res. 2013 Varikasuvu Seshadri Reddy et al., 2013 Review Article ISSN 2250-3137 www.ijlbpr.com Vol. 2, No. 1, January 2013 2013 IJLBPR. All Rights Reserved THE EFFECT OF VITAMIN-C
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationPlasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original
More informationSpontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes
30 The Open Diabetes Journal, 2011, 4, 30-36 Open Access Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes Sumiaki Fukuda, Katsuhiro Miyajima, Tomohiko Sasase
More informationJournal of Global Pharma Technology
Journal of Global Pharma Technology ISSN: 0975-8542 Available Online at www.jgpt.co.in RESEARCH ARTICLE Hepatoprotective Effect of Vitamin C and E on Antitubercular Drugs Induced Hepatotoxicity in Albino
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationDiabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs
Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationOnline at JPBR, 2014, Vol.2(1): 63-68
B. Kishore Kumar Reddy et al Research Article JPBR, 2014, Vol.2(1): 63-68 ISSN: 2347 8330 Journal of Pharmaceutical and Biological Research Online at www.pharmaresearchlibrary.com/jpbr JPBR, 2014, Vol.2(1):
More informationTaylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University
Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State
More informationEFFECTS OF VIRGIN COCONUT OIL (VCO) ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY)
EFFECTS OF VIRGIN COCONUT OIL () ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY) ROSARIO S. SAGUM, Ph.D., MILDRED A. UDARBE, M.Sc, TRINIDAD P. TRINIDAD, Ph.D., and MARIO V. CAPANZANA, Ph.D. Food and
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationEffects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats
Original Research Article Effects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats Sushil Sharma*, Amol Khanapure 1Department
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationDiabetes Oral Agents Pharmacology. University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D
Diabetes Oral Agents Pharmacology University of Hawai i Hilo Pre-Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 Learning Objectives Understand the role of the utilization of free
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationPharmacologyonline 2: (2009) Pharmacodynamic Drug Interaction of Gliclazide and Mexiletine in Rats
Pharmacodynamic Drug Interaction of Gliclazide and Mexiletine in Rats K. Abedulla Khan 1, S. Satyanarayana 2, K. Eswar Kumar 2, K. Pavan Kumar 1, K. Anupama 1 1 Sultan-ul-uloom College of pharmacy, Banjarahills,
More informationEarly life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem
More informationObesity, Insulin Resistance, Metabolic Syndrome, and the Natural History of Type 2 Diabetes
Obesity, Insulin Resistance, Metabolic Syndrome, and the Natural History of Type 2 Diabetes Genetics, environment, and lifestyle (obesity, inactivity, poor diet) Impaired fasting glucose Decreased β-cell
More informationChapter 4 Optimization of Insulin Resistance Model
4. 4.1. Background Type-II diabetes is a condition characterized by insulin resistance followed by progressive decrease in insulin secretion. The epidemiological evidence points to the fact that most type-2
More informationToxicity, Acute and Longterm Anti-Diabetic Profile of Methanolic Extract of Leaves of Pterocarpus Marsupium on Alloxan Induced Diabetic Albino Rats
2016; 5(7): 90-94 ISSN: 2277-7695 TPI 2016; 5(7): 90-94 2016TPI www.thepharmajournal.com Received: 12-05-2016 Accepted: 13-06-2016 Behara Chandra Rekha PG student, Department of Pharmacology, Gandhi Medical
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationInternational Journal of Pharma and Bio Sciences
Research Article Biochemistry International Journal of Pharma and Bio Sciences ISSN 0975-6299 CORRELATION BETWEEN SERUM URIC ACID LEVELS AND NON HDL CHOLESTEROL IN TYPE II DIABETES MELLITUS AN OBSERVATIONAL
More informationHSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationReceived: 10 March 2014, Accepted: 30 May 2014, Published Online: 19 June 2014 Abstract
Research Article www.pharmaresearchlibrary.com/ajmps ISSN: 2348-0165 Asian Journal of Medical and Pharmaceutical Sciences Pharmacodynamic Drug Interaction of Anti-Hypertensive Drug Combination Metoprolol
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationINVESTIGATION OF NEPFROPROTECTIVE EFFECT OF SILYMARIN AGAINST METHOTREXATE AND IFOSFAMIDE INDUCED TOXICITY IN RATS.
INVESTIGATION OF NEPFROPROTECTIVE EFFECT OF SILYMARIN AGAINST METHOTREXATE AND IFOSFAMIDE INDUCED TOXICITY IN RATS. MANOHAR NAIK K*, MANODEEP CHAKRABORTY, RIYAZ AHMED, SHAHZAD HAMZA, MOHAMMED AFSAL A R.
More informationHISTOPL4THOLOG1CAL STUDY OF LIVER
HISTOPL4THOLOG1CAL STUDY OF LIVER 6.1 Inti-oduction The structural and functional organization of the liver has been described by hepatic lobule and hepatic acinus models, respectively (Jarvelainen, 2000).
More informationThe promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease
The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease Steve Smith, Group Director Scientific Affairs, Diabetes & Metabolism GlaxoSmithKline R & D
More informationDr/ Sherein Saeid AbdElgayed, ph.d
هللامسب Dr/ Sherein Saeid AbdElgayed, ph.d Professor of Veterinary Pathology, Cairo University, Giza, Egypt. Chairman of the Editorial Board of Arab Journal of Science & Research Publishing (AJSRP) http://www.ajsrp.com
More informationAfrican Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp (2012)
African Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp.16-19 (2012) Effects of Antimalarial Herbal Mixture (Abc 123) on the Liver of Rats *Iliya HA, Wannang NN, Andrew MM, Ibrahim H Department
More informationDr. Hany M. Abo-Haded
BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline
More informationChapter 18. Diet and Health
Chapter 18 Diet and Health Risk Factors and Chronic Diseases Interrelationships among Chronic Diseases Chronic Disease Heart Disease and Stroke Hypertension Cancer Diabetes The Formation of Plaques in
More informationImproving Access to Quality Medical Care Webinar Series
Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX
More informationLaboratory analysis of the obese child recommendations and discussion. MacKenzi Hillard May 4, 2011
Laboratory analysis of the obese child recommendations and discussion MacKenzi Hillard May 4, 2011 aka: What to do with Fasting Labs The Obesity Epidemic The prevalence of obesity in adolescents has tripled
More informationComparison of Glucose & Lipid Profiles in Oxidative Stress Contain Diabetic Patients
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861. Volume 4, Issue 4 (Jan.- Feb. 2013), PP 40-44 Comparison of Glucose & Lipid Profiles in Oxidative Stress Contain
More informationEffects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver
Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University
More informationMetabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah
Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for
More informationJournal of Chemical and Pharmaceutical Research, 2012, 4(9): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2012, 4(9):4307-4318 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 Histopathological and ultrastructural changes
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationEvaluation of Hepatoprotective Activity of Aqueous Extract of Andrographis paniculata in Wistar Rats
www.ijpcs.net RESEARCH ARTICLE Evaluation of Hepatoprotective Activity of Aqueous Extract of Andrographis in Wistar Rats Naveen Alasyam 1*, Venkatanarayana Narapogu 2, Premendran John 3, Shaik Ubedulla
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More informationEffects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy
Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy J. Guan 1,2, L. Long 1, Y.-Q. Chen 1, Y. Yin 1, L. Li 1, C.-X. Zhang 1, L. Deng 1 and L.-H. Tian
More informationChanges in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss. Robert Lawrence Bowers
Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss by Robert Lawrence Bowers A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the
More informationProtective Effect of Cleome Viscosa Extract on Diet Induced Atherosclerosis in Diabetic Rats
Page1 Int J Pharm Pharmacol ISSN: 2581-3080 2017; 1(1): 103 Available at http://ijpp.edwiserinternational.com/home.php Research Article International Journal of Pharmaceutics & Pharmacology Protective
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More informationEvaluation of Anti-Hyperlipidemic Activity of Ammomum subulatum Seeds Extracts
Evaluation of Anti-Hyperlipidemic Activity of Ammomum subulatum Seeds Extracts Vavaiya R.B. 1, Patel A.A. 2, 1 Department of Pharmaceutical Science, JJT University, Jhunjhunu, Rajasthan 2 B M Shah College
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationThe New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
More informationANTI-DIABETIC ACTIVITY OF RIBES NIGRUM FRUIT EXTRACT IN ALLOXAN INDUCED DIABETIC RATS
IJPSR (2013), Vol. 4, Issue 3 (Research Article) Received on 30 November, 2012; received in revised form, 05 January, 2013; accepted, 27 February, 2013 ANTI-DIABETIC ACTIVITY OF RIBES NIGRUM FRUIT EXTRACT
More informationStudy of fixed dose combination for the management of cardiovascular diseases
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-331; ISSN (Online): 2321-386 Available online at: http://www.wjpsonline.org/ Original Article Study of fixed dose combination for the management
More informationCognitive Dysfunction in Diabetic Rats. Effect of Minocycline
Cognitive Dysfunction in Diabetic Rats. Effect of Minocycline *Author for correspondence Falgun Bhuva, Veeranjaneyulu Addepalli* Department of Pharmacology, School of Pharmacy and Technology Management,
More informationAdiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance.
ORIGINAL ARTICLE Adiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance. Bonneau GA y Pedrozo WR 1 Ministry of Public Health, Province of Misiones, 2 School of Exact, Chemical
More informationResearch Article. Antiobesity activity of ethanolic extract of fruits of Terminalia bellirica on atherogenic diet induced obesity in experimental rats
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2016, 8(3):191-197 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 Antiobesity activity of ethanolic extract of fruits
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationHYPOLIPIDEMIC EFFECT OF EXTRACTS FROM ABELMOSCHUS ESCULENTUS L. MALVACEAE ON TYLOXAPOL- INDUCED HYPERLIPIDEMIA IN MICE
HYPOLIPIDEMIC EFFECT OF EXTRACTS FROM ABELMOSCHUS ESCULENTUS L. MALVACEAE ON TYLOXAPOL- INDUCED HYPERLIPIDEMIA IN MICE Huynh Ngoc Trinh 1, Nguyen Ngoc Quynh 1, Tran T Van Anh 2, Vo Phung Nguyen 1 1 Department
More informationAn experimental study to evaluate the potentiating effect of Selenium and Vitamin-E as supplement to Sulfonylureas on Alloxan induced diabetic rats
ISSN: 2347-3215 Volume 2 Number 10 (October-2014) pp. 37-47 www.ijcrar.com An experimental study to evaluate the potentiating effect of Selenium and Vitamin-E as supplement to Sulfonylureas on Alloxan
More informationMethod Development and Validation for the Estimation of Saroglitazar in Bulk and Pharmaceutical Dosage Form by RP-HPLC
Original Research Method Development and Validation for the Estimation of Saroglitazar in Bulk and Pharmaceutical Dosage Form by RP-HPLC Hanumantha Rao K 1, Lakshmana Rao A 2,*, Chandra Sekhar KB 3 1 Assistant
More informationA study of waist hip ratio in identifying cardiovascular risk factors at Government Dharmapuri College Hospital
Original Research Article A study of waist hip ratio in identifying cardiovascular risk factors at Government Dharmapuri College Hospital M. Arivumani * Assistant Professor of General Medicine, Government
More informationPrevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar
Original Research Article Prevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar Naresh Kumar 1, Jyoti Kumar Dinkar 2*, Chandrakishore
More informationSubject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
More informationRESEARCH ARTICLE. Received on: 08/02/2017 Published on:27/03/2017
RESEARCH ARTICLE Received on: 08/02/2017 Published on:27/03/2017 Corresponding Author Anuradha VivekanandPhatak, Department of Pharmacology, Dr.BhanubenNanavati College of Pharmacy, Vile Parle (West),
More informationLearning Objectives. Disclosures. Self Assessment Questions. Background
Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)
More informationINTERNATIONAL JOURNAL OF PHYTOTHERAPY RESEARCH ISSN Research article
Research article EVALUATION OF SAFETY OF VETTUMARAN GUTIKA THROUGH SUB ACUTE TOXICITY STUDY IN WISTAR RATS Sanjaya Kumar Y.R*, Sushant S Parekar, Thamizh Selvam N, Sanal Gopi C.G and Sudarsanan Nair PK
More informationHBA1C: PREDICTOR OF DYSLIPIDEMIA AND ATHEROGENICITY IN DIABETES MELLITUS
Original Article HBA1C: PREDICTOR OF DYSLIPIDEMIA AND ATHEROGENICITY IN DIABETES MELLITUS Chintamani Bodhe*, Deepali Jankar**, Tara Bhutada***, Milind Patwardhan****, Mrs Varsha Patwardhan***** ABSTRACT
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationKeywords: Type 2 DM, lipid profile, metformin, glimepiride ABSTRACT
Human Journals Research Article September 2015 Vol.:4, Issue:2 All rights are reserved by K. Saravanan et al. Effects of Monotherapy and Combination Therapy Involving Metformin and Glimepiride on HbA1c
More informationHEPATIC CELL INJURY BY ETHINYL OESTRADIOL ESTROGEN Pandey Govind a*, Pandey S.P. b and Madhuri S. c
Research Article HEPATIC CELL INJURY BY ETHINYL OESTRADIOL ESTROGEN Pandey Govind a*, Pandey S.P. b and Madhuri S. c a* Ex-Professor & Head of Pharmacology (Pharmacy), presently Officer-In-Charge of Rinder
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationMetabolic Syndrome: What s so big about BIG?
Tuesday, 10:00 11:30, A2 Objectives: Notes: Metabolic Syndrome: What s so big about BIG? Patrice Conrad pbconrad1@att.net 1. Identify advances in clinical assessment and management of selected healthcare
More informationArteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
More informationDiabetes treatment by the algorithm
Diabetes treatment by the algorithm Joseph Dawley, M.D. Southwest Oklahoma Family Medicine Residency Oklahoma University Health Sciences Center Clinical Assistant Professor Objectives By the end of this
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationEffect of vegetable oils on the lipid profile and antioxidant status in Wistar rats: A comparative study
Biochemistry- Original article DOI: http://dx.doi.org/10.18320/jimd/201603.02109 JOURNAL OF INTERNATIONAL MEDICINE AND DENTISTRY To search..to know...to share p-issn: 2454-8847 e-issn: 2350-045X Effect
More informationA Practical Approach to the Use of Diabetes Medications
A Practical Approach to the Use of Diabetes Medications Juan Pablo Frias, M.D., FACE President, National Research Institute, Los Angles, CA Clinical Faculty, University of California, San Diego, CA OUTLINE
More informationInternational Journal of Pharma and Bio Sciences COMPARISON OF EFFICACY AND SAFETY OF RIMONABANT WITH ORLISTAT IN OBESE AND OVERWEIGHT PATIENTS
International Journal of Pharma and Bio Sciences RESEARCH ARTICLE PHARMACOLOGY COMPARISON OF EFFICACY AND SAFETY OF RIMONABANT WITH ORLISTAT IN OBESE AND OVERWEIGHT PATIENTS Corresponding Author DR.JAIN
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationJMSCR Vol 05 Issue 05 Page May 2017
www.jmscr.igmpublication.org Impact Factor 5.84 Index Copernicus Value: 83.27 ISSN (e)-2347-176x ISSN (p) 2455-0450 DOI: https://dx.doi.org/10.18535/jmscr/v5i5.193 Lipid Profile as Early Predictor of Complication
More information