List of Figures. List of Tables
|
|
|
- Elmer Horton
- 6 years ago
- Views:
Transcription
1 Supporting Information for: Signaling Domain of Sonic Hedgehog as Cannibalistic Calcium-Regulated Zinc-Peptidase Rocio Rebollido-Rios 1, Shyam Bandari 3, Christoph Wilms 1, Stanislav Jakuschev 1, Andrea Vortkamp 2, Kay robe 3, Daniel Hoffmann 1, 1 Research roup Bioinformatics, Faculty of Biology, Center of Medical Biotechnology, University of Duisburg-Essen, Essen, ermany 2 Department of Developmental Biology, Faculty of Biology, Center of Medical Biotechnology, University of Duisburg-Essen, Essen, ermany 3 Institute of Physiological Chemistry and Pathobiochemistry, Faculty of Medicine, University of Münster, Münster, ermany kgrobe@uni-muenster.de, daniel.hoffmann@uni-due.de List of Figures 1 B-factors Backbone RMSDs Calcium binding and zinc center geometry Docking of cholesterol Distance of Zn 2+ and water Water, zinc, ligand angle Electrostatics at CDO binding site Zinc and flexibility ShhN mutant stabilities at ph 5 and List of Tables 1 RMSF and calcium state RMSDs between LAS enzymes and ShhN Comparison with 2vo Comparison with 1u Comparison with 1r Comparison between MDs of LAS 1lbu and ShhN MDs of LAS 2vo9 vs. ShhN Distances of E127 and H
2 9 Distances of H135 and E Docking without catalytic water Docking with catalytic water pka of calcium ligands Position of Zn-co-ordinating water in vitro results Primer sequences Figures A B B factors (Backbone) L1 L2 L3 B factors (Backbone) L1 L2 L Residue number Residue number C D L2 L3 B factors (Backbone) L1 L2 L3 B factors (Backbone) L Residue number Residue number Figure 1: B-factors from molecular dynamics simulations of ShhN in states Ca2 Ihog (A), Ca2 Hhip (B), Ca0 (C), and Ca1 (D). The green curves show the corresponding experimental B-factors. 2
3 A 0.30 B RMSDs RMSDs Ca2 Ihog Ca1 Ca2 Hhip Ca0 Shh proteins Ca2 Ihog Ca1 Ca2 Hhip Ca0 Shh proteins C D RMSDs RMSDs Ca2 Ihog Ca1 Ca2 Hhip Ca0 Shh proteins Ca2 Ihog Ca2 Hhip Ca1 Ca0 Shh proteins Figure 2: Backbone RMSDs between, on one hand, the four different X- ray structures representative of Ca2 Ihog (3d1m, panel A), Ca2 Hhip (2wfx, B), Ca0 (1vhh, C), Ca1 (3n1r, D), and, on the other hand, MD trajectories of ShhN in these states; e.g. the first boxplot (grey) in panel A gives the RMSD between 3d1m and an MD trajectory based on 3d1m. Boxplots within each of the four panels are sorted according to ascending median of RMSD. 3
4 Bond distance E54 H Bond distance 128 H Ca0 Ca1 Ca2 Shh proteins Ca0 Ca1 Ca2 Shh proteins Figure 3: Effect of calcium binding on geometry of interactions that stabilize the zinc center. Shown are the distributions of distances (in nm; sampled by MD simulations) between carboxylate or carbonyl groups and histidine imidazole rings that co-ordinate the zinc. Left: the distance between groups from E54 and H183, both distal to the Ca 2+ binding site, is barely affected by Ca 2+ binding. Right: Binding of the Ca2 calcium ion breaks the hydrogen bond between 128 carbonyl and H141 imidazole N-H. 4
5 A B Figure 4: Docking of cholesterol to ShhN (1vhh), without zinc coordinating water (A), and with zinc co-ordinating water (B). The best (green) and second best (blue) poses are shown. 5
6 Distance : H 2 O ZN Simulation time (ns) Ca0 Ca1 Ca2 Figure 5: Distance between zinc ion and oxygen of water molecule close to the position of the putative catalytic water. 6
7 Frequency Ca0 Ca1 Ca Angle : H 2 O ZN H183NE2 Figure 6: Histogram of angle (in degrees) between oxygen of putative catalytic water, zinc ion, and zinc ligand N δ1 of H183 as sampled by MD simulations. The green line marks the angle measured in the X-ray structure 1vhh [1]. 7
8 Figure 7: Electrostatics of ShhN states Ca0 (left), Ca1 (center), and Ca2 (right). Electrostatic potential on the surface of ShhN is color-coded between high (blue) and low (red). The circle encloses the loop where the calcium ions are bound, which is approximately the binding site of CDO. Calcium and zinc ions are depicted as green and yellow spheres, respectively. Electrostatic potential were scaled to the range of -5 (red) and 5 kt/e (blue). 8
9 RMSD values (nm) Zinc bound form Zinc free form Figure 8: Effect of zinc ion on RMSD based on PDB entry 1vhh. The RMSD (in nm) of the structure with Zn 2+ (left boxplot) is clearly lower than that without Zn 2+ (right boxplot), in agreement with experiment [2]. Whiskers and edges of boxplots mark quartiles of sampled RMSD values, bold bar in the colored boxes is the median. 9
10 ph: 5 x177: A ph: 5 x177: E ph: 6 x177: A ph: 6 x177: E 90 % protein time (h) Figure 9: In vitro tests of ShhN mutant stabilities against proteolysis at ph 5 and ph 6. The content of ShhN mutant proteins Pep + (E177) and Pep (E177A) over time is shown relative to the maximum protein content of the respective measurement series (data as in Table 15 of this supporting information). ph is 5 in the first two panels and 6 in the last two. The first and third panel refer to the E177A mutant Pep, the second and fourth to the mutant Pep + with wild type catalytic E177. Box elements (upper and lower whisker, upper and lower box) at each time point indicate quartiles of measured values, single points are outliers. Colors encode time points for easier comparison between panels. 10
11 Tables Mean RMSF p-values (nm) Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Ca2 Ihog Table 1: Mean values of RMSFs from Figure 1 of main text, and p-values from Wilcoxon rank sum tests with null hypotheses that there is no shift between RMSF distributions in the compared pairs of states. p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 2: P-values of RMSD comparisons (Wilcoxon tests) between zinc center of LAS enzyme X-ray structure 1lbu and zinc centers of ShhN in MD simulations of states Ca0, Ca1, Ca2 Hhip, and Ca2 Ihog (see Figure 4A of main text). p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 3: As Table 2, but referring to X-ray structure of LAS enzyme 2vo9. 11
12 p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 4: As Table 2, but referring to X-ray structure of LAS enzyme 1u10. p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 5: As Table 2, but referring to X-ray structure of LAS enzyme 1r44. 12
13 p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 6: P-values of RMSD comparisons (Wilcoxon tests) between zinc center of LAS enzyme structure 1lbu and zinc centers of ShhN in states Ca0, Ca1, Ca2 Hhip, and Ca2 Ihog (see Figure 4B of main text). In contrast to Table 2, the structures of the zinc centers of both the LAS enzyme and ShhN are taken from MD simulations of the respective proteins. p-values Ca1 Ca2 Hhip Ca2 Ihog Ca Ca Ca2 Hhip Table 7: As Table 6, but for comparison of LAS enzyme 2vo9 and ShhN. 13
14 Ca 2+ state Min. 1st Qu. Median Mean 3rd Qu. Max. Ca Ca Table 8: Distribution of distances (in nm) between carboxylate-o of E127 and imidazole proton of H135, along the charged hydrogen bond between these groups. iven are the mean distance and the distances demarcating the quartiles, both for Ca0 and Ca2, corresponding to vertical axis of Figure 5B of main text. There is little change between the states, i.e. the H-bond is conserved. Ca 2+ state Min. 1st Qu. Median Mean 3rd Qu. Max. Ca Ca Table 9: Distribution of distances (in nm) between side chains of H135 and E177, the catalytic clamp. iven are the mean distance and the distances demarcating the quartiles, both for Ca0 and Ca2, corresponding to horizontal axis of Figure 5B of main text. The comparison shows that the clamp opens from Ca0 to Ca2, and that it becomes more flexible. 14
15 Modes Affinity (kcal/mol) RMSD l.b RMSD u.b Table 10: Summary of docking results of cholesterol to the surface of ShhN, without zinc co-ordinating water molecule. Affinity (kcal/mol): the affinity estimate by AutoDock vina. The two RMSD columns give the root mean square deviation between the respective docking pose and the docking pose with best affinity (top ranking pose); l.b is a lower bound of RMSD, considering matches between atoms of same type, while u.b is an upper bound, computed for matches between exactly equivalent atoms according to the chosen numbering of atoms in the ligand. 15
16 Modes Affinity (kcal/mol) RMSD l.b RMSD u.b Table 11: Same as Table 10, but including the zinc co-ordinating water molecule as in X-ray structure 1vhh. 16
17 Residues Ca0 state Ca2 state E E D E D D Table 12: Predicted pk a values for calcium ligands in Ca0 (1vhh) and Ca2 states (3d1m). PDB entries Ligands Angles X Y Z O-Zn-X O-Zn-Y O-Zn-Z 1vhh H141 D148 H lbu H154 D161 H vo9 H80 D87 H r44 H116 D123 H tln H142 H146 E Table 13: The position of the Zn-co-ordinating water in ShhN (1vhh), three LAS enzymes (1lbu, 2vo9, 1r44), and thermolysin (8tln). Angles refer to positions of water oxygen, zinc ion, and closest oxygen (Asp, lu) or nitrogen (His) atoms of co-ordinating amino acids. 17
18 Table 14: Results of in vitro experiments with mutants Pep + (x177=e) and Pep (x177=a). Time is given in hours and protein is percent of maximum protein content in the respective experiment. x177,ph,time,protein E,6,0,100 E,6,0,94 E,6,0,100 E,5,0,100 E,5,0,100 E,5,0,100.1 E,5,0,100 E,5,0,100 A,6,0,100 A,6,0,100 A,6,0,93 A,5,0,100 A,5,0,100 A,5,0,100.1 A,5,0,100 A,5,0,100 E,6,3,101 E,6,3,94 E,6,3,93 E,5,3,50 E,5,3,98 E,5,3,81 E,5,3,20 E,5,3,15 A,6,3,95 A,6,3,110 A,6,3,83 A,5,3,91 A,5,3,85 A,5,3,89 A,5,3,81 A,5,3,87 x177,ph,time,protein E,6,6,96 E,6,6,100 E,6,6,97 E,5,6,26 E,5,6,60 E,5,6,50 E,5,6,9 E,5,6,1 A,6,6,95 A,6,6,99 A,6,6,99 A,5,6,65 A,5,6,94 A,5,6,65 A,5,6,58 A,5,6,57 E,6,18,96 E,6,18,98 E,6,18,100 E,5,18,3 E,5,18,18 E,5,18,7 E,5,18,2 E,5,18,1 A,6,18,95 A,6,18,100 A,6,18,89 A,5,18,45 A,5,18,81 A,5,18,59 A,5,18,27 A,5,18,29 18
19 Table 15: Primer sequences for Pep + and Pep mutants. Catalytic residue knockout mutant primers: E177A_Sense: CACTTCTACTATCATCCAAACTCACATCC E177A_Antisense: ATTACTTTATCATATAACCCATC Calcium binding pocket mutant primers: E90 and 91A_Sense: CACATCATATTTAAATCCAAACACACAACC E90 and 91A_Antisense: TCTCTCCCTTTTCCCATCCTTAAATATATTC E127A_Sense: CTCATACCCCTATA E127A_Antisense: CTCATCCCACCCCTCACTCCA 19
20 References 1. Hall TM, Porter JA, Beachy PA, Leahy DJ (1995) A potential catalytic site revealed by the 1.7-Å crystal structure of the amino-terminal signalling domain of sonic hedgehog. Nature 378: Day ES, Wen D, arber EA, Hong J, Avedissian LS, et al. (1999) Zincdependent structural stability of human sonic hedgehog. Biochemistry 38:
SUPPLEMENTARY INFORMATION. Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity
SUPPLEMENTARY INFORMATION Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity Christopher Woods 1, Maturos Malaisree 1, Ben Long 2, Simon McIntosh-Smith
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels. Supplementary Information
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels Craig T. Armstrong, Philip E. Mason, J. L. Ross Anderson and Christopher E. Dempsey
Table S1: Kinetic parameters of drug and substrate binding to wild type and HIV-1 protease variants. Data adapted from Ref. 6 in main text.
Dynamical Network of HIV-1 Protease Mutants Reveals the Mechanism of Drug Resistance and Unhindered Activity Rajeswari Appadurai and Sanjib Senapati* BJM School of Biosciences and Department of Biotechnology,
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman
Supplementary Information A Hydrophobic Barrier Deep Within the Inner Pore of the TWIK-1 K2P Potassium Channel Aryal et al.
Supplementary Information A Hydrophobic Barrier Deep Within the Inner Pore of the TWIK-1 K2P Potassium Channel Aryal et al. Supplementary Figure 1 TWIK-1 stability during MD simulations in a phospholipid
Molecular Dynamics Simulation Study Explaining Inhibitor Selectivity in Different Class of Histone Deacetylases
Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 29, Issue Number 4, (2012) Adenine Press (2012) Abstract Molecular Dynamics Simulation Study Explaining Inhibitor Selectivity in Different
SUPPORTING INFORMATION FOR. A Computational Approach to Enzyme Design: Using Docking and MM- GBSA Scoring
SUPPRTING INFRMATIN FR A Computational Approach to Enzyme Design: Predicting ω- Aminotransferase Catalytic Activity Using Docking and MM- GBSA Scoring Sarah Sirin, 1 Rajesh Kumar, 2 Carlos Martinez, 2
Crystal Structure of the Subtilisin Carlsberg: OMTKY3 Complex
John Clizer & Greg Ralph Crystal Structure of the Subtilisin Carlsberg: OMTKY3 Complex The turkey ovomucoid third domain (OMTKY3) is considered to be one of the most studied protein inhibitors. 1 Ovomucin
Lecture 10 More about proteins
Lecture 10 More about proteins Today we're going to extend our discussion of protein structure. This may seem far-removed from gene cloning, but it is the path to understanding the genes that we are cloning.
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,
Excerpt from J. Mol. Biol. (2002) 320, :
Excerpt from J. Mol. Biol. (2002) 320, 1095 1108: Crystal Structure of the Ternary Complex of the Catalytic Domain of Human Phenylalanine Hydroxylase with Tetrahydrobiopterin and 3-(2-Thienyl)-L-alanine,
Supplementary Material
Supplementary Material Materials and methods Enzyme assay The enzymatic activity of -glucosidase toward salicin was measured with the Miller method (Miller, 1959) using glucose as the standard. A total
Secondary Structure North 72nd Street, Wauwatosa, WI Phone: (414) Fax: (414) dmoleculardesigns.com
Secondary Structure In the previous protein folding activity, you created a generic or hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously
3.2 Ligand-Binding at Nicotinic Acid Receptor Subtypes GPR109A/B
3.2 Ligand-Binding at Nicotinic Acid Receptor Subtypes GPR109A/B 3.2.1 Characterization of the Ligand Binding Site at GPR109A Receptor Ligands of GPR109A Receptor are Carboxylic Acids Nicotinic acid (pyridine-3-carboxylic
Supplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
Supplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors Jan Jakubík, Alena Randáková, Pavel Zimčík, Esam E. El-Fakahany, and Vladimír
PHAR3316 Pharmacy biochemistry Exam #2 Fall 2010 KEY
1. How many protons is(are) lost when the amino acid Asparagine is titrated from its fully protonated state to a fully deprotonated state? A. 0 B. 1 * C. 2 D. 3 E. none Correct Answer: C (this question
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 The UBL and RING1 interface remains associated in the complex structures of Parkin and pub. a) Asymmetric Unit of crystal structure of UBLR0RBR and pub complex showing UBL (green),
Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.
Supplementary Figure 1 Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site. (a) Gel filtration profiles of purified 5 TMD samples at 100 nm, heated beforehand for
Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction
Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction Amir Barati Farimani, Mohammad Heiranian, Narayana R. Aluru 1 Department
Biology 2E- Zimmer Protein structure- amino acid kit
Biology 2E- Zimmer Protein structure- amino acid kit Name: This activity will use a physical model to investigate protein shape and develop key concepts that govern how proteins fold into their final three-dimensional
Protein Primer, Lumry I, Chapter 10, Enzyme structure, middle
Protein Primer, Lumry I, Chapter 10, Enzyme structure, 5-15-03 10-1 Chapter 10. Enzyme structure A major feature of the trypsin family of proteases is the palindromic pattern taken by the B factors of
The role of Ca² + ions in the complex assembling of protein Z and Z-dependent protease inhibitor: A structure and dynamics investigation
www.bioinformation.net Hypothesis Volume 8(9) The role of Ca² + ions in the complex assembling of protein Z and Z-dependent protease inhibitor: A structure and dynamics investigation Zahra Karimi 1 *,
Table S1. X-ray data collection and refinement statistics
Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,
Secondary Structure. by hydrogen bonds
Secondary Structure In the previous protein folding activity, you created a hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously folds
Understandable Statistics
Understandable Statistics correlated to the Advanced Placement Program Course Description for Statistics Prepared for Alabama CC2 6/2003 2003 Understandable Statistics 2003 correlated to the Advanced Placement
Bioinformatics for molecular biology
Bioinformatics for molecular biology Structural bioinformatics tools, predictors, and 3D modeling Structural Biology Review Dr Research Scientist Department of Microbiology, Oslo University Hospital -
Nature Structural & Molecular Biology: doi: /nsmb.1933
The structural basis of open channel block in a prokaryotic pentameric ligand-gated ion channel Ricarda J. C. Hilf, Carlo Bertozzi, Iwan Zimmermann, Alwin Reiter, Dirk Trauner and Raimund Dutzler a GLIC
Introduction to Protein Structure Collection
Introduction to Protein Structure Collection Teaching Points This collection is designed to introduce students to the concepts of protein structure and biochemistry. Different activities guide students
HOMEWORK II and Swiss-PDB Viewer Tutorial DUE 9/26/03 62 points total. The ph at which a peptide has no net charge is its isoelectric point.
BIOCHEMISTRY I HOMEWORK II and Swiss-PDB Viewer Tutorial DUE 9/26/03 62 points total 1). 8 points total T or F (2 points each; if false, briefly state why it is false) The ph at which a peptide has no
SDS-Assisted Protein Transport Through Solid-State Nanopores
Supplementary Information for: SDS-Assisted Protein Transport Through Solid-State Nanopores Laura Restrepo-Pérez 1, Shalini John 2, Aleksei Aksimentiev 2 *, Chirlmin Joo 1 *, Cees Dekker 1 * 1 Department
(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
NIH Public Access Author Manuscript J Am Chem Soc. Author manuscript; available in PMC 2008 September 29.
NIH Public Access Author Manuscript Published in final edited form as: J Am Chem Soc. 2006 March 8; 128(9): 2812 2813. doi:10.1021/ja058211x. HIV-1 protease flaps spontaneously close to the correct structure
Chymotrypsin Lecture. Aims: to understand (1) the catalytic strategies used by enzymes and (2) the mechanism of chymotrypsin
Chymotrypsin Lecture Aims: to understand (1) the catalytic strategies used by enzymes and (2) the mechanism of chymotrypsin What s so great about enzymes? They accomplish large rate accelerations (10 10-10
6. The catalytic mechanism of arylsulfatase A and its theoretical investigation
6. The catalytic mechanism of arylsulfatase A and its theoretical investigation When the crystal structure of arylsulfatase A was solved, a remarkable structural analogy to another hydrolytic enzyme, the
Charges on amino acids and proteins. ph 1. ph 7. Acidic side chains: glutamate and aspartate
harges on amino acids and proteins Acidic side chains: glutamate and aspartate A A- + + + - + Basic side chains: arginine, lysine & histidine Glycine @ p 1 B+ B + + + The amino group, pka 9.6 3 N+ The
Biochemistry - I. Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture 1 Amino Acids I
Biochemistry - I Prof. S. Dasgupta Department of Chemistry Indian Institute of Technology, Kharagpur Lecture 1 Amino Acids I Hello, welcome to the course Biochemistry 1 conducted by me Dr. S Dasgupta,
Statin inhibition of HMG-CoA reductase: a 3-dimensional view
Atherosclerosis Supplements 4 (2003) 3/8 www.elsevier.com/locate/atherosclerosis Statin inhibition of HMG-CoA reductase: a 3-dimensional view Eva Istvan * Department of Molecular Microbiology, Howard Hughes
IN-SILICO APPROACH FOR THE ASSESSMENT OF ORAL CANCER PROPERTY ON LIMONIA ACIDISSIMA
IJPSR (2016), Vol. 7, Issue 3 (Research Article) Received on 16 September, 2015; received in revised form, 29 October, 2015; accepted, 12 December, 2015; published 01 March, 2016 IN-SILICO APPROACH FOR
Modeling holo-acp:dh and holo-acp:kr complexes of modular polyketide synthases: a docking and molecular dynamics study
Anand and Mohanty BMC Structural Biology 2012, 12:10 RESEARCH ARTICLE Open Access Modeling holo-acp:dh and holo-acp:kr complexes of modular polyketide synthases: a docking and molecular dynamics study
Supplementary Table 1. Data collection and refinement statistics (molecular replacement).
Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2
obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and in a
Supplementary Figure S1. Distribution of atoms along the bilayer normal. Normalized density profiles obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and
Guided Inquiry Skills Lab. Additional Lab 1 Making Models of Macromolecules. Problem. Introduction. Skills Focus. Materials.
Additional Lab 1 Making Models of Macromolecules Guided Inquiry Skills Lab Problem How do monomers join together to form polymers? Introduction A small number of elements make up most of the mass of your
2. Which of the following amino acids is most likely to be found on the outer surface of a properly folded protein?
Name: WHITE Student Number: Answer the following questions on the computer scoring sheet. 1 mark each 1. Which of the following amino acids would have the highest relative mobility R f in normal thin layer
Interactions of Polyethylenimines with Zwitterionic and. Anionic Lipid Membranes
Interactions of Polyethylenimines with Zwitterionic and Anionic Lipid Membranes Urszula Kwolek, Dorota Jamróz, Małgorzata Janiczek, Maria Nowakowska, Paweł Wydro, Mariusz Kepczynski Faculty of Chemistry,
Porphyrins: Chemistry and Biology
Porphyrins: Chemistry and Biology 20.109 Lecture 6 24 February, 2011 Goals Explore some essential roles of heme in biology Appreciate how ature has used the same cofactor to achieve diverse functions Gain
P450 CYCLE. All P450s follow the same catalytic cycle of;
P450 CYCLE All P450s follow the same catalytic cycle of; 1. Initial substrate binding 2. First electron reduction 3. Oxygen binding 4. Second electron transfer 5 and 6. Proton transfer/dioxygen cleavage
BIOCHEMISTRY I HOMEWORK III DUE 10/15/03 66 points total + 2 bonus points = 68 points possible Swiss-PDB Viewer Exercise Attached
BIOCHEMISTRY I HOMEWORK III DUE 10/15/03 66 points total + 2 bonus points = 68 points possible Swiss-PDB Viewer Exercise Attached 1). 20 points total T or F (2 points each; if false, briefly state why
Project Manual Bio3055. Cholesterol Homeostasis: HMG-CoA Reductase
Project Manual Bio3055 Cholesterol Homeostasis: HMG-CoA Reductase Bednarski 2003 Funded by HHMI Cholesterol Homeostasis: HMG-CoA Reductase Introduction: HMG-CoA Reductase is an enzyme in the cholesterol
Predicting Inactive Conformations of Protein Kinases Using Active Structures: Conformational Selection of Type-II Inhibitors
Predicting Inactive Conformations of Protein Kinases Using Active Structures: Conformational Selection of Type-II Inhibitors Min Xu, Lu Yu, Bo Wan, Long Yu, Qiang Huang* State Key Laboratory of Genetic
PAPER No. : 16, Bioorganic and biophysical chemistry MODULE No. : 22, Mechanism of enzyme catalyst reaction (I) Chymotrypsin
Subject Paper No and Title 16 Bio-organic and Biophysical Module No and Title 22 Mechanism of Enzyme Catalyzed reactions I Module Tag CHE_P16_M22 Chymotrypsin TABLE OF CONTENTS 1. Learning outcomes 2.
Rapid Characterization of Allosteric Networks. with Ensemble Normal Mode Analysis
Supporting Information Rapid Characterization of Allosteric Networks with Ensemble Normal Mode Analysis Xin-Qiu Yao 1, Lars Skjærven 2, and Barry J. Grant 1* 1 Department of Computational Medicine and
Bio 100 Serine Proteases 9/26/11
Assigned Reading: 4th ed. 6.4.1 The Chymotrypsin Mechanism Involves Acylation And Deacylation Of A Ser Residue p. 213 BOX 20-1 Penicillin and β-lactamase p. 779 6.5.7 Some Enzymes Are Regulated By Proteolytic
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10913 Supplementary Figure 1 2F o -F c electron density maps of cognate and near-cognate trna Leu 2 in the A site of the 70S ribosome. The maps are contoured at 1.2 sigma and some of
During the last half century, much effort has been devoted
Membranes serve as allosteric activators of phospholipase A 2, enabling it to extract, bind, and hydrolyze phospholipid substrates Varnavas D. Mouchlis a,b,1, Denis Bucher b, J. Andrew McCammon a,b,c,1,
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.aal4326/dc1 Supplementary Materials for Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution Huaizong Shen, Qiang Zhou, Xiaojing
Catalysis & specificity: Proteins at work
Catalysis & specificity: Proteins at work Introduction Having spent some time looking at the elements of structure of proteins and DNA, as well as their ability to form intermolecular interactions, it
Introduction to proteins and protein structure
Introduction to proteins and protein structure The questions and answers below constitute an introduction to the fundamental principles of protein structure. They are all available at [link]. What are
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
Note: Please use the actual date you accessed this material in your citation.
MIT OpenCourseWare http://ocw.mit.edu 5.111 Principles of Chemical Science, Fall 2005 Please use the following citation format: Sylvia Ceyer and Catherine Drennan, 5.111 Principles of Chemical Science,
Chemical Mechanism of Enzymes
Chemical Mechanism of Enzymes Enzyme Engineering 5.2 Definition of the mechanism 1. The sequence from substrate(s) to product(s) : Reaction steps 2. The rates at which the complex are interconverted 3.
BIOCHEMISTRY 460 FIRST HOUR EXAMINATION FORM A (yellow) ANSWER KEY February 11, 2008
WRITE YOUR AND I.D. NUMBER LEGIBLY ON EVERY PAGE PAGES WILL BE SEPARATED FOR GRADING! CHECK TO BE SURE YOU HAVE 6 PAGES, (print): ANSWERS INCLUDING COVER PAGE. I swear/affirm that I have neither given
MCB 102 Discussion, Spring 2012
MB Discussion, Spring 2012 Practice Problems 1. Effect of enzymes on reactions Which of the listed effects would be brought about by any enzyme catalyzing the following simple reaction? k 1 S P where K
CS612 - Algorithms in Bioinformatics
Spring 2016 Protein Structure February 7, 2016 Introduction to Protein Structure A protein is a linear chain of organic molecular building blocks called amino acids. Introduction to Protein Structure Amine
Workshop on Analysis and prediction of contacts in proteins
Workshop on Analysis and prediction of contacts in proteins 1.09.09 Eran Eyal 1, Vladimir Potapov 2, Ronen Levy 3, Vladimir Sobolev 3 and Marvin Edelman 3 1 Sheba Medical Center, Ramat Gan, Israel; Departments
Available Online through
ISS: 0975-766X CDE: IJPTFI Available nline through Research Article www.ijptonline.com RELATISHIP BETWEE SCRIG FUCTI AD THE IC 50 IHIBITRY F PI3K IHIBITRS Awantika Shrivastava*, Dr.K.Durga Prasad 1, Dr.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. (a) Uncropped version of Fig. 2a. RM indicates that the translation was done in the absence of rough mcirosomes. (b) LepB construct containing the GGPG-L6RL6-
Chemical Nature of the Amino Acids. Table of a-amino Acids Found in Proteins
Chemical Nature of the Amino Acids All peptides and polypeptides are polymers of alpha-amino acids. There are 20 a- amino acids that are relevant to the make-up of mammalian proteins (see below). Several
Design and Modeling Studies on Liriodenine derivatives as novel topoisomerase II inhibitors
International Journal of ChemTech Research CODEN( USA): IJCRGG ISSN : 0974-4290 Vol. 3, No.3,pp 1622-1627, July-Sept 2011 Design and Modeling Studies on Liriodenine derivatives as novel topoisomerase II
CHAPTER 9: CATALYTIC STRATEGIES. Chess vs Enzymes King vs Substrate
CHAPTER 9: CATALYTIC STRATEGIES Chess vs Enzymes King vs Substrate INTRODUCTION CHAPTER 9 What are the sources of the catalytic power and specificity of enzymes? Problems in reactions in cells Neutral
Bioinformation Volume 5
Identification of sequence mutations affecting hemagglutinin specificity to sialic acid receptor in influenza A virus subtypes Usman Sumo Friend Tambunan*, Ramdhan Department of Chemistry, Faculty of Mathematics
PHARMACOPHORE MODELING
CHAPTER 9 PHARMACOPHORE MODELING 9.1 PHARMACOPHORES AS VIRTUAL SCREENING TOOLS The pharmacophore concept has been widely used over the past decades for rational drug design approaches and has now been
Amino Acids. Review I: Protein Structure. Amino Acids: Structures. Amino Acids (contd.) Rajan Munshi
Review I: Protein Structure Rajan Munshi BBSI @ Pitt 2005 Department of Computational Biology University of Pittsburgh School of Medicine May 24, 2005 Amino Acids Building blocks of proteins 20 amino acids
SUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 SUPPORTING INFORMATION Lysine Carbonylation is a Previously Unrecognized Contributor to
Proteins consist of joined amino acids They are joined by a Also called an Amide Bond
Lecture Two: Peptide Bond & Protein Structure [Chapter 2 Berg, Tymoczko & Stryer] (Figures in Red are for the 7th Edition) (Figures in Blue are for the 8th Edition) Proteins consist of joined amino acids
Translation Activity Guide
Translation Activity Guide Student Handout β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an
Side-Chain Protonation and Mobility in the Sarcoplasmic Reticulum Ca 21 -ATPase: Implications for Proton Countertransport and Ca 21 Release
Biophysical Journal Volume 93 November 2007 3259 3270 3259 Side-Chain Protonation and Mobility in the Sarcoplasmic Reticulum Ca 21 -ATPase: Implications for Proton Countertransport and Ca 21 Release K.
Unit 1 Exploring and Understanding Data
Unit 1 Exploring and Understanding Data Area Principle Bar Chart Boxplot Conditional Distribution Dotplot Empirical Rule Five Number Summary Frequency Distribution Frequency Polygon Histogram Interquartile
Wiring diagram. A.-F. Miller, 2008, pg 1. Garrett & Grisham Fig
Wiring diagram 1 Garrett & Grisham Fig. 32.22 Gradients as signalling devices Nerve impulses propagated at 100 m/s Neuronal impulses are carried along axons as electrical signals: transient changes in
Enzyme Catalysis-Serine Proteases
Enzyme Catalysis-Serine Proteases Concepts to be learned Activation Energy Transition State Example: Proteases Requirements for proteolysis Families of proteases Protein Folds used by proteases for catalysis
MITOCW watch?v=xms9dyhqhi0
MITOCW watch?v=xms9dyhqhi0 The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high-quality, educational resources for free.
Docking Analysis of Darunavir as HIV Protease Inhibitors
Journal of Computational Methods in Molecular Design, 2012, 2 (1):39-43 Scholars Research Library (http://scholarsresearchlibrary.com/archive.html) ISSN : 2231-3176 CODEN (USA): JCMMDA Docking Analysis
Determination of the Structure of the Zn 2+ -Oxytocin Complex: Implications for Oxytocin-Receptor Binding
Determination of the Structure of the Zn 2+ -Oxytocin Complex: Implications for Oxytocin-Receptor Binding Alexandra Seuthe, Dengfeng Liu, Oli Th. Ehrler, Xiaohua Zhang, Thomas Wyttenbach and Michael T.
Biochemistry 1 Recitation1 Cell & Water
Biochemistry 1 Recitation1 Cell & Water There are several important themes that transcends the chemistry and bring the importance of understanding the cell biological differences between eukaryotes and
Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase. Biol 405 Molecular Medicine
Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase Biol 405 Molecular Medicine 1998 Crystal structure of phenylalanine hydroxylase solved. The polypeptide consists of three regions: Regulatory
Molecular Dynamics of Sialic Acid Analogues and their Interaction with Influenza Hemagglutinin
Research Papers www.ijpsonline.com Molecular Dynamics of Sialic Acid Analogues and their Interaction with Influenza Hemagglutinin T. FEMLIN BLESSIA, V. S. RAPHEAL 1 AND D. J. S. SHARMILA* Department of
Supplementary Materials. High affinity binding of phosphatidylinositol-4-phosphate. by Legionella pneumophila DrrA
Supplementary Materials High affinity binding of phosphatidylinositol-4-phosphate by Legionella pneumophila DrrA Running title: Molecular basis of PtdIns(4)P-binding by DrrA Stefan Schoebel, Wulf Blankenfeldt,
Life Sciences 1a. Practice Problems 4
Life Sciences 1a Practice Problems 4 1. KcsA, a channel that allows K + ions to pass through the membrane, is a protein with four identical subunits that form a channel through the center of the tetramer.
Theta sequences are essential for internally generated hippocampal firing fields.
Theta sequences are essential for internally generated hippocampal firing fields. Yingxue Wang, Sandro Romani, Brian Lustig, Anthony Leonardo, Eva Pastalkova Supplementary Materials Supplementary Modeling
Designing Psychology Experiments: Data Analysis and Presentation
Data Analysis and Presentation Review of Chapter 4: Designing Experiments Develop Hypothesis (or Hypotheses) from Theory Independent Variable(s) and Dependent Variable(s) Operational Definitions of each
بسم هللا الرحمن الرحيم
بسم هللا الرحمن الرحيم Biochemistry Lec #1 Dr. Nafith AbuTarboush- (30.6.2014) Amino Acids 1 Campbell and Farrell s Biochemistry, Chapter 3 (pp.66-76) Introduction: Biochemistry is two courses; one is
Student Guide. Concluding module. Visualizing proteins
Student Guide Concluding module Visualizing proteins Developed by bioinformaticsatschool.eu (part of NBIC) Text Hienke Sminia Illustrations Bioinformaticsatschool.eu Yasara.org All the included material
Previous Class. Today. Spectrophotometry Spectrofluorimetry Radioactive procedures. ph dependence of Enzyme Catalysis (focus on pgs.
Spectrophotometry Spectrofluorimetry Radioactive procedures Previous Class Today ph dependence of Enzyme Catalysis (focus on pgs. 169-176) ph Effects on Enzyme Activity Structural Considerations: Extreme
Adaptable Lipid Matrix Promotes Protein Protein Association in Membranes
Supporting information Adaptable Lipid Matrix Promotes Protein Protein Association in Membranes Andrey S. Kuznetsov, Anton A. Polyansky,, Markus Fleck, Pavel E. Volynsky, and Roman G. Efremov *,, M. M.
Project Manual Bio3055. Apoptosis: Superoxide Dismutase I
Project Manual Bio3055 Apoptosis: Superoxide Dismutase I Bednarski 2003 Funded by HHMI Apoptosis: Superoxide Dismutase I Introduction: Apoptosis is another name for programmed cell death. It is a series
A: All atom molecular simulation systems
Cholesterol level affects surface charge of lipid membranes in physiological environment Aniket Magarkar a, Vivek Dhawan b, Paraskevi Kallinteri a, Tapani Viitala c, Mohammed Elmowafy c, Tomasz Róg d,
Supporting Information
Supporting Information Mechanism of inactivation of -aminobutyric acid aminotransferase by (1S,3S)-3-amino-4-difluoromethylenyl-1- cyclopentanoic acid (CPP-115) Hyunbeom Lee, 1, Emma H. Doud, 1,2 Rui Wu,
Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for
Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.
Final Exam Chemistry 391 Structural Biochemistry Fall Do not open the exam until ready to begin! Rules of the Game:
Name Practice for 2018 Final Exam Chemistry 391 Structural Biochemistry Fall 2016 Do not open the exam until ready to begin! ules of the Game: This is a take-home Exam. The exam is due on Thursday, December