H. MOTAZEDIAN,*,1 H. NOYES,* AND R. MAINGON
|
|
- Susan Heath
- 5 years ago
- Views:
Transcription
1 EXPERIMENTAL PARASITOLOGY 83, (1996) ARTICLE NO RESEARCH BRIEF Leishmania and Sauroleishmania: The Use of Random Amplified Polymorphic DNA for the Identification of Parasites from Vertebrates and Invertebrates H. MOTAZEDIAN,*,1 H. NOYES,* AND R. MAINGON *Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, L3 5QA United Kingdom; and Department of Biological Sciences, Centre for Applied Parasitology and Entomology, Keele University, Staffordshire, United Kingdom MOTAZEDIAN, H., NOYES, H., AND MAINGON, R Leishmania and Sauroleishmania: The use of random amplified polymorphic DNA for the identification of parasites from vertebrates and invertebrates. Experimental Parasitology 83, We used the RAPD PCR method for distinguishing the main Old World Leishmania parasites Leishmania tropica, L. major, and L. infantum and applied it to Sauroleishmania species from Iran. Twelve out of 21 tested primers were suitable for identification of these parasites. The Jaccard similarity index was 0.30 for L. tropica and L. infantum as well as for L. major and L. infantum. The similarity coefficient for L. major and L. infantum was 0.22 and for L. tropica and L. major it was These data agree well with established phylogenetic/ taxonomic classification. The index between different isolates derived from various hosts and sandfly vectors for the same Leishmania species was 1, indicating that this method is suitable for epidemiological analysis Academic Press, Inc. INDEX DESCRIPTORS AND ABBREVIATIONS: Leishmania; L. infantum; L. major; L. tropica; Sergentomyia; random amplified polymorphic DNA; Sauroleishmania; S. gymnodactyli; S. tarentolae; Tatera; trypanosomatidae DNA, deoxyribonucleic acid; OTU, operational taxonomic unit; RAPD, random amplified polymorphic DNA; PCR, polymerase chain reaction; SSU rrna, Small subunit ribosomal ribonucleic acid. The RAPD PCR method was used to distinguish between the main Old World Leishmania parasites Leishmania tropica, L. major, and L. infantum and it was applied to Sauroleishmania species from Iran. Twenty-five primers were tested, 13 of which were suitable for identification of these parasites as they generated near identical fingerprints from strains of the same species isolated from various countries. The Jaccard similarity indices for these species, which may be used for the classification of Leishmania, agreed well with the same measure calculated from isoenzyme data. The epidemiology of Leishmania is complex and not fully understood; for the detailed studies required to elucidate the remaining problems, it is important to identify large numbers of isolates from a wide range of potential hosts and vectors across the full geographic range of the parasite. A number of biochemical methods are available for the identification and classification of Leishmania but none of them are ideal. Isoenzyme analysis has become the standard technique; however, it requires bulk in vitro culture of parasites and a relatively large range of reagents (Abderrazak et al. 1 Present address: Department of Microbiology, University of Medical Sciences, Shiraz, Iran. 1993). Monoclonal antibodies for the identification of Leishmania are not available for the majority of Old World species. As DNA is more chemically stable than both isoenzymes and antigens/antibodies, it has been the subject of intensive research for genetic markers suitable for Leishmania identification. DNA probes derived from the various DNA molecules have been developed (Bozza et al. 1995; Ellis and Crampton 1988; Guevara et al. 1992; Qiao et al. 1995; Ready et al. 1988), but are available for only a few species. The PCR offers very high sensitivity but resolution is lower than with isoenzymes, and PCR primers have been published only for L. major and the L. donovani complex of the Old World species (Ibrahim et al. 1994; Smyth et al. 1992). Recently the RAPD PCR method has attracted a great deal of interest (Caetano-Anolles, 1994; Tibayrenc et al. 1993; Waitumbi and Murphy 1993; Williams et al. 1990). It is relatively simple to perform, requires no prior knowledge of the parasite genome, and requires a minimal number of parasites. Furthermore it may be manipulated experimentally to yield information at the species or subspecies level. We have previously shown that RAPD can be useful for identifying members of a sandfly species complex (Adamson et al. 1993) and that it is useful for identifying and classifying members of the L. braziliensis complex (Noyes et al. 1995). We show here the results of a prelimi /96 $18.00 Copyright 1996 by Academic Press, Inc. All rights of reproduction in any form reserved. 150
2 MOTAZEDIAN, NOYES, AND MAINGON 151 TABLE I Parasite Stocks Species Strain number Identification 1 L. tropica MHOM/IR/60/LV357 a 2 L. tropica MHOM/IR/66/LV556 a 3 L. tropica MHOM/IR/89/ARD22 a 4 L. major MHOM/ET/XX/LV305 a 5 L. major MHOM/IR/59/LV 39 a 6 L. major MHOM/IR/XX/LV114 a 7 S. tarentolae RTAR/IT/XX/LV 35 a 8 S. gymnodactyli RAGE/SU/XX/LV 247 a 9 L. infantum MHOM/BE/67/ITMA263 a 10 L. infantum MHOM/FR/80/LEM 188 a 11 Unknown IPAP/IR/94/LMIRP1 L. major 12 Unknown MTAT/IR/94/LMIRR2 L. major 13 Unknown MHOM/SD/95/LMIRP3 L. major 14 Unknown MHOM/IR/94/LMIRP4 L. infantum 15 Unknown ISER/IR/94/SLIRP5 S. gymnodactyli 16 Unknown RLIZ/IR/94/SLIRP6 S. gymnodactyli nary study to investigate the application of RAPD to the problem of identifying the Leishmania and Sauroleishmania species found in Iran. Reference strains and recent isolates of L. tropica, L. major, L. infantum, Sauroleishmania gymnodactyli, and S. tarentolae used in this study are shown in Table I. DNA was isolated from the promastigote stage which had been in vitro cultured at 25 C in Schneider s insect medium (Sigma). Parasites ( ) were harvested by centrifugation (1000g, 10 min) and washed once with Locke s solution (150 mm NaCl, 6 mm KCl, 4 mm CaCl 2,2mMNaHCO 3,and5mM glucose). The pellet was resuspended in 100 l lysis buffer (150 mm Tris HCl ph 7.6, EDTA (ph 8), 0.5% v/v Tween 20, and 200 g/ml proteinase K) and incubated at 55 C for 1 hr. The lysate was extracted once with equal volumes of 1:1 (v/v) phenol:chloroform and once with 24:1 (v/v) chloroform:isoamylalcohol and precipitated by ethanol. The DNA was resuspended in 100 lof10mmtris HCl, 1 mm EDTA, and a 1:10 dilution was prepared in PCR grade water. Amplification reactions were done in a total volume of 25 l containing 20 mm (NH 4 ) 2 SO4, 75 mm Tris HCl, ph9, 0.01% (w/v) Tween 20, 2 mm MgCl 2, 200 M each deoxynucleotide triphosphate, 1 mm primer and 1 unit of Taq polymerase. One microliter of diluted DNA (approximately 5 ng) was added by centrifugation through the mineral oil overlay and the reaction was carried out in a thermocycler (Perkin Elmer or Omnigene, Hybaid) programmed at one cycle of 94 C, 2 min, followed by 30 cycles of 94 C, 30 sec; 36 C, 1 min; 72 C, 2 min. Twelve microliters of each reaction was run on 1.5% agarose gels and visualised under UV light with ethidium bromide. Primers used in this study are listed in Table II. Fingerprint patterns were compared by the Jaccard similarity coefficient which was calculated as described by Cibulskis et al. (1986). Twenty-five primers were tested for the amplification of reproducible species specific products. Thirteen of those primers generated at least five reproducible products each that could be visualised on an ethidium bromide stained gel (Table I). Figure 1 shows the fingerprints produced by primer M13( 40) with eight reference strains: two L. infantum isolated in Belgium France in 1967 and 1980, three L. major isolated from Ethiopia and Iran, and three L. tropica isolated Primer TABLE II PCR Primers Sequence M13( 40) a GTTTTCCCAGTCACGAC M13 a GTAAAACGACGGCCAGT A1 CAGGCCCTTC A4 GAAACGGGTG A8 GTGACGTAGG AB1-01 GTTTCGCTCC AB1-07 GGTGACGCAG AB1-09 TGGGGGACTC AB1-12 CCTTGACGCA AB1-14 TTCCCCCGCT AB1-15 GGAGGGTGTT AB1-18 CCACAGCAGT 3301 TCGTAGCCAA Note. Table II Primers that reliably amplified Leishmania and Sauroleishmania. Amplification was 1 cycle of 94 C, 2 min, followed by 30 cycles of 94 C, 30 sec; 36 C, 1 min; 72 C, 2 min, except for primers marked with an a, which were amplified as follows: 2 cycles of 94 C, 2 min; 40 C, 5 min; 72 C, 5 min, followed by 35 cycles of 94 C, 30 sec; 60 C, 1 min; 72 C, 2 min.
3 JOBNAME: JEP 83#1 96 PAGE: 3 SESS: 12 OUTPUT: Thu Jun 20 15:41: /xypage/worksmart/tsp000/70152f/6 152 RAPD FOR THE IDENTIFICATION OF Leishmania AND Sauroleischmania FIG. 1. RAPD products of primer M13 ( 40) with Leishmania reference strains separated on a 1.5% agarose gel. L. inf L. infantum; L. maj L. major, L. trop L. tropica. in Iran between 1960 and All strains produced species-specific patterns despite large separations in time and distance. With primer M13( 40) L. tropica shares a strong band at 900 bp with L. major and a band at 400 bp with L. infantum; however, all three species are readily distinguishable. The primers that produced fingerprints with the greatest difference between L. tropica and L. major were OP-A8 and AB1-12. Primers AB1-18 and AB1-14 gave the greatest difference between L. tropica and L. infantum. Four primers (AB1-12, AB1-14, AB1-18, and OP-A1) gave fingerprints with little similarity between L. major and L. infantum. Unknown parasite isolates were identified with primer AB1-18 as follows: LMIRP2 from the gerbil Tatera from Iran and LMIRP3 from a child from the Sudan were both L. major. LMIRP4 from a human case in Iran was L. infantum (Fig. 2). Although fingerprints were generally very reproducible, the range of product sizes did vary as can be seen from the L. major LV305 in Fig. 1, lane 5, in which the higher molecular weight bands (above 1000 bp) have not amplified. On other occasions products below 600 bp did not amplify. However, in a given run only higher or lower bands were lost but not both, so there was always a region in which comparison could be made with confidence. FIG. 2. RAPD products of primer AB1-18 with Leishmania reference strains and parasites isolated from humans, Sergentomyia and a lizard. L. inf, L. infantum; L. maj L. major; S. tar, Sauroleishmania tarentolae; S. gym Sauroleishmania gymnodactyli. All of the primers tested distinguished between any of the Leishmania from Iran and Sauroleishmania. which is found in sandflies in the same area. S. tarentolae and S. gymnodactyli were easily differentiated from each other using a variety of primers, as shown for the primer AB1-18 (Fig. 2). Two unknown flagellates isolated from Sergentomyia spp. (IRP5) and from a lizard (IRP6) were identified as S. gymnodactyli. L. tropica and S. tarentolae generated very similar fingerprint patterns (Fig. 2) emphasizing the intermediate nature of the latter lizard parasite which has been also described as L. tarentolae (Simpson and Simpson 1978). RAPD has not been found to be suitable for the comparison of distantly related species so this apparent similarity may not be an accurate representation of the relationship between the two genomes (Black 1993). There is very little comparative data on Sauroleishmania and Leishmania, but the two genera cannot be satisfactorily resolved using the sequence of the 18S SSU rrna gene (Briones et al. 1992; Marché et al. 1995). The genus Sauroleishmania was created on the basis of host and vector specificity and some biological characteristics at a time when very little comparative biochemical molecular biological data were available (Killick-Kendrick et al., 1986). We are currently examining a larger group of isolates to investigate the relationship between these genera (Noyes and Maingon, in preparation). The 13 primers listed in Table II were used to calculate
4 MOTAZEDIAN, NOYES, AND MAINGON 153 similarity coefficients (Table III). The Jaccard coefficient has values between 1, for identical OTUs, and 0, for OTUs with no similarity. Although a relatively limited number of isolates have been tested in this study, the values for the three pairs of Leishmania species studied ranged between 0.22 and 0.30, showing that RAPD PCR clearly differentiated between these species. The results obtained from reference strains are encouraging for the general applicability of the RAPD PCR as parasites of a given species collected in widely different places at different times gave consistently similar patterns. Although RAPD fingerprints can only be obtained from cultured parasites, sufficient parasites are available in the supernatant of the biphasic media that are routinely used for parasite isolation. As a single primer is sufficient for identification purposes, RAPD has considerable potential for epidemiological surveys in which it is necessary to combine identification to the species level with the capacity to process large numbers of samples. As RAPD can be used to identify any species for which reference stains are available without prior development work, it is valuable for the identification of lesser known species such as the Sauroleishmania shown here. Isoenzymes have been used to identify S. tarentolae but this requires bulk culture of parasites (Pozio et al. 1986). Since it has been reported that Sauroleishmania can cross react with Leishmania in the Montenegro skin test for at least 2 years after inoculation and may give some cross protection, the Sauroleishmania may have some epidemiological significance (Wilson and Southgate 1979). As stocks isolated from both invertebrate and vertebrate hosts appeared identical, RAPD could provide a useful tool for the further study of the ecology of these lesser known trypanosomatidae. RAPD must be used with caution for the classification of even closely related taxa, as some products of equal size may not be homologous. Furthermore the mix of conserved and variable sequences represented is not known and may vary between taxa (Black 1993). Nevertheless the values of the Jaccard coefficient found from the RAPD fingerprints compare well with others produced from isoenzyme data. Cibulskis et al. (1986) examined 280 Old World stocks with 13 enzymes; values of the Jaccard coefficient for the same pairs of species as examined in the present study were interpolated from their dendrograms. The values ranged between 0.24 and 0.31, compared with the values between 0.22 and 0.30 found in the present study. The same authors found the most closely related species to be either L. infantum and L. major or L. tropica and L. major, according to TABLE III Jaccard Similarity Coefficients between Leishmania Species Found in Iran L. tropica v. L. major 0.26 L. tropica v. L. infantum 0.30 L. major v. L. infantum 0.22 whether the data were analyzed by the average linkage or single linkage methods. In the present study L. infantum and L. tropica were most closely related, however, Lanotte et al. (1986) also found L. infantum and L. tropica to be the most closely related using three enzymes and 202 stocks. There are no reliable methods for determining the precise relationships between taxa that are almost equidistant from each other (Felsenstein 1988), so these discrepancies are not significant. RAPD has already proved useful in a study of the ecoepidemiology of L. braziliensis in Brazil (Gomez et al. 1995). We have previously shown that RAPD gives a classification of the L. braziliensis complex consistent with those generated by isoenzymes (Noyes et al. 1995). A fuller understanding of the epidemiology and ecology of Leishmania and Sauroleishmania will require large-scale highresolution studies of these parasites; we have shown here that RAPD can make a valuable contribution to those studies. (We are grateful to Drs. A. Rashti, N. Gavadian, G. H. Edrissian, and M. Mohebalia (Faculty of Public Health, Medical Sciences, University of Tehran) and Dr. M. Chance (LSTM, Liverpool), who supplied the parasites used in this study. Dr. H. Motazedian s research was financed under a Government of Iran Research Training Fellowship. The partial support of the International Scientific Cooperation Programme of the European Union (Grant CT ), which provided a Ph.D. studentship to H.N. is gratefully acknowledged.) REFERENCES ABDERRAZAK, S. B., GUERRINI, F., MATHIEU-DAUDÉ, F., TRUC, P., NEUBAUER, K., LEWICKA, K., BARNABÉ, C., AND TIBAYRENC, M Isoenzyme electrophoresis for parasite characterisation. In Protocols in Molecular Parasitology, pp Humana Press, Totowa, NJ. ADAMSON, R. E., WARD, R. D., FELICIANGELI, M. D., AND MAINGON, R The application of random amplified polymorphic DNA for sandfly species identification. Medical and Veterinary Entomology 7, BLACK, W. C., IV, PCR with arbitrary primers: Approach with care. Insect Molecular Biology 2, 1 6. BOZZA, M., FERNANDEZ, O., DEGRAVE, W. M., AND LOPES, U. G Characterization of Old World Leishmania species using amplified minicircle variable regions as molecular probes. Transactions of the Royal Society of Tropical Medicine and Hygiene 89, BRIONES, M. R., NELSON, K., BEVERLEY, S. M., AFFONSO, H. T., CAMARGO, E. P., AND FLOETER-WINTER, L. M Leishmania tarentolae taxonomic relatedness inferred from phylogenetic analysis of the small subunit ribosomal RNA gene. Molecular and Biochemical Parasitology 53, CAETANO-ANOLLES, G MAAP: A versatile and universal tool for genome analysis. Plant Molecular Biology 25, CIBULSKIS, R. E., PETERS, W., AND LE BLANQ, S. M
5 154 RAPD FOR THE IDENTIFICATION OF Leishmania AND Sauroleischmania Leishmania in the Old World: 5. Numerical analysis of isoenzyme data. Transactions of the Royal Society of Tropical Medicine and Hygiene 80, ELLIS, J., AND CRAMPTON, J Characterisation of a simple, highly repetitive DNA sequence from the parasite Leishmania donovani. Molecular and Biochemical Parasitology 29, FELSENSTEIN, J Phylogenies from molecular sequences: Inference and reliability. Annual Reviews of Genetics 22, GOMEZ, R. F., MACEDO, A. M., PENA, S. D. J., AND MELO, M. N Leishmania (Viannia) braziliensis: Genetic relationships between strains isolated from different areas of Brazil as revealed by DNA fingerprinting and RAPD. Experimental Parasitology 80, GUEVARA, P., ALONSO, G., DA SILVEIRA, J. F., DE MELLO, M., SCORZA, J. V., ANEZ, N., AND RAMIREZ, J. L Identification of New World Leishmania using ribosomal gene spacer probes. Molecular and Biochemical Parasitology 56, IBRAHIM, M. E., SMYTH, A. J., ALI, M. H., BARKER, D. C., AND KHARAZMI, A The polymerase chain reaction can reveal the occurrence of naturally mixed infections with Leishmania parasites. Acta Tropica 57, KILLICK-KENDRICK, R., LAINSON, R., RIOUX, J. A., AND SAF- JANOVA, V. M The taxonomy of Leishmania like parasites of reptiles. In Leishmania. Taxonomie et phylogenese. Applications ecoepidemiologique (J-A. Rioux, Ed.), pp , IMEEE, Montpellier. LANOTTE, G., RIOUX, J.-A., AND SERRES, E Approche cladistique du genre Leishmania Ross, A propos de 192 souches originaires de l ancien monde, analyse numérique de 50 zymodèmes identifiés par 15 enzymes et 96 isoenzymes. In Leishmania. Taxonomie et phylogenèse. Applications épidemiologiques (J-A. Rioux, Ed.), pp IMEEE, Montpellier. MARCHÉ, S., ROTH, C., PHILLIPE, H., DOLLET, M., AND BALTZ, T Characterisation and detection of plant trypanosomatids by sequence analysis of the small subunit ribosomal RNA gene. Molecular and Biochemical Parasitology 71, NOYES, H., BELLI, A., AND MAINGON, R Appraisal of various RAPD PCR primers for Leishmania identification. American Journal of Tropical Medicine and Hygiene, in press. POZIO, E., GRAMICCIA, M., GRADONI, L., AND MAROLI, M Hémoflagellés de Tarentola mauritanica L., 1758 (Reptilia, Gekkonidae). In Leishmania. Taxonomie et phylogenese (J-A. Rioux, Ed.), pp IMEEE, Montpellier. QIAO, Z., MILES, M., AND WILSON, S. M Detection of parasites of the Leishmania donovani complex by a polymerase chain reaction-solution hybridisation enzymelinked immunoassay (PCR SHELA). Parasitology 110, READY, P. D., SMITH, D. F., AND KILLICK-KENDRICK, R DNA hybridizations on squash-blotted sandflies to identify both Phlebotomus papatasi and infecting Leishmania major. Medical and Veterinary Entomology 2, SIMPSON, L., AND SIMPSON, A Kinetoplast RNA of Leishmania tarentolae. Cell 14, SMYTH, A. J., GHOSH, A., HASSAN, M. Q., BASU, D., DE- BRUIJN, M. H., ADHYA, S., MALLIK, K. K., AND BARKER, D. C Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of kalaazar patients. Parasitology 105, TIBAYRENC, M., NEUBAUER, K., BARNABE, C., GUERRINI, F., SKARECKY, D., AND AYALA, F. J Genetic characterization of six parasitic protozoa: Parity between random-primer DNA typing and multilocus enzyme electrophoresis. Proceedings of the National Academy of Sciences of the United States of America 90, WAITUMBI, J. N., AND MURPHY, N. B Inter- and intraspecies differentiation of trypanosomes by genomic fingerprinting with arbitrary primers. Molecular and Biochemical Parasitology 58, WILLIAMS, J. G. K., KUBELIK, A. R., LIVAK, K. J., RAFALSKI, J. A., AND TINGEY, S. V DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, WILSON, V. C. L. C., AND SOUTHGATE, B. A Lizard Leishmania. In Biology of the Kinetoplastida Vol. 2, pp , Academic Press, London. Received 6 September 1995; accepted with revision 13 December 1995
Evolution of the genus Leishmania revealed by comparison of DNA and RNA polymerase gene sequences 1
Molecular and Biochemical Parasitology 89 (1997) 149 159 Evolution of the genus Leishmania revealed by comparison of DA and RA polymerase gene sequences 1 David G. Croan, David A. Morrison, John T. Ellis
More informationAccepted 3 December 2003
African Journal of Biotechnology Vol. 3 (1), pp. 94-98, January 2004 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2004 Academic Journals Full Length Research Paper Characterization
More informationIsolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province
Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum
More informationPhylogenetic analysis of Trypanosomatina (Protozoa: Kinetoplastida) based on minicircle conserved regions
FOLIA PARASITOLOGICA 47: 1-5, 2000 Phylogenetic analysis of Trypanosomatina (Protozoa: Kinetoplastida) based on minicircle conserved regions Vyacheslav Yurchenko 1, 3, Alexander A. Kolesnikov 1 and Julius
More informationMore than 98 countries affected by Leishmaniasis
More than 98 countries affected by Leishmaniasis ACL In many urban & sub urban areas (8 provinces) Tehran, Mashhad, Neishabur, Shiraz, Kerman, Bam (Sharifi et al. 2011) ZCL In 2012, totally ( ZCL & ACL)
More informationT parasites which is transmitted by sandflies (Diptera; Psychodidae;
J. Euk. Microbiot.. 44(5). 1997 pp. 511-517 0 1997 by the Society of Protozoologists The Leishmania hertigi (Kinetoplastida; Trypanosomatidae) Complex and the : Their Classification and Evidence for a
More informationsandflies collected in Nepal.
NAOSITE: Nagasaki University's Ac Title Author(s) Citation Molecular detection of Leishmania p sandflies collected in Nepal. Pandey, Kishor; Pant, Shishir; Kanb Nasir; Mallik, Arun Kumar; Pandey, Tetsuo
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationDetection of Toxoplasma Parasitemia by PCR: Does it Correlate with IgG and IgM Antibody Titers?
Detection of Toxoplasma Parasitemia by : Does it Correlate with IgG and IgM Antibody Titers? Behzad Haghpanah 1, Mansoor Salehi 2, Shahram Sadri 1 1 Department of Parasitology and Mycology, 2 Department
More informationTereza C Orlando, Mary Anne T Rubio*, Nancy R Sturm*, David A Campbell*, Lucile M Floeter-Winter/ +
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 97(5): 695-701, July 2002 695 Intergenic and External Transcribed Spacers of Ribosomal RNA Genes in Lizard-infecting Leishmania: Molecular Structure and Phylogenetic
More informationComparison of light microscopy and nested PCR assay in detecting of malaria mixed species infections in an endemic area of Iran
Comparison of light microscopy and nested PCR assay in detecting of malaria mixed species infections in an endemic area of Iran Aliehsan Heidari, Manizheh Nourian, Hossein Keshavarz Associate Prof. Dept.
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationAbsence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary
Online Data Supplement Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary Arterial Hypertension Cornelia Henke-Gendo, Michael Mengel, Marius M. Hoeper, Khaled Alkharsah, Thomas
More informationMechanistic Studies of Pentamidine Analogs on Leishmania donovani Promastigotes
Mechanistic Studies of Pentamidine Analogs on Leishmania donovani Promastigotes Undergraduate Honors Thesis The Ohio State University, College of Pharmacy Division of Medicinal Chemistry and Pharmacognosy
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationH. NOYES *, F. PRATLONG, M. CHANCE, J. ELLIS, G. LANOTTE and J.-P. DEDET
A previously unclassified trypanosomatid responsible for human cutaneous lesions in Martinique (French West Indies) is the most divergent member of the genus Leishmania ss 17 H. NOYES *, F. PRATLONG, M.
More informationHuman Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment
Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in
More informationSummary of Cases & Epidemiology Aspects of Leishmaniasis in Thailand
Summary of Cases & Epidemiology Aspects of Leishmaniasis in Thailand Sukmee T. 1, Mungthin M. 2, Apiwathanasorn C. 3, Leelayoova S. 2 1 Department of Microbiology, Phramongkutklao College of Medicine 2
More informationHIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis
Product Manual HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis For research use only. Not for use in diagnostic procedures for clinical purposes Catalog
More informationAIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
More informationEpidemic Outbreak of Cutaneous Leishmaniasis due to Leishmania major in Ghanavat Rural District, Qom Province, Central Iran
Epidemic Outbreak of Cutaneous Leishmaniasis due to Leishmania major in Ghanavat Rural District, Qom Province, Central Iran *AA Akhavan 1, MR Yaghoobi-Ershadi 1, D Mehdipour 2, H Abdoli 3, B Farzinnia
More informationMorphological forms of hemoflagellates
Parasitology Lecture: 1 Hemoflagellates (blood and tissue flagellates) *Classification: - Sub-kingdom: Protozoa -Phylum: Sarcomastigophora -Sub-phylum: Mastigiphora -Class: Zoomastigophora د. رائد *Flagellates
More informationGenotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR
Genotype Variation in H. Pylori Isolates by RAPD-PCR Genotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR Siavoshi F Department of Microbiology, Faculty of Science, Tehran University
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationA pilot study on fingerprinting Leishmania species from the Old World using Fourier transform infrared spectroscopy
Analytical and Bioanalytical Chemistry Electronic Supplementary Material A pilot study on fingerprinting Leishmania species from the Old World using Fourier transform infrared spectroscopy Andrea Hornemann,
More informationPRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature
PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human
More informationFusarium strain identification in complex feeds from Romanian market
Volume 16(1), 207-211, 2012 JOURNAL of Horticulture, Forestry and Biotechnology www.journal-hfb.usab-tm.ro Fusarium strain identification in complex feeds from Romanian market Ioja-Boldura Oana Maria 1,
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationOVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria
More informationLaboratory diagnosis of Blood and tissue flagellates
Laboratory diagnosis of Blood and tissue flagellates (Leishmania and trypanosma) Sarah Alharbi Clinical Laboratory department Collage of Applied Medical Sciences King Saud University Leishmania and trypanosma:
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationAnnexure III SOLUTIONS AND REAGENTS
Annexure III SOLUTIONS AND REAGENTS A. STOCK SOLUTIONS FOR DNA ISOLATION 0.5M Ethylene-diamine tetra acetic acid (EDTA) (ph=8.0) 1M Tris-Cl (ph=8.0) 5M NaCl solution Red cell lysis buffer (10X) White cell
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationSingle-Step Multiplex PCR Assay for Characterization of New World Leishmania Complexes
JOURNAL OF CLINICAL MICROBIOLOGY, July 1998, p. 1989 1995 Vol. 36, No. 7 0095-1137/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Single-Step Multiplex PCR Assay for
More informationThe Leishmania Years at UNL (Or, My Life as a Cell Biologist, )
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Harold W. Manter Laboratory of Parasitology Parasitology, Harold W. Manter Laboratory of 1-22-2015
More informationIDENTIFICATION OF CRYPTOSPORIDIUM PARVUM GENOTYPE FROM HIV AND NON-HIV FECAL SAMPLES BY PCR
IDENTIFICATION OF CRYPTOSPORIDIUM PARVUM GENOTYPE FROM HIV AND NON-HIV FECAL SAMPLES BY PCR Zulhainan Hamzah 1, Songsak Petmitr 2, Mathirut Mungthin 3 and Porntip Chavalitshewinkoon-Petmitr 1 1 Department
More informationMasterPure RNA Purification Kit
Cat. No. MCR85102 The MasterPure RNA Purification Kit pro vides all of the reagents necessary to recover RNA from a wide variety of biological sources. This kit uses a rapid desalting process 1 to remove
More informationDiscovery and study of cutaneous leishmaniasis in Karamay of Xinjiang, West China
Guan et al. Infectious Diseases of poverty 2013, 2:20 SCOPING REVIEW Open Access Discovery and study of cutaneous leishmaniasis in Karamay of Xinjiang, West China Li-Ren Guan 1*, Yuan-Qing Yang 1, Jing-Qi
More informationNew genomic typing method MLST
New genomic typing method MLST Bon KIMURA fingerprinting PFGE DNA multilocus sequence typingmlst alleles PFGE MLST 1990 PCR 1 PCR DNA PFGE 1 PFGE RAPDrandomly amplified polymorphic DNA 3 AFLPAmplified
More informationChromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab)
Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Updated 12/3/02 Reagents: ChIP sonication Buffer (1% Triton X-100, 0.1% Deoxycholate, 50 mm Tris 8.1, 150 mm NaCl, 5 mm EDTA): 10 ml 10 % Triton
More informationOptimized PCR Using Patient Blood Samples For Diagnosis and Follow-Up of Visceral Leishmaniasis, with Special Reference to AIDS Patients
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2000, p. 236 240 Vol. 38, No. 1 0095-1137/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Optimized PCR Using Patient Blood Samples
More informationEastern Mediterranean Health Journal, Vol. 9, No. 4,
Eastern Mediterranean Health Journal, Vol. 9, No. 4, 2003 837 Antimony-resistant Leishmania donovani in eastern Sudan: incidence and in vitro correlation M.G. Abdo, 1 W.M. Elamin, 1 E.A.G. Khalil 1 and
More informationLaboratory diagnosis of congenital infections
Laboratory diagnosis of congenital infections Laboratory diagnosis of HSV Direct staining Tzanck test Immunostaining HSV isolation Serology PCR Tzanck test Cell scrape from base of the lesion smear on
More informationProtozoa from tissues. Leishmania spp. Naegleria fowleri Toxoplasma gondii Trichomonas vaginalis Trypanosoma spp.
Protozoa from tissues Leishmania spp. Naegleria fowleri Toxoplasma gondii Trichomonas vaginalis Trypanosoma spp. Leishmaniasis Leishmania infantum, Leishmania donovani, in macrophages of man. Female sandflies:
More informationThis is a repository copy of Detection of Leishmania infantum by PCR, serology and cellular immune response in a cohort study of Brazilian dogs.
This is a repository copy of Detection of Leishmania infantum by PCR, serology and cellular immune response in a cohort study of Brazilian dogs. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/1262/
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationLab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 67-73) and Biocontrol of Crown Gall (p. 113-117), Observation of Viral Movement in Plants (p. 119), and Intro section for Viruses (pp. 75-77).
More informationHAEMOFLAGELLATES. Dr. Anuluck Junkum Department of Parasitology Faculty of Medicine
HAEMOFLAGELLATES Dr. Anuluck Junkum Department of Parasitology Faculty of Medicine Objective Can describe the morphology, life cycle, pathology, diagnosis and prevention of Leishmania spp. and Trypanosoma
More informationMycoplasma Total Solution. Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free)
Mycoplasma Total Solution Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free) Mycoplasma Detection Mycoplasma Detection CellSafe s Mycoplasma Detection
More informationProtein Dephosphorylation Methods
Protein Dephosphorylation Methods Phosphospecific antibodies are designed to differentiate between the phosphorylated and the non-phosphorylated states of a protein. The method to determine if or how well
More informationEmergence of Cutaneous Leishmaniasis due to Leishmania major in a New Focus of Southern Iran
Original Article Emergence of Cutaneous Leishmaniasis due to Leishmania major in a New Focus of Southern Iran AA Akhavan 1, * MR Yaghoobi-Ershadi 1, F Hasibi 1, R Jafari 2, H Abdoli 3, MH Arandian 3, H
More informationby nexttec TM 1 -Step
Protocol DNA Isolation from Bacteria by nexttec TM 1 -Step - nexttec cleancolumns - Cat. No. 20N.010 Cat. No. 20N.050 Cat. No. 20N.250 Version 1.0 For research only Principle nexttec 1 -Step is the easiest
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-cfDNA Serum & Plasma Kit Catalog No. D4076 Highlights High-quality DNA, including cell-free, is easily and robustly purified from up to 10 ml of serum/plasma, up to 1 ml amniotic
More informationGenerating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
More informationLaboratory investigation of Cutaneous Leishmaniasis in Karachi
Laboratory investigation of Cutaneous Leishmaniasis in Karachi Pages with reference to book, From 248 To 250 G.M. Rajpar, M.A. Khan, A. Hafiz ( Department of Microbiology, Jinnah Postgraduate Medical Centre,
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationGeneaid DNA Isolation Kit
Instruction Manual Ver. 02.21.17 For Research Use Only Geneaid DNA Isolation Kit GEB100, GEB01K, GEB01K+ GEC150, GEC1.5K, GEC1.5K+ GET150, GET1.5K, GET1.5K+ GEE150, GEE1.5K, GEE1.5K+ Advantages Sample:
More informationP spectrum of human diseases, ranging from mild cutaneous
224 J. PROTOZOOL., VOL. 38, NO. 3, MAY-JUNE 1991 chromatin in mammalian chromosomes with a new fluochrome. Exp. d'acanthamoeba du groupe astronyxis-comandoni. J. Protozool., 19: Cell Rex, 75:122-126. 557-563.
More informationBlood Smears Only 6 October Sample Preparation and Quality Control 15B-K
NEW YORK STATE Parasitology Proficiency Testing Program Blood Smears Only 6 October 5 The purpose of the New York State Proficiency Testing Program in the category of Parasitology - Blood Smears Only is
More informationLab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 69-75) and Biocontrol of Crown Gall (p. 115-119), Observation of Viral Movement in Plants (p. 121), and Intro section for Viruses (pp. 77-79).
More informationCourse Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationPREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS
TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationASSESMENT OF CRYOPRESERVATION SYSTEMS INFLUENCE ON THE SURVAVIAL OF E. COLI RECOMBINANT STRAINS
Lucrări ştiinńifice Zootehnie şi Biotehnologii, vol. 41(1) (2008), Timişoara ASSESMENT OF CRYOPRESERVATION SYSTEMS INFLUENCE ON THE SURVAVIAL OF E. COLI RECOMBINANT STRAINS TESTAREA INFLUENłEI SISTEMELOR
More informationThe Most Common Parasitic Infections In Yemen. Medical Parasitology
The Most Common Parasitic Infections In Yemen Medical Parasitology ﻓﺎﯾز اﻟﺧوﻻﻧﻲ / د 2 : is a vector-borne disease that transmitted by sandflies and caused by obligate intracellular protozoa of the genus
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationInvestigations on the in vitro metacyclogenesis of a visceral and a cutaneous human strain of Leishmania infantum 1
Acta Tropica 70 (1998) 355 368 Investigations on the in vitro metacyclogenesis of a visceral and a cutaneous human strain of Leishmania infantum 1 Mostafa Louassini 2,a, Francisco Javier Adroher a, *,
More informationINSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents
INSTRUCTION MANUAL Catalog Nos. R1015 & R1016 Highlights Quick (5 minute) method for cleaning and concentrating RNA. Ideal for purification of RNA from aqueous phase following an acid phenol extraction.
More informationMidi Plant Genomic DNA Purification Kit
Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple
More informationOn the Importance of Validating Dientamoeba fragilis Real-Time PCR Assays. Dr Damien Stark Division of Microbiology St Vincent s Hospital
On the Importance of Validating Dientamoeba fragilis Real-Time PCR Assays Dr Damien Stark Division of Microbiology St Vincent s Hospital Dientamoeba fragilis D. fragilis is a protozoan parasite worldwide
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationEVALUATION OF A RAPID ASSAY FOR DETECTION OF IGM ANTIBODIES TO CHIKUNGUNYA
EVALUATION OF A RAPID ASSAY FOR DETECTION OF IGM ANTIBODIES TO CHIKUNGUNYA Pornpimol Rianthavorn 1,2, Norra Wuttirattanakowit 3, Kesmanee Prianantathavorn 1, Noppachart Limpaphayom 4, Apiradee Theamboonlers
More informationGenetic diversity among Trypanosoma brucei rhodesiense isolates from Tanzania
Genetic diversity among Trypanosoma brucei rhodesiense isolates from Tanzania 571 E. K. KOMBA,, S. N. KIBONA, A. K. AMBWENE, J. R. STEVENS, and W. C. GIBSON, * National Institute for Medical Research,
More informationINTRODUCTION PRODUCT DESCRIPTION
INTRODUCTION Mycoplasma are known as important contaminants of biological products derived from cell lines in the biopharmaceutical industry affecting every parameter of a cell culture system. Contaminated
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationThe Problem of Mixing up of Leishmania Isolates in the Laboratory: Suggestion of ITS1 Gene Sequencing for Verification of Species
Iranian J Parasitol: Vol. 6, No., 20, pp.4-48 Iranian J Parasitol Tehran University of Medical Sciences Publication http:// tums.ac.ir Open access Journal at http:// ijpa.tums.ac.ir Iranian Society of
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More information~DNA. s-ici-vs. DNAs-ici. extraction buffer~ RIZO Inc. User Manual. Ver. 1.0 DS for plant materials containing viscous substance
DNAs-ici s-ici-vs DS-0004 ~DNA extraction buffer~ for plant materials containing viscous substance User Manual Ver. 1.0 RIZO Inc. Table of Contents Page Key Features 2 Kit Components 2 Storage Conditions
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationMolecular Diagnosis Future Directions
Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular
More informationWork-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:
Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample
More informationDental Research Institute, Faculty of Dentistry, University of Toronto, Toronto, Canada *For correspondence:
Zymogram Assay for the Detection of Peptidoglycan Hydrolases in Streptococcus mutans Delphine Dufour and Céline M. Lévesque * Dental Research Institute, Faculty of Dentistry, University of Toronto, Toronto,
More informationRapid differentiation of mycobacterium tuberculosis and mycobacterium leprae from sputum by polymerase chain reaction
Original Article Nepal Medical College Journal 27; 9(1): Rapid differentiation of mycobacterium tuberculosis and mycobacterium leprae from sputum by polymerase chain reaction Bishwa Raj Sapkota, Chaman
More informationWhole Mount Drosophila Embryo In Situ Hybridization with RNA probes 2/5/2001 Leslie Vosshall
Whole Mount Drosophila Embryo In Situ Hybridization with RNA probes 2/5/2001 Leslie Vosshall DAY ONE All incubations are done at room temperature unless otherwise noted. All solutions and all containers
More informationNOMENCLATURE & CLASSIFICATION OF PLANT VIRUSES. P.N. Sharma Department of Plant Pathology, CSK HPKV, Palampur (H.P.)
NOMENCLATURE & CLASSIFICATION OF PLANT VIRUSES P.N. Sharma Department of Plant Pathology, CSK HPKV, Palampur (H.P.) What is the purpose of classification? To make structural arrangement comprehension for
More informationAperto Cell Lysis and Protein Solubilization Users Manual
Aperto Cell Lysis and Protein Solubilization Users Manual Revision 2 THIS MANUAL APPLIES TO THE FOLLOWING PRODUCTS: 3A8600 Aperto, 5X Cell Lysis Buffer. 20mL 3A8610 Aperto, 5X Cell Lysis Buffer. 100mL
More informationAntibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.
Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,
More informationE.Z.N.A. SQ Blood DNA Kit II. Table of Contents
E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More information