A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
|
|
- Isabella Carroll
- 6 years ago
- Views:
Transcription
1 A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China
2 Accelerated Aging in China Percentage of people over 6 (%) Y -15Y > 6Y Source:
3 Serious Unmet Medical Needs: Explosion of NCDs Diabetes 114 Mn in China Possible Asian DM phenotype with lower BMI onset, dissimilar glucose metabolism Hypertension 25 Mn in China: high incidence of complications Stroke mortality in China/India is 16/125 vs. US 47, 1k population/year
4 Metabolic Syndrome: A Clinical Constellation Abdominal Obesity Hypertension MS US 25% China, 15% Dyslipidemia Proinflammatory Prothrombotic Insulin Resistance Type-2 Diabetes The IDF consensus worldwide definition of the metabolic syndrome (25)
5 MS Increases the Risk of CVD and T2D Scott M. Grundy, NATURE REVIEWS DRUG DISCOVERY 5:295-39, 26
6 Common Soil of MS: Insulin Resistance Obesity Dyslipidemia Insulin Resistance Hyperglycemia Hypertension Lancet, 365: , 25
7 Glucose Metabolism Blood Glucose skeletal muscle accounts for 7-9% of insulin-stimulated glucose disposal Nature Medicine, 1: , 24 7
8 MG53: A Key Player in Insulin Resistance Insulin MG53 Hypertension Coronary Heart Disease Stroke Diabetes
9 MG53 is Specifically Expressed in Cardiac and Skeletal Muscles Brain Liver Spleen Lung Kidney Pancreas Intestine Stomach Heart M. Skeletal M. Testis White fat 1 White fat 2 Brown fat MG53 Northern blot of MG53 in wt mice. 1: subcutaneous adipose tissue; 2: visceral adipose tissue. 9
10 Upregulation of MG53 in Rodent Models with Metabolic Disorders A. Chow HFD Mouse Rat Lean db/db WKY SHR MG53 GAPDH B. MG53 protein (fold of control) Song et al., nature, 213
11 Transgenic Overexpression of MG53 Is Sufficient to Induce Obesity a b MG53 GSK3β Heart wt Skeletal muscle Heart wt Skeletal muscle mg53 TG Lung Brain Hypothalamus Liver Intestine Kidney Visceral fat Testis mg53 TG Body weight (g) c wt mg53 TG Age (weeks)
12 Transgenic Overexpression of MG53 Triggers Severe Insulin Resistance a. b. Glucose (mg/dl) Glucose (% of baseline) Glucose (min) Insulin (min) wt mg53 TG
13 Overexpression of MG53 Causes Hypertension and Metabolic Disorders a Blood pressure (mmhg) Systolic Diastolic b Cholesterol (mg/dl) c Insulin (ng/ml) wt mg53 TG
14 Transgenic Overexpression of MG53 Does Not Cause Skeletal Muscle Atrophy wt mg53 TG 5 µm Cross-sectional area (µm 2 ) 2 1 Weight (g).2.1. wt mg53 TG
15 Upregulation of MG53 Leads to Diabetic Cardiomyopathy Insulin MG53 Diabetic cardiomyopathy is the major cause of death (5%) in patients with diabetes Hypertension Coronary Heart Disease Stroke Diabetes Common Soil: Insulin Resistance
16 Overexpression of MG53 Causes Cardiac Hypertrophy and Ventricular Dilation A WT Mg53 TG C WT Mg53 TG B Heart weight (g)
17 Overexpression of MG53 Leads to Myocardial Lipid Accumulation WT mg53 TG
18 MG53 Ablation Attenuates HFD-induced Obesity A. B. A. Body weight (g) # # # # # # # wt Chow mg53-/- Chow wt HFD mg53-/- HFD wt Chow mg53-/- Chow wt HFD mg53-/- HFD Age (weeks) 1 cm
19 Mg53 deficiency Prevents HFD-induced Glucose Intolerance Glucose (mg/dl) # # # # # wt Chow wt HFD mg53-/- Chow mg53-/- HFD Glucose (% of baseline) Glucose (min) # # # # # Insulin (min)
20 MG53 Ablation Attenuates HFD-induced Hypertension Blood pressure (mmhg) wt Chow mg53-/- Chow Systolic Diastolic wt HFD mg53-/- HFD
21 MG53 Ablation blocks HFD-induced Metabolic Disorders A. B. Blood glucose (mg/dl) wt Chow mg53-/- Chow Fast wt HFD mg53-/- HFD Fed Insulin (ng/dl) C. Cholesterol (mg/dl) Triglyceride (mg/dl)
22 MG53 Attenuates HFD-induced Fatty Liver wt Chow wt mg53-/- mg53-/- HFD HE staining of Liver
23 MG53 Deficiency Prevents HFD-induced Pancreatic Dysfunction wt Chow mg53-/-chow wt mg53-/- wt HFD mg53-/-hfd Chow HFD Insulin (% of baseline) # 15 3 Glucose (min)
24 Insulin Signaling Nature. 414: , 21.
25 MG53 Blocks Muscle Insulin Signaling a Insulin p-irβ t-irβ - wt mg53 TG b p-irβ (fold of wt) Insulin - + NS - + t-ir (fold of wt) 1 wt mg53 TG py-irs1 t-irs1 p-akt t-akt py-irs1 (fold of wt) Insulin - + NS - + t-irs1 (fold of wt) 1 MG53 GAPDH p-akt (fold of wt) 1 5 Insulin - + NS - + t-akt (fold of wt) 1
26 MG53 Blocks Insulin-induced Glucose Uptake in C2C12 Myotubes and Cardiac Myocytes A B Ad-GFP Ad-MG53 2-NBDG uptake (fold of Control) 2 1 Glucose uptake (fold of control) insulin min insulin 3 min insulin min insulin 3 min
27 MG53 Ablation Restores Insulin Sensitivity in Mice on HFD Chow HFD wtchow mg53-/- Chow wt HFD mg53-/- HFD Insulin p-irs1 t-irs1 wt mg53-/ wt mg53-/ p-irs1 (fold of wt Chow) Insulin p-akt t-akt p-gsk3β t-gsk3 p-akt (fold of wt Chow) Insulin MG53 GAPDH p-gsk3β (fold of wt Chow) Insulin
28 Progression and Outcomes of MS Grundy SM., Journal of the American College of Cardiology, 26
29 Different T2D Profile in China vs USA USA China 48% 14% 21% 9% 8% 17% 27% 56% T2DM T2DM + Hypertension T2DM + Obesity T2DM + Hypertension + Obesity DiBonaventura, The burden of the Complicated T2DM Patient in China
30 Tracking Insulin Sensitivity in Multiple Organs 3
31 Muscle Insulin Resistance Is the Earliest Defect in mg53 TG mice a Insulin p-akt t-akt Skeletal muscle wt mg53 TG wt Liver mg53 TG + Visceral fat wt mg53 TG MG53 b p-akt/t-akt (fold of WT) GAPDH w age wt mg53 TG Insulin Skeletal muscle Liver Visceral fat
32 Aberrant Muscle Insulin Signaling Precedes Systemic Insulin Resistance in Mice on HFD for 1 week Chow HFD Insulin p-akt t-akt MG53 GAPDH Skeletal muscle Chow HFD Insulin p-akt t-akt MG53 GAPDH Liver Visceral fat Chow HFD Insulin p-akt t-akt MG53 β-actin p-akt/t-akt (fold of control) 1 5 Chow HFD Insulin p-akt/t-akt (fold of control) 2 1 Insulin p-akt/t-akt (fold of control) 8 4 Insulin Chow HFD
33 Systemic Insulin Resistance in mg53 TG mice at 38 weeks of age Insulin p-akt t-akt MG53 GAPDH p-akt/t-akt (fold of wt) Skeletal muscle wt mg53 TG Liver wt mg53 TG w age Visceral fat wt mg53 TG wt mg53 TG Insulin Skeletal muscle Liver Visceral fat
34 Systemic Insulin Resistance-induced by HFD (35 Weeks) Skeletal muscle Liver Visceral fat Insulin p-akt t-akt wt Chow HFD mg53-/- mg53-/-wt wt mg53-/ Chow HFD wt mg53-/-wt mg53-/ Chow HFD wt mg53-/ p-akt/t-akt Insulin p-akt/t-akt Insulin 6 p-akt/t-akt t Insulin
35 Posttranslational Downregulation of Both IR and IRS1 in MS Models a c IR β protein (fold of control) IRS1 protein (fold of control) b IR mrna (fold of control) d IRS1 mrna (fold of control)
36 Is MG53 an E3 Ligase? MG53 RING B-box Putative coiled-coil PRY SPRY TRIM SPRY Ring: E3 ligase? B-box: no clear function Coiled-coil: oligomerization SPRY: protein interaction
37 MG53 E3 Ligase Targets IR and IRS1 for Ubiquitin-dependent Degradation a c Chow HFD IP: IRβ IB: ubiquitin IRβ (Ub) n 95 kda IP: IRβ IB: ubiquitin IRβ (Ub) n 95 KDa Lysate IRβ MG53 IRβ MG53 Lysa te b IRS1 (Ub) n d Chow HFD IRS1 (Ub) n IP: IRS1 IB: ubiquitin 17 kda IP: IRS1 IB: ubiquitin 17 KDa Lysate IRS1 MG53 Lysate IRS1 MG53
38 Sequence Analysis of MG53 N-terminus RING B-box Putative coiled-coil PRY SPRY C14A Homo sapiens: Mus musculus: Xenopus laevis: C C CH C C C C RING (lacking 1-56 aa) Zn 2+ Zn 2+ Ring finger cross-brace motif 38
39 Ring Finger Domain Is Required for MG53- mediated IR and IRS1 Ubiquitination a b Flag-FL-MG Flag- RING Flag-C14A IR-Myc HA-Ub IP: Myc IB: HA IRβ (Ub) n 95 Kd Flag-FL-MG Flag- RING Flag-C14A IRS1-Myc HA-Ub IP: Myc IB: HA IRS1 (Ub) n 17 Kd Lysate IB: Flag IB: Myc Lysate IB: Flag IB: Myc
40 Central Role of E3 Ubiquitin Ligase MG53 in Insulin Resistance and Metabolic Syndrome Insulin receptor (IR) PM Glucose uptake GSK3 Akt IRS1 PI3K Ub Ub Ub Ub Ub Ub Ub Ub Proteosome MG53 E2 Ub UbUbUbUb Degradation of IR & IRS1 Glycogen synthesis Dietary factors Hypertension Genetic defects Stress Insulin Resistance, MS, Obesity, T2D and CVD
41 Summary 1. MG53 expression is universally elevated in various rodent, nonhuman primate models and humans with insulin resistance and metabolic disorders. 2. Transgenic overexpression of MG53 in mice is sufficient to cause severe insulin resistance and metabolic syndrome. 3. Upregulation of MG53 is indispensable for dietinduced insulin resistance and metabolic disorders. 4. Thus, upregulation of MG53, a novel E3 ligase, is both necessary and sufficient to target insulin resistance and resultant metabolic syndrome.
42 Ongoing Translational Research Man (disease detection, prevention, intervention and possible reversal; human tissue bank) Nonhuman Primate disease models Rodent Disease Models (KO, KI, TG models, in vivo physiology and pathology, cell signaling circuitries) Molecules (medical genetics; high-throughput gene sequencing and protemomics; bioinformatics)
43 NHP Model of Spontaneous Metabolic Syndrome
44 Insulin Resistance in MS Monkeys Glucose (mmol/l) MetS Control Insulin (μu/ml) Time (min) Time (min)
45 Upregulation of MG53 in NHPs and Humans with MS NHP Human Control MS Control MS MG53 MG53 GAPDH GAPDH MG53 protein (fold of control) 2 1 MG53 protein (fold of lean) 3 2 1
46 Human Population Genetic Study
47 Target Validation: MG53 as A Pomising Target for Metabolic and CV Diseases Discovery Development
48 Discovery to Delivery IP Portfolios University Healthcare Delivery
49 Team Efforts
50 Thank You!
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationEffects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
More informationThe Metabolic Syndrome: Is It A Valid Concept? YES
The Metabolic Syndrome: Is It A Valid Concept? YES Congress on Diabetes and Cardiometabolic Health Boston, MA April 23, 2013 Edward S Horton, MD Joslin Diabetes Center Harvard Medical School Boston, MA
More informationTotal risk management of Cardiovascular diseases Nobuhiro Yamada
Nobuhiro Yamada The worldwide burden of cardiovascular diseases (WHO) To prevent cardiovascular diseases Beyond LDL Multiple risk factors With common molecular basis The Current Burden of CVD CVD is responsible
More informationWelcome and Introduction
Welcome and Introduction This presentation will: Define obesity, prediabetes, and diabetes Discuss the diagnoses and management of obesity, prediabetes, and diabetes Explain the early risk factors for
More informationMetabolic Syndrome.
www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationCardiotoxicity of Hyperamylinemia
Cardiotoxicity of Hyperamylinemia β-cell Dysfunction & Apoptosis Pancreatic β-cell Amylin Oligomers BLOO OD AMYLIN OLIGOMERIZATION HYPERGLYCEMIA Calcium dsreglation dysregulation HYPERAMYLINEMIA HYPERINSULINEMIA
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationJaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationDiabetes Day for Primary Care Clinicians Advances in Diabetes Care
Diabetes Day for Primary Care Clinicians Advances in Diabetes Care Elliot Sternthal, MD, FACP, FACE Chair New England AACE Diabetes Day Planning Committee Welcome and Introduction This presentation will:
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationGenetic ablation of Acp1 (Lmptp) in mice prevents heart failure
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular
More informationDiabetes Mellitus: A Cardiovascular Disease
Diabetes Mellitus: A Cardiovascular Disease Nestoras Mathioudakis, M.D. Assistant Professor of Medicine Division of Endocrinology, Diabetes, & Metabolism September 30, 2013 1 The ABCs of cardiovascular
More informationAECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA
INCB013739, a Selective Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11βHSD1), Improves Insulin Sensitivity and Lowers Plasma Cholesterol Over 28 Days in Patients with Type 2 Diabetes Mellitus
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationEpidemiology of Diabetes, Impaired Glucose Homeostasis and Cardiovascular Risk. Eberhard Standl
Epidemiology of Diabetes, Impaired Glucose Homeostasis and Cardiovascular Risk Eberhard Standl European Heart House Sophia Antipolis Thursday, June 17, 2010 IDF Diabetes Atlas 2009: Global Numbers Still
More informationHSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
More informationDiabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs
Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationThe promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease
The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease Steve Smith, Group Director Scientific Affairs, Diabetes & Metabolism GlaxoSmithKline R & D
More informationObesity in the pathogenesis of chronic disease
Portoroz October 16th 2013 Obesity in the pathogenesis of chronic disease Rocco Barazzoni University of Trieste Department of Medical, Surgical and Health Sciences Obesity Trends* Among U.S. Adults BRFSS,
More informationRoadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total
Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationDevelopment of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
More informationIschemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010
Ischemic Heart and Cerebrovascular Disease Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Relationships Between Diabetes and Ischemic Heart Disease Risk of Cardiovascular Disease in Different Categories
More informationProven and Proposed Cardiovascular Benefits of Soyfoods
Proven and Proposed Cardiovascular Benefits of Soyfoods Mark Messina, PhD, MS Soy Nutrition Institute Loma Linda University Nutrition Matters, Inc. markjohnmessina@gmail.com Alpro Foundation 20 years symposium
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationMichigan/Chicago unit
Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression
More informationBeijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:
Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli
More informationRehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD
Disclosure The contents of this presentation were developed with support from educational grants from the Department of Education, NIDRR grant numbers H133B090005, H133B970011 and H133G010160. However,
More informationDiabetes Overview. How Food is Digested
Diabetes Overview You are The Teacher, The Coach and the Fan Pathophysiology of Diabetes Complications Know the Numbers Treatment Can Good Control Make a Difference? Can Tight Control Be too Tight? How
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationUniversity of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationPre-diabetes. Pharmacological Approaches to Delay Progression to Diabetes
Pre-diabetes Pharmacological Approaches to Delay Progression to Diabetes Overview Definition of Pre-diabetes Risk Factors for Pre-diabetes Clinical practice guidelines for diabetes Management, including
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More informationTerm-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY
MCC-006 POST GRADUATE DIPLOMA IN CLINICAL CARDIOLOGY (PGDCC) 00269 Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY Time : 2 hours Maximum Marks : 60 Note : There will be multiple
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationMetabolic Syndrome among Type-2 Diabetic Patients in Benghazi- Libya: A pilot study. Arab Medical University. Benghazi, Libya
Original Article Metabolic Syndrome among Type-2 Diabetic Patients in Benghazi- Libya: A pilot study Alshkri MM 1, Elmehdawi RR 2 1 Benghazi Diabetes Center. 2 Medical Department, Faculty of Medicine,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationGene expression in insulin resistance
Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m
More informationHypertension and obesity. Dr Wilson Sugut Moi teaching and referral hospital
Hypertension and obesity Dr Wilson Sugut Moi teaching and referral hospital No conflict of interests to declare Obesity Definition: excessive weight that may impair health BMI Categories Underweight BMI
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationSCIENTIFIC STUDY REPORT
PAGE 1 18-NOV-2016 SCIENTIFIC STUDY REPORT Study Title: Real-Life Effectiveness and Care Patterns of Diabetes Management The RECAP-DM Study 1 EXECUTIVE SUMMARY Introduction: Despite the well-established
More informationCardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016
Cardiovascular disease physiology Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016 Content Introduction The number 1 killer in America Some statistics Recommendations The disease process
More informationMetabolic Syndrome: What s so big about BIG?
Tuesday, 10:00 11:30, A2 Objectives: Notes: Metabolic Syndrome: What s so big about BIG? Patrice Conrad pbconrad1@att.net 1. Identify advances in clinical assessment and management of selected healthcare
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationCardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009
Cardiovascular disease, studies at the cellular and molecular level Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009 Content Introduction The number 1 killer in America Some statistics
More informationWhat is Diabetes Mellitus?
Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationRisk Factors for Heart Disease
Risk Factors for Heart Disease Risk Factors we cannot change (Age, Gender, Family History) Risk Factors we can change (modifiable) Smoking Blood pressure Cholesterol Diabetes Inactivity Overweight Stress
More informationCVD Risk Assessment. Michal Vrablík Charles University, Prague Czech Republic
CVD Risk Assessment Michal Vrablík Charles University, Prague Czech Republic What is Risk? A cumulative probability of an event, usually expressed as percentage e.g.: 5 CV events in 00 pts = 5% risk This
More informationKnow Your Number Aggregate Report Single Analysis Compared to National Averages
Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics
More informationHormonal Regulations Of Glucose Metabolism & DM
Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order
More informationDiabetes and Concomitant Cardiovascular Disease: Guideline Recommendations and Future Directions
Diabetes and Concomitant Cardiovascular Disease: Guideline Recommendations and Future Directions Diabetes is one of the largest global health emergencies of 21 st century, with the number of people with
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationEndothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationTrends In CVD, Related Risk Factors, Prevention and Control In China
Trends In CVD, Related Risk Factors, Prevention and Control In China Youfa Wang, MD, MS, PhD Associate Professor Center for Human Nutrition Department of International Health Department of Epidemiology
More informationFAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
More informationMetabolic syndrome and insulin resistance in an urban and rural adult population in Sri Lanka
Original Metabolic paper syndrome and insulin resistance in an urban and rural adult population in Sri Lanka Metabolic syndrome and insulin resistance in an urban and rural adult population in Sri Lanka
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More informationChild born in year /3 will die before parents in US (diabetes)
Child born in year 2000-1/3 will die before parents in US (diabetes) ATP III identified 6 components of the metabolic syndrome that relate to CVD 1. Abdominal obesity 2. Atherogenic dyslipidemia (elevated
More informationManagement of Cardiovascular Disease in Diabetes
Management of Cardiovascular Disease in Diabetes Radha J. Sarma, MBBS, FACP. FACC. FAHA. FASE Professor of Internal Medicine Western University of Health Sciences. Director, Heart and Vascular Center Western
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationDiabetes: Definition Pathophysiology Treatment Goals. By Scott Magee, MD, FACE
Diabetes: Definition Pathophysiology Treatment Goals By Scott Magee, MD, FACE Disclosures No disclosures to report Definition of Diabetes Mellitus Diabetes Mellitus comprises a group of disorders characterized
More informationStandards of Medical Care in Diabetes 2016
Standards of Medical Care in Diabetes 2016 Care Delivery Systems 33-49% of patients still do not meet targets for A1C, blood pressure, or lipids. 14% meet targets for all A1C, BP, lipids, and nonsmoking
More informationDiabetes in Older Adults
Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More information