A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Size: px
Start display at page:

Download "A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes"

Transcription

1 A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China

2 Accelerated Aging in China Percentage of people over 6 (%) Y -15Y > 6Y Source:

3 Serious Unmet Medical Needs: Explosion of NCDs Diabetes 114 Mn in China Possible Asian DM phenotype with lower BMI onset, dissimilar glucose metabolism Hypertension 25 Mn in China: high incidence of complications Stroke mortality in China/India is 16/125 vs. US 47, 1k population/year

4 Metabolic Syndrome: A Clinical Constellation Abdominal Obesity Hypertension MS US 25% China, 15% Dyslipidemia Proinflammatory Prothrombotic Insulin Resistance Type-2 Diabetes The IDF consensus worldwide definition of the metabolic syndrome (25)

5 MS Increases the Risk of CVD and T2D Scott M. Grundy, NATURE REVIEWS DRUG DISCOVERY 5:295-39, 26

6 Common Soil of MS: Insulin Resistance Obesity Dyslipidemia Insulin Resistance Hyperglycemia Hypertension Lancet, 365: , 25

7 Glucose Metabolism Blood Glucose skeletal muscle accounts for 7-9% of insulin-stimulated glucose disposal Nature Medicine, 1: , 24 7

8 MG53: A Key Player in Insulin Resistance Insulin MG53 Hypertension Coronary Heart Disease Stroke Diabetes

9 MG53 is Specifically Expressed in Cardiac and Skeletal Muscles Brain Liver Spleen Lung Kidney Pancreas Intestine Stomach Heart M. Skeletal M. Testis White fat 1 White fat 2 Brown fat MG53 Northern blot of MG53 in wt mice. 1: subcutaneous adipose tissue; 2: visceral adipose tissue. 9

10 Upregulation of MG53 in Rodent Models with Metabolic Disorders A. Chow HFD Mouse Rat Lean db/db WKY SHR MG53 GAPDH B. MG53 protein (fold of control) Song et al., nature, 213

11 Transgenic Overexpression of MG53 Is Sufficient to Induce Obesity a b MG53 GSK3β Heart wt Skeletal muscle Heart wt Skeletal muscle mg53 TG Lung Brain Hypothalamus Liver Intestine Kidney Visceral fat Testis mg53 TG Body weight (g) c wt mg53 TG Age (weeks)

12 Transgenic Overexpression of MG53 Triggers Severe Insulin Resistance a. b. Glucose (mg/dl) Glucose (% of baseline) Glucose (min) Insulin (min) wt mg53 TG

13 Overexpression of MG53 Causes Hypertension and Metabolic Disorders a Blood pressure (mmhg) Systolic Diastolic b Cholesterol (mg/dl) c Insulin (ng/ml) wt mg53 TG

14 Transgenic Overexpression of MG53 Does Not Cause Skeletal Muscle Atrophy wt mg53 TG 5 µm Cross-sectional area (µm 2 ) 2 1 Weight (g).2.1. wt mg53 TG

15 Upregulation of MG53 Leads to Diabetic Cardiomyopathy Insulin MG53 Diabetic cardiomyopathy is the major cause of death (5%) in patients with diabetes Hypertension Coronary Heart Disease Stroke Diabetes Common Soil: Insulin Resistance

16 Overexpression of MG53 Causes Cardiac Hypertrophy and Ventricular Dilation A WT Mg53 TG C WT Mg53 TG B Heart weight (g)

17 Overexpression of MG53 Leads to Myocardial Lipid Accumulation WT mg53 TG

18 MG53 Ablation Attenuates HFD-induced Obesity A. B. A. Body weight (g) # # # # # # # wt Chow mg53-/- Chow wt HFD mg53-/- HFD wt Chow mg53-/- Chow wt HFD mg53-/- HFD Age (weeks) 1 cm

19 Mg53 deficiency Prevents HFD-induced Glucose Intolerance Glucose (mg/dl) # # # # # wt Chow wt HFD mg53-/- Chow mg53-/- HFD Glucose (% of baseline) Glucose (min) # # # # # Insulin (min)

20 MG53 Ablation Attenuates HFD-induced Hypertension Blood pressure (mmhg) wt Chow mg53-/- Chow Systolic Diastolic wt HFD mg53-/- HFD

21 MG53 Ablation blocks HFD-induced Metabolic Disorders A. B. Blood glucose (mg/dl) wt Chow mg53-/- Chow Fast wt HFD mg53-/- HFD Fed Insulin (ng/dl) C. Cholesterol (mg/dl) Triglyceride (mg/dl)

22 MG53 Attenuates HFD-induced Fatty Liver wt Chow wt mg53-/- mg53-/- HFD HE staining of Liver

23 MG53 Deficiency Prevents HFD-induced Pancreatic Dysfunction wt Chow mg53-/-chow wt mg53-/- wt HFD mg53-/-hfd Chow HFD Insulin (% of baseline) # 15 3 Glucose (min)

24 Insulin Signaling Nature. 414: , 21.

25 MG53 Blocks Muscle Insulin Signaling a Insulin p-irβ t-irβ - wt mg53 TG b p-irβ (fold of wt) Insulin - + NS - + t-ir (fold of wt) 1 wt mg53 TG py-irs1 t-irs1 p-akt t-akt py-irs1 (fold of wt) Insulin - + NS - + t-irs1 (fold of wt) 1 MG53 GAPDH p-akt (fold of wt) 1 5 Insulin - + NS - + t-akt (fold of wt) 1

26 MG53 Blocks Insulin-induced Glucose Uptake in C2C12 Myotubes and Cardiac Myocytes A B Ad-GFP Ad-MG53 2-NBDG uptake (fold of Control) 2 1 Glucose uptake (fold of control) insulin min insulin 3 min insulin min insulin 3 min

27 MG53 Ablation Restores Insulin Sensitivity in Mice on HFD Chow HFD wtchow mg53-/- Chow wt HFD mg53-/- HFD Insulin p-irs1 t-irs1 wt mg53-/ wt mg53-/ p-irs1 (fold of wt Chow) Insulin p-akt t-akt p-gsk3β t-gsk3 p-akt (fold of wt Chow) Insulin MG53 GAPDH p-gsk3β (fold of wt Chow) Insulin

28 Progression and Outcomes of MS Grundy SM., Journal of the American College of Cardiology, 26

29 Different T2D Profile in China vs USA USA China 48% 14% 21% 9% 8% 17% 27% 56% T2DM T2DM + Hypertension T2DM + Obesity T2DM + Hypertension + Obesity DiBonaventura, The burden of the Complicated T2DM Patient in China

30 Tracking Insulin Sensitivity in Multiple Organs 3

31 Muscle Insulin Resistance Is the Earliest Defect in mg53 TG mice a Insulin p-akt t-akt Skeletal muscle wt mg53 TG wt Liver mg53 TG + Visceral fat wt mg53 TG MG53 b p-akt/t-akt (fold of WT) GAPDH w age wt mg53 TG Insulin Skeletal muscle Liver Visceral fat

32 Aberrant Muscle Insulin Signaling Precedes Systemic Insulin Resistance in Mice on HFD for 1 week Chow HFD Insulin p-akt t-akt MG53 GAPDH Skeletal muscle Chow HFD Insulin p-akt t-akt MG53 GAPDH Liver Visceral fat Chow HFD Insulin p-akt t-akt MG53 β-actin p-akt/t-akt (fold of control) 1 5 Chow HFD Insulin p-akt/t-akt (fold of control) 2 1 Insulin p-akt/t-akt (fold of control) 8 4 Insulin Chow HFD

33 Systemic Insulin Resistance in mg53 TG mice at 38 weeks of age Insulin p-akt t-akt MG53 GAPDH p-akt/t-akt (fold of wt) Skeletal muscle wt mg53 TG Liver wt mg53 TG w age Visceral fat wt mg53 TG wt mg53 TG Insulin Skeletal muscle Liver Visceral fat

34 Systemic Insulin Resistance-induced by HFD (35 Weeks) Skeletal muscle Liver Visceral fat Insulin p-akt t-akt wt Chow HFD mg53-/- mg53-/-wt wt mg53-/ Chow HFD wt mg53-/-wt mg53-/ Chow HFD wt mg53-/ p-akt/t-akt Insulin p-akt/t-akt Insulin 6 p-akt/t-akt t Insulin

35 Posttranslational Downregulation of Both IR and IRS1 in MS Models a c IR β protein (fold of control) IRS1 protein (fold of control) b IR mrna (fold of control) d IRS1 mrna (fold of control)

36 Is MG53 an E3 Ligase? MG53 RING B-box Putative coiled-coil PRY SPRY TRIM SPRY Ring: E3 ligase? B-box: no clear function Coiled-coil: oligomerization SPRY: protein interaction

37 MG53 E3 Ligase Targets IR and IRS1 for Ubiquitin-dependent Degradation a c Chow HFD IP: IRβ IB: ubiquitin IRβ (Ub) n 95 kda IP: IRβ IB: ubiquitin IRβ (Ub) n 95 KDa Lysate IRβ MG53 IRβ MG53 Lysa te b IRS1 (Ub) n d Chow HFD IRS1 (Ub) n IP: IRS1 IB: ubiquitin 17 kda IP: IRS1 IB: ubiquitin 17 KDa Lysate IRS1 MG53 Lysate IRS1 MG53

38 Sequence Analysis of MG53 N-terminus RING B-box Putative coiled-coil PRY SPRY C14A Homo sapiens: Mus musculus: Xenopus laevis: C C CH C C C C RING (lacking 1-56 aa) Zn 2+ Zn 2+ Ring finger cross-brace motif 38

39 Ring Finger Domain Is Required for MG53- mediated IR and IRS1 Ubiquitination a b Flag-FL-MG Flag- RING Flag-C14A IR-Myc HA-Ub IP: Myc IB: HA IRβ (Ub) n 95 Kd Flag-FL-MG Flag- RING Flag-C14A IRS1-Myc HA-Ub IP: Myc IB: HA IRS1 (Ub) n 17 Kd Lysate IB: Flag IB: Myc Lysate IB: Flag IB: Myc

40 Central Role of E3 Ubiquitin Ligase MG53 in Insulin Resistance and Metabolic Syndrome Insulin receptor (IR) PM Glucose uptake GSK3 Akt IRS1 PI3K Ub Ub Ub Ub Ub Ub Ub Ub Proteosome MG53 E2 Ub UbUbUbUb Degradation of IR & IRS1 Glycogen synthesis Dietary factors Hypertension Genetic defects Stress Insulin Resistance, MS, Obesity, T2D and CVD

41 Summary 1. MG53 expression is universally elevated in various rodent, nonhuman primate models and humans with insulin resistance and metabolic disorders. 2. Transgenic overexpression of MG53 in mice is sufficient to cause severe insulin resistance and metabolic syndrome. 3. Upregulation of MG53 is indispensable for dietinduced insulin resistance and metabolic disorders. 4. Thus, upregulation of MG53, a novel E3 ligase, is both necessary and sufficient to target insulin resistance and resultant metabolic syndrome.

42 Ongoing Translational Research Man (disease detection, prevention, intervention and possible reversal; human tissue bank) Nonhuman Primate disease models Rodent Disease Models (KO, KI, TG models, in vivo physiology and pathology, cell signaling circuitries) Molecules (medical genetics; high-throughput gene sequencing and protemomics; bioinformatics)

43 NHP Model of Spontaneous Metabolic Syndrome

44 Insulin Resistance in MS Monkeys Glucose (mmol/l) MetS Control Insulin (μu/ml) Time (min) Time (min)

45 Upregulation of MG53 in NHPs and Humans with MS NHP Human Control MS Control MS MG53 MG53 GAPDH GAPDH MG53 protein (fold of control) 2 1 MG53 protein (fold of lean) 3 2 1

46 Human Population Genetic Study

47 Target Validation: MG53 as A Pomising Target for Metabolic and CV Diseases Discovery Development

48 Discovery to Delivery IP Portfolios University Healthcare Delivery

49 Team Efforts

50 Thank You!

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Effects of sitagliptin on cardiac metabolism in mice

Effects of sitagliptin on cardiac metabolism in mice Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures

More information

The Metabolic Syndrome: Is It A Valid Concept? YES

The Metabolic Syndrome: Is It A Valid Concept? YES The Metabolic Syndrome: Is It A Valid Concept? YES Congress on Diabetes and Cardiometabolic Health Boston, MA April 23, 2013 Edward S Horton, MD Joslin Diabetes Center Harvard Medical School Boston, MA

More information

Total risk management of Cardiovascular diseases Nobuhiro Yamada

Total risk management of Cardiovascular diseases Nobuhiro Yamada Nobuhiro Yamada The worldwide burden of cardiovascular diseases (WHO) To prevent cardiovascular diseases Beyond LDL Multiple risk factors With common molecular basis The Current Burden of CVD CVD is responsible

More information

Welcome and Introduction

Welcome and Introduction Welcome and Introduction This presentation will: Define obesity, prediabetes, and diabetes Discuss the diagnoses and management of obesity, prediabetes, and diabetes Explain the early risk factors for

More information

Metabolic Syndrome.

Metabolic Syndrome. www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

Cardiotoxicity of Hyperamylinemia

Cardiotoxicity of Hyperamylinemia Cardiotoxicity of Hyperamylinemia β-cell Dysfunction & Apoptosis Pancreatic β-cell Amylin Oligomers BLOO OD AMYLIN OLIGOMERIZATION HYPERGLYCEMIA Calcium dsreglation dysregulation HYPERAMYLINEMIA HYPERINSULINEMIA

More information

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.

More information

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

Diabetes Day for Primary Care Clinicians Advances in Diabetes Care

Diabetes Day for Primary Care Clinicians Advances in Diabetes Care Diabetes Day for Primary Care Clinicians Advances in Diabetes Care Elliot Sternthal, MD, FACP, FACE Chair New England AACE Diabetes Day Planning Committee Welcome and Introduction This presentation will:

More information

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1

More information

Cardiovascular Complications of Diabetes

Cardiovascular Complications of Diabetes VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary

More information

Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure

Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular

More information

Diabetes Mellitus: A Cardiovascular Disease

Diabetes Mellitus: A Cardiovascular Disease Diabetes Mellitus: A Cardiovascular Disease Nestoras Mathioudakis, M.D. Assistant Professor of Medicine Division of Endocrinology, Diabetes, & Metabolism September 30, 2013 1 The ABCs of cardiovascular

More information

AECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA

AECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA INCB013739, a Selective Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11βHSD1), Improves Insulin Sensitivity and Lowers Plasma Cholesterol Over 28 Days in Patients with Type 2 Diabetes Mellitus

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

Metabolic Syndrome in Asians

Metabolic Syndrome in Asians Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly

More information

Epidemiology of Diabetes, Impaired Glucose Homeostasis and Cardiovascular Risk. Eberhard Standl

Epidemiology of Diabetes, Impaired Glucose Homeostasis and Cardiovascular Risk. Eberhard Standl Epidemiology of Diabetes, Impaired Glucose Homeostasis and Cardiovascular Risk Eberhard Standl European Heart House Sophia Antipolis Thursday, June 17, 2010 IDF Diabetes Atlas 2009: Global Numbers Still

More information

HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME

HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing

More information

Diabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs

Diabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease

The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease Steve Smith, Group Director Scientific Affairs, Diabetes & Metabolism GlaxoSmithKline R & D

More information

Obesity in the pathogenesis of chronic disease

Obesity in the pathogenesis of chronic disease Portoroz October 16th 2013 Obesity in the pathogenesis of chronic disease Rocco Barazzoni University of Trieste Department of Medical, Surgical and Health Sciences Obesity Trends* Among U.S. Adults BRFSS,

More information

Roadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total

Roadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors

More information

Ischemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010

Ischemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Ischemic Heart and Cerebrovascular Disease Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Relationships Between Diabetes and Ischemic Heart Disease Risk of Cardiovascular Disease in Different Categories

More information

Proven and Proposed Cardiovascular Benefits of Soyfoods

Proven and Proposed Cardiovascular Benefits of Soyfoods Proven and Proposed Cardiovascular Benefits of Soyfoods Mark Messina, PhD, MS Soy Nutrition Institute Loma Linda University Nutrition Matters, Inc. markjohnmessina@gmail.com Alpro Foundation 20 years symposium

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

Michigan/Chicago unit

Michigan/Chicago unit Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression

More information

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author: Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli

More information

Rehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD

Rehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD Disclosure The contents of this presentation were developed with support from educational grants from the Department of Education, NIDRR grant numbers H133B090005, H133B970011 and H133G010160. However,

More information

Diabetes Overview. How Food is Digested

Diabetes Overview. How Food is Digested Diabetes Overview You are The Teacher, The Coach and the Fan Pathophysiology of Diabetes Complications Know the Numbers Treatment Can Good Control Make a Difference? Can Tight Control Be too Tight? How

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Pre-diabetes. Pharmacological Approaches to Delay Progression to Diabetes

Pre-diabetes. Pharmacological Approaches to Delay Progression to Diabetes Pre-diabetes Pharmacological Approaches to Delay Progression to Diabetes Overview Definition of Pre-diabetes Risk Factors for Pre-diabetes Clinical practice guidelines for diabetes Management, including

More information

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and

More information

Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY

Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY MCC-006 POST GRADUATE DIPLOMA IN CLINICAL CARDIOLOGY (PGDCC) 00269 Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY Time : 2 hours Maximum Marks : 60 Note : There will be multiple

More information

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu

More information

Metabolic Syndrome among Type-2 Diabetic Patients in Benghazi- Libya: A pilot study. Arab Medical University. Benghazi, Libya

Metabolic Syndrome among Type-2 Diabetic Patients in Benghazi- Libya: A pilot study. Arab Medical University. Benghazi, Libya Original Article Metabolic Syndrome among Type-2 Diabetic Patients in Benghazi- Libya: A pilot study Alshkri MM 1, Elmehdawi RR 2 1 Benghazi Diabetes Center. 2 Medical Department, Faculty of Medicine,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Gene expression in insulin resistance

Gene expression in insulin resistance Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m

More information

Hypertension and obesity. Dr Wilson Sugut Moi teaching and referral hospital

Hypertension and obesity. Dr Wilson Sugut Moi teaching and referral hospital Hypertension and obesity Dr Wilson Sugut Moi teaching and referral hospital No conflict of interests to declare Obesity Definition: excessive weight that may impair health BMI Categories Underweight BMI

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

SCIENTIFIC STUDY REPORT

SCIENTIFIC STUDY REPORT PAGE 1 18-NOV-2016 SCIENTIFIC STUDY REPORT Study Title: Real-Life Effectiveness and Care Patterns of Diabetes Management The RECAP-DM Study 1 EXECUTIVE SUMMARY Introduction: Despite the well-established

More information

Cardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016

Cardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016 Cardiovascular disease physiology Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016 Content Introduction The number 1 killer in America Some statistics Recommendations The disease process

More information

Metabolic Syndrome: What s so big about BIG?

Metabolic Syndrome: What s so big about BIG? Tuesday, 10:00 11:30, A2 Objectives: Notes: Metabolic Syndrome: What s so big about BIG? Patrice Conrad pbconrad1@att.net 1. Identify advances in clinical assessment and management of selected healthcare

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Cardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009

Cardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009 Cardiovascular disease, studies at the cellular and molecular level Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009 Content Introduction The number 1 killer in America Some statistics

More information

What is Diabetes Mellitus?

What is Diabetes Mellitus? Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

Risk Factors for Heart Disease

Risk Factors for Heart Disease Risk Factors for Heart Disease Risk Factors we cannot change (Age, Gender, Family History) Risk Factors we can change (modifiable) Smoking Blood pressure Cholesterol Diabetes Inactivity Overweight Stress

More information

CVD Risk Assessment. Michal Vrablík Charles University, Prague Czech Republic

CVD Risk Assessment. Michal Vrablík Charles University, Prague Czech Republic CVD Risk Assessment Michal Vrablík Charles University, Prague Czech Republic What is Risk? A cumulative probability of an event, usually expressed as percentage e.g.: 5 CV events in 00 pts = 5% risk This

More information

Know Your Number Aggregate Report Single Analysis Compared to National Averages

Know Your Number Aggregate Report Single Analysis Compared to National Averages Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics

More information

Hormonal Regulations Of Glucose Metabolism & DM

Hormonal Regulations Of Glucose Metabolism & DM Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order

More information

Diabetes and Concomitant Cardiovascular Disease: Guideline Recommendations and Future Directions

Diabetes and Concomitant Cardiovascular Disease: Guideline Recommendations and Future Directions Diabetes and Concomitant Cardiovascular Disease: Guideline Recommendations and Future Directions Diabetes is one of the largest global health emergencies of 21 st century, with the number of people with

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Trends In CVD, Related Risk Factors, Prevention and Control In China

Trends In CVD, Related Risk Factors, Prevention and Control In China Trends In CVD, Related Risk Factors, Prevention and Control In China Youfa Wang, MD, MS, PhD Associate Professor Center for Human Nutrition Department of International Health Department of Epidemiology

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda

More information

Metabolic syndrome and insulin resistance in an urban and rural adult population in Sri Lanka

Metabolic syndrome and insulin resistance in an urban and rural adult population in Sri Lanka Original Metabolic paper syndrome and insulin resistance in an urban and rural adult population in Sri Lanka Metabolic syndrome and insulin resistance in an urban and rural adult population in Sri Lanka

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Child born in year /3 will die before parents in US (diabetes)

Child born in year /3 will die before parents in US (diabetes) Child born in year 2000-1/3 will die before parents in US (diabetes) ATP III identified 6 components of the metabolic syndrome that relate to CVD 1. Abdominal obesity 2. Atherogenic dyslipidemia (elevated

More information

Management of Cardiovascular Disease in Diabetes

Management of Cardiovascular Disease in Diabetes Management of Cardiovascular Disease in Diabetes Radha J. Sarma, MBBS, FACP. FACC. FAHA. FASE Professor of Internal Medicine Western University of Health Sciences. Director, Heart and Vascular Center Western

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =

More information

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE

Diabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE Diabetes: Definition Pathophysiology Treatment Goals By Scott Magee, MD, FACE Disclosures No disclosures to report Definition of Diabetes Mellitus Diabetes Mellitus comprises a group of disorders characterized

More information

Standards of Medical Care in Diabetes 2016

Standards of Medical Care in Diabetes 2016 Standards of Medical Care in Diabetes 2016 Care Delivery Systems 33-49% of patients still do not meet targets for A1C, blood pressure, or lipids. 14% meet targets for all A1C, BP, lipids, and nonsmoking

More information

Diabetes in Older Adults

Diabetes in Older Adults Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information