Extraction and Analysis of Antioxidant Capacity in Rice Bran Extracts from Different Sarawak Local Rice Varieties

Transcription

1 Extraction and Analysis of Antioxidant Capacity in Rice Bran Extracts from Different Sarawak Local Rice Varieties By Tan Xian Wen A thesis submitted to the Faculty of Engineering, Computing and Science, Swinburne University of Technology Sarawak Campus, Malaysia in fulfilment of the requirements for the degree of Master of Science by Research 2015 I

2 Abstract Sarawak is blessed with many different local rice varieties. However, the nutritional contents and value-added processing possibilities of these local rice varieties remain underexplored. This research project was conducted to extract and assess natural antioxidant contents from rice bran of selected Sarawak local rice varieties. The rice bran extracts (RBE) were then further tested with in vitro chemical- and cell-based antioxidant assays preliminarily to evaluate their respective antioxidant capacities in alleviating oxidative injuries. The results revealed that RBE of different Sarawak local rice varieties contain significant amount of natural antioxidants. According to the current finding, Bajong LN RBE has the highest contents of phenolic compounds, flavonoids, and γ-oryzanol among all the tested samples. It was also discovered that higher average total phenolic, flavonoids, and tocotrienols contents were detected in RBE of Sarawak local rice varieties studied as compared to those in certain rice varieties cultivated elsewhere. In vitro chemical-based antioxidant assays further revealed the dose-dependent 2,2-diphenyl-1-picrylhydrazyl (DPPH) freeradical scavenging capabilities of RBE to which the effectiveness differed among RBE of different local rice varieties. Among all the tested rice varieties, highest free-radical scavenging activity was detected with Bajong LN RBE and was significantly higher than that with RBE of commercial rice variety, MR219. Both Bajong LN and MR219 RBE were selected for in vitro cell-based antioxidant assay. Here, the H9c2(2-1) cardiomyocyte was used and the cellular induction effects with selected RBE and H 2 O 2 were studied. Incubation of H9c2(2-1) with RBE and H 2 O 2 showed dose-dependent cytotoxic effects respectively. Such observation revealed the potential prooxidant activity of RBE which consequently reduced cell viability at higher concentration. Cellular induction with safe dose range of RBE showed significant improvement in enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) in H9c2(2-1). Co-incubation of H9c2(2-1) with RBE and H 2 O 2 further revealed the potential of RBE in alleviating H 2 O 2 -induced oxidative injuries as observed through a right shift in IC 50 of H 2 O 2. Higher increment in IC 50 of H 2 O 2 was detected with Bajong LN RBE as compared to MR219 RBE. Besides that, significant up-regulations in enzymatic activity and II

3 expression of CAT were also reported from H9c2(2-1) co-incubated with RBE and H 2 O 2. As a summary, the present result put forward the potential of RBE as a source of antioxidants for alleviation of oxidative injuries in cardiovascular diseases (CVD). Additional studies are still required to further investigate the utilization of RBE as a strategy to combat oxidative stress-induced CVD. III

4 Acknowledgement I would like to express my sincerest gratitude to my supervisor, Dr. Hwang Siaw San, for her persistent guidance, advice and support throughout the progression of my research project as well as the completion of this dissertation. It is an honourable pleasure to have her as supervisor who show endless care for my work and diligently responded to my doubts at times of difficulties of my research. In addition to that, I would like to acknowledge my co-supervisors Dr. Alan Fong Yean Yip, Dr. Ng Sing Muk and Dr. Irine Henry Ginjom for their valuable advice and for sharing their knowledge and experiences on technical related uncertainties in my research. I would like to sincerely thank Prof. Mrinal Bhave from Swinburne University of Technology Melbourne for providing technical advices and funding support to facilitate the research work. I would like to further extend my gratitude to Prof. Yuen Kah Hay and Dr. Sherlyn Lim Sheau Chin from Universiti Sains Malaysia (USM), Penang for granting access to their HPLC analytical laboratory and also providing necessary technical advice, chemicals and consumables required for the HPLC analysis work of this research. Also, I am delighted to express my gratitude to Dr. Paul Neilsen from Swinburne University of Technology, Sarawak Campus, and Prof. Eiji Matsuura, Dr. Kazuko Kobayashi and Dr. Shen Lian Hua from Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences for their assistance in providing invaluable technical advices on cell culture-related work. I must express my gratitude to my family, especially my parents and brother for their continuous support, encouragement and patience for experiencing the peaks and valleys at times of my research. Also not to forget the guidance and supports from my fellow lab mates: Jessica Fong, Diana Choo, Melissa Chang, Yan Huey, Reagan and lab colleagues, Jia Ni, Rafika and Nurul for keeping my things in perspective. Last but not least, I would like to thank Faculty of Engineering, Computing and Science, Swinburne Sarawak and Research Consultancy Office Swinburne Sarawak for providing the necessities which have allowed me to IV

5 pursue this research. The expenses for the research work, conferences and research attachment were supported by Swinburne Sarawak Research Grant 2013 (SSRG Grant ), Melbourne-Sarawak Research Collaboration Scheme Grant (MSRCS 2013) and Strategic Research Grant (StraRG ). Permission has been granted by Sarawak Biodiversity Centre (SBC), Malaysia for accession to the collection and research on the selected Sarawak local rice varieties (Research Agreement No.: SBC-RA-0093-HSS). V

6 Declaration by Candidate I, Tan Xian Wen, higher degree research student of Masters of Science by Research, from Faculty of Engineering, Computing and Science, Swinburne University of Technology Sarawak Campus hereby declare that this dissertation is original and contains no material which has been accepted for award to the candidate of any other degree or diploma, except where due reference is made in the text of the examinable outcome. To the best of candidate s knowledge, this thesis contains no material previously published or written by another person except where due reference is made in the text of the examinable outcome; and where the work is based on joint research or publications, the relative contributions of the respective workers or authors has been disclosed. (TAN XIAN WEN) As the principal coordinating supervisor, I hereby acknowledge and certify that the above mentioned statements are legitimate to the best of my knowledge. (DR. HWANG SIAW SAN) VI

7 Table of Contents Abstract... II Acknowledgement... IV Declaration by Candidate... VI Conference Presentation... XI Conference Awards... XI List of Figures and Tables... XII Chapter 1: Introduction Research Background Research Aims and Objectives Research Contributions and Impact to Society... 6 Chapter 2: Extraction of Natural Antioxidant from Rice Bran Executive Summary Literature Review Rice and Rice Brans Extraction and Analysis of Antioxidants Rice Antioxidants Polyphenols Phenolic Acids in Rice Flavonoids in Rice Anthocyanins in Rice Heath Benefits of Polyphenols Gamma-Oryzanol Health benefits of γ-oryzanol Vitamin E Health Benefits of Vitamin E (Tocotrienols) Research Aims and Objectives Experimental Design Materials and Chemicals Rice Samples Chemicals Rice Sample Treatment and Preparation of Rice Bran Sample Methodology Simple Solvent Extraction Determination of Total Flavonoid Content VII

8 Determination of Total Anthocyanin Content Determination of Total Gamma Oryzanol (γ-oryzanol) Content Determination of Vitamin E Content Statistical Analysis Results and Discussion Determination of Total Phenolic Content Determination of Total Flavonoid Content Determination of Total Anthocyanin Content Determination of Total Gamma Oryzanol (γ-oryzanol) Content Determination of Vitamin E Content Conclusion Chapter 3: Bioactivity Studies of Natural Antioxidants Derived from Rice Bran of Different Sarawak Local Rice Varieties Executive Summary Literature Review Reactive Oxygen Species (ROS) and Oxidative Stress Oxidative Stress Related Disease Cardiovascular Diseases Atherosclerosis Myocardial Infarction (MI) and Myocardial Reperfusion Injury Antioxidants Endogenous antioxidant Superoxide Dismutase (SOD) Catalase (CAT) Glutathione Peroxidase (GPx) Exogenous Antioxidants Research Aims and Objectives Experimental Design Materials and Chemicals Test Samples Methodology In Vitro Chemical-Based System DPPH Free Radical Scavenging Assay Trolox Equivalent Antioxidant Capacity (TEAC) Assay Statistical Analysis In Vitro Cell Culture-Based System VIII

9 Cell Culture and Growth Curve Study Cell cytotoxicity Assay Induction of Oxidative Stress Endogenous Antioxidant Enzyme Activity Studies Endogenous Antioxidant Enzyme Gene Expression Studies Statistical Analysis Results and Discussions In Vitro Chemical-Based System DPPH Free Radical Scavenging Assay Trolox Equivalent Antioxidant Capacity (TEAC) Assay In Vitro Cell Culture-Based System Morphology and Growth of H9c2(2-1) Cardiomyocytes Cell Cytotoxicity Assay (RBE) Cell Cytoxicity Assay (Hydrogen Peroxide) Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide) Effects of Different Treatments on Activities and Gene Expression of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells (A) Superoxide Dismutase (SOD) (i) Effects of RBE on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) Cells (ii) Effects of H 2 O 2 on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) Cells (iii) Effects of H 2 O 2 on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) cells pre-treated with RBE (B) Catalase (CAT) (i) Effects of RBE on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells (ii) Effects of Hydrogen peroxide (H 2 O 2 ) on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells (iii) Effects of H 2 O 2 on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells pre-treated with RBE (C) Glutathione Peroxidase (GPx) (i) Effects of RBE on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells (ii) Effects of Hydrogen peroxide (H 2 O 2 ) on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells (iii) Effects of H 2 O 2 on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells pre-treated with RBE Conclusion IX

10 Chapter 4: Research Limitations and Future Works Project Limitations Future Works Appendices Graphical representations Tabulation of Data References X

11 Conference Presentation 1. Tan, XW, Fong, AYY, Ng, SM, Ginjom, IR & Hwang, SS 2014, Preliminary screening of γ-oryzanol (γ-ory) content in local rice varieties of Sarawak, The 18 th Biological Sciences Graduate Congress (BSGC), University of Malaya (UM), Kuala Lumpur, January 6 January 8, Tan, XW, Fong, AYY & Hwang, SS 2014, The studies on antioxidant activity of Sarawak local rice varieties, 2 nd International Conference on Advances in Plant Sciences (ICAPS 2014), Kuching, Sarawak, Malaysia, November 18 November 22, Tan, XW, Bhave, M, Fong, AYY & Hwang, SS 2015, Potential cytoprotective effects of rice bran extracts against oxidative stress in rat cardiomyocytes, The Annual Conference on Life Sciences and Engineering (ACLSE), Osaka, Japan, August 25 August 27, Conference Awards 1. The Gold Medal Winner for Poster Presentation, Applied Science and Biotechnology category, The 18 th Biological Sciences Graduate Congress (BSGC), University of Malaya (UM), Kuala Lumpur, January 6 January 8, Upstream Category Silver Award Best Poster, 2 nd International Conference on Advances in Plant Sciences (ICAPS 2014), Kuching, Sarawak, Malaysia, November 18 November 22, XI

12 List of Figures and Tables 1. Figures Figure 2-1: An example of Sarawak local rice varieties, Padi Bario (also known as Bario rice Figure 2-1: Local rice varieties of Sarawak... 8 Figure 2-2: Chemical structure of phenol functional group Figure 2-3: Basic structural configurations of different flavone and flavonol derivatives [image source: (Tanaka & Takahashi 2013)] Figure 2-4: General pharmacological properties and biological mechanism/molecular targets of polyphenols... Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A) cycloartenyl ferulate; (B) campesteryl ferulate; (C) 24-methlenecycloartenyl ferulate; (D) β-sitosteryl ferulate Figure 2-6: General pharmacological properties and biological mechanism/molecular targets of γ-oryzanol... Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol. [Image source: (Wolf 2005)] Figure 2-8: General pharmacological properties and biological mechanism/molecular targets of tocotrienol Figure 2-9: Overview of experimental approaches applied for extraction of antioxidants from rice bran samples and determination of the contents of antioxidants in the extracts Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN. Delta T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α-tocotrienols; Tocopherol: mainly α-tocopherol Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE were expressed in units of %. The data represented mean ± standard deviation of three repetitions (n=3). T3 = Tocotrienols; T = Tocopherol Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image source:(quillard & Libby 2012a)] Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b; Toh et al. 2014) Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal blood flow to heart is disrupted at site of arterial blockage and subsequently damages the heart muscles and tissues. [Image source: (Antipuesto 2014) ] Figure 3-4: Overview of experimental approaches applied for bioactivity studies of antioxidants from rice bran extracts... Figure 3-5: DPPH free radical scavenging activities of different concentrations of different crude RBE. The data represented mean ± standard deviation of three repetitions (n=3) Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an inverted light microscope (Magnification: 200x) XII

13 Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation period. Each alphabet represents different growth phases of the cells. (a): Log phase; (b): Exponential phase; (c): Stationary phase; (d): Doubling time (~2.73 days) Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at different time points (1 st to 8 th day) Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative control) and (b) H9c2(2-1) cells induced with lethal dosage of Bajong LN extract (500 µg/ml). Red oval inset in (b) showed apoptotic H9c2(2-1) cells. *Magnification: 40x Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with different concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN and (B) MR219 RBE over 24, 48 and 72 hours of incubation time respectively. Best fit curves were drawn by using excel for visual purposes Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different concentrations of hydrogen peroxide (H 2 O 2 ). The insets showed the inhibition concentration (IC 50 ) of H 2 O 2 on H9c2(2-1) cells determined via GraphPad Prism (GraphPad Software, Inc. USA). Best fit curve were drawn using excel for visual purpose Figure 3-12: Effects of H 2 O 2 inductions on cell viabilities of H9c2(2-1) cardiomyocytes pre-treated with different concentrations of Bajong LN RBE (25µg/mL and 50µg/mL) and MR219 RBE (50µg/mL and 100µg/mL) Figure 3-13: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P Figure 3-14: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in H9c2(2-1) cells after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P Figure 3-15: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT after treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P Figure 3-17: (A) Total enzymatic activities and (B) gene expression levels of CAT after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P XIII

14 Figure 3-18: (A) Total enzymatic activities and (B) gene expression levels of CAT in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1 after treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P Figure 3-20: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1 after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P Figure 3-21: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) Figure 5-1: Total phenolic content of different RBE were expressed in unit of mg GAE/g dried extracts. Vertical bars and errors bars represent the mean ± standard deviation of 3 experimental repetitions (n=3). Similar letters on each bar represent significant differences at P 0.05 (Tukey s Test). GAE = Gallic Acid Equivalent Figure 5-2: Total flavonoid content of different RBE were expressed in unit of mg QE/g dried extracts. Vertical bars and errors bars represent the mean ± standard deviation of 3 experimental repetitions (n=3). Different letters on each bar represent significant differences at P 0.05 (Tukey s Test). QE = Quercetin Equivalent Figure 5-3: Total anthocyanin content of different RBE were expressed in unit of mg C3G/100g dried extracts. Vertical bars and errors bars represent the mean ± standard deviation of 3 experimental repetitions (n=3). The * annotation represents significant difference at P 0.05 from RBE of Bajong (Tukey s Test) Figure 5-4: Total γ-oryzanol content of different crude rice bran extracts were expressed in unit of mg/kg dried extracts. Vertical bars and errors bars represent the mean ± standard deviation of 3 experimental repetitions (n=3). Different letters on each bar represent significant differences at P 0.05 (Tukey s Test) Figure 5-5: Inhibitory concentration (IC 50 ) of different RBE for DPPH free radical scavenging assay. Tocomin50 was used as the positive control. The data represent mean ± standard deviation of three repetitions (n=3). Different letters on each bar represent significant differences at P 0.05 (Tukey s Test) XIV

15 Figure 5-6: The correlation graphs of 1/DPPH (IC 50 ) from RBE with (A) total phenolic content, (B) total flavonoid content, (C) total anthocyanin content, (D) total γ-oryzanol content, (E) total vitamin E content, (F) δ-tocotrienol content, (G) γ-tocotrienol content, (H) α-tocotrienol content, and (I) tocopherol (αtocopherol) content Figure 5-7: Trolox Equivalent Antioxidant Capacity (TEAC) assay of different RBE. Trolox was used as the positive control. Antioxidant capacities of different RBE were expressed in trolox equivalence (nmol/g trolox). The data represent mean ± standard deviation of three repetitions (n=3). Different letters on each bar represent significant differences at P 0.05 (Tukey s Test) Figure 5-8: The correlation graphs of TEAC of RBE with (1) total phenolic content, (2) total flavonoid content, (3) total anthocyanin content, (4) total γ-oryzanol content, (5) total vitamin E content, (6) δ-tocotrienol content, (7) γ- tocotrienol content, (8) α-tocotrienol content, and (9) tocopherol (αtocopherol) content Figure 5-9: Cell viability curves of H9c2(2-1) cells treated with different concentrations of Bajong LN extracts over 24, 48 and 72 hours of incubation period respectively. The insets showed the inhibition concentration (IC 50 ) of Bajong LN RBE on H9c2(2-1) cells determined via GraphPad Prism (GraphPad Software, Inc. USA). Best fit curves were plotted using excel for visual purpose Figure 5-10: Cell viability curves of H9c2(2-1) cells treated with different concentrations of MR219 extracts over 24, 48 and 72 hours of incubation period respectively. The insets showed the inhibition concentration (IC 50 ) of MR219 RBE on H9c2(2-1) cells determined via GraphPad Prism (GraphPad Software, Inc. USA). Best fit curves were plotted using excel for visual purpose Figure 5-11: IC 50 of H 2 O 2 for H9c2(2-1) cells pre-treated with different concentrations of RBE. Data represent mean ± standard deviation for 3 repetitions (n=3). IC 50 values were determined via GraphPad Prism (GraphPad Software, Inc. USA) Tables Table 2-1: General chemical structures of different sub-groups of polyphenols (Navindra 2010) Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of different rice samples Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant difference at P 0.05 (Tukey s Test). GAE = Gallic Acid Equivalent. Graphical representation for the following data is presented in Figure 5-1 (Appendix Section) Table 2-4: Average total phenolic contents in different rice varieties XV

16 Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). QE = Quercetin Equivalent. Graphical representation for the following data is presented in Figure 5-2 (Appendix section) Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of mg cyanidin-3-glucoside equivalent/100g dried extracts. Results were expressed in mean ± standard deviation of three consecutive experimental repetitions (n=3). Graphical representation for the following data is presented in Figure 5-3 (Appendix section) Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation for the following data is presented in Figure 5-4 (Appendix section) Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE were expressed in units of mg/kg. The data represented mean ± standard deviation of three repetitions (n=3). Different letters within the same column denote significant difference at P T3 = tocotrienols; T = tocopherol Table 3-1: Oligonucleotide primer sequences Table 3-2: qrt-pcr Reaction Cycle Condition (Qiagen 2011) Table 3-3: Inhibitory concentration (IC 50 ) of different RBE for DPPH free radical scavenging assay. Values represents mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation for the following data is presented in Figure 5-5 (Appendix section) Table 3-4: Regression and correlation analyses of 1/DPPH (IC 50 ) with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ- tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE. Correlation graphs for the following data were depicted in Figure 5-6 (Appendix section) Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation of the data was depicted in Figure 5-7 (Appendix section) Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant capacity (TEAC) of RBE with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol. Correlation graphs were depicted in Figure 5-8 (Appendix section) XVI

17 Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations of Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control Table 3-8: Inhibitory concentration (IC 50 ) of Bajong LN RBE over 24, 48 and 72 hours of incubation time. The IC 50 values were determined from respective cell viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3). Graphical representations of data were depicted in Figure 5-9 (Appendix section) Table 3-9: Cell viability of H9c2(2-1) after inductions with different concentrations of MR219 RBE for 24, 48 and 72 hours respectively. Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control Table 3-10: Inhibitory concentration (IC 50 ) of MR219 RBE over 24, 48 and 72 hours of incubation time. The IC 50 values were determined from respective cell viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3). Graphical representations of data were depicted in Figure 5-10 (Appendix section) Table 3-11: Cell viability of H9c2(2-1) after inductions with different concentrations of hydrogen peroxide (H 2 O 2 ). Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control Table 3-12: IC 50 of H 2 O 2 on H9c2(2-1) cell. The IC 50 value was determined from respective cell viability curves (Figure 3-11) via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3) Table 3-13: Cell viability of H9c2(2-1) after inductions with different concentrations of H 2 O 2. Cells were pre-treated with different concentrations of Bajong LN and MR219 RBE before H 2 O 2 -induction. Data represent mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control (non-treated cells) Table 3-14: Average IC 50 of H 2 O 2 for H9c2(2-1) cells. The IC 50 value was determined from respective cell viability curves (Figure 5-11) via GraphPad Prism (GraphPad Software, Inc. USA). Data represent mean ± standard deviation of 3 (n=3). * denotes significantly different from negative control treated with media + 1% EtOH at P Graphical representations of data were depicted in Figure 5-11 (Appendix section) Table 5-1: Extraction yields of RBE XVII

18 2. Chapter 1: Introduction 2.1. Research Background Recent years of extensive research has disclosed the fact that majority of diseases originated from the dysregulation of multiple genes, as a consequence of oxidative stress. The origin of oxidative stress has been strongly correlated with high concentration of free radicals, whereby it occurs when the balance between the production rates of free radicals and the rates of their removals are being disturbed (Wang et al. 2011). Primary targets of free radicals include important biological components such as DNA, lipids, sugars, proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury, Mignotte & Vayssiere 2002). Under oxidative stress conditions, these essential biological components will undergo oxidative modifications which disrupt their normal functions. This consequently triggered the occurrence of chronic diseases such as cardiovascular diseases, cancers and various degenerative diseases (Magalhaes et al. 2009). Endogenous antioxidants are produced by the body as a defensive mechanism to maintain redox homeostasis within the biological system (Rodrigo & Gil-Becerra 2014). Although these endogenous antioxidants are capable of neutralizing free radicals, they remain incomplete in the absence of exogenous antioxidants. Both components act synergistically to maintain low levels of free radicals within the biological systems (Bouayed & Bohn 2010; Pietta 2000). For instance, the rejuvenation of oxidized glutathione (GSSG) to its reduced form (GSH) requires vitamin E as one of the precursors (Valko et al. 2007). Besides that, vitamin E also detoxifies lipid peroxyl radicals (LOO - ) (Bouayed & Bohn 2010) concomitantly with endogenous antioxidant enzyme, glutathione peroxidase (GPx) to terminate free radical chain reactions (Lip & Hall 2007). 1

19 Exogenous antioxidants often come from dietary sources and can be categorized under two different types, namely synthetic exogenous antioxidants and natural exogenous antioxidants. As the safety of synthetic exogenous antioxidants remains as a major concern, there has been a great attention centred on natural antioxidants derived from bioactive compounds present naturally in both fruits and vegetables (Magalhaes et al. 2009). In Malaysia, Sarawak state is known as the treasure trove for many different local rice varieties. These include Bario (Figure 2-1), Biris, Bajong, Rotan, Boria, Udang Halus and other less-known rice varieties. Overall, there are more than 100 different rice varieties in Sarawak and majority of them are sold in local markets (Teo 2000). Rice is usually consumed in the form of polished and refined white grains. Through the rice milling process, rice brans are often removed as part of the raw rice component. The removal of brans from the grains has resulted in significant loss of numerous nutritive components (Borresen & Ryan 2014). Figure 2-1: An example of Sarawak local rice varieties, Padi Bario (also known as Bario rice. 2

20 Rice bran extracts derived from various extraction methods have shown a mixture of antioxidant-rich bioactive compounds. These include anthocyanins, gamma-oryzanol (γ-oryzanol), phenolic acids and vitamin E (tocopherols and tocotrienols). It has been proven epidemiologically that consumption of bran portion of rice significantly reduces the prevalence and occurrence rates of chronic diseases such as cardiovascular diseases, type 2 diabetes, various degenerative diseases and cancers (de Munter et al. 2007; Jariwalla 2001; Most et al. 2005). Studies on rice bran and health related research have been performed to evaluate rice bran antioxidants in health and wellness. With more than 100,000 different varieties of rice grown worldwide, it opens up research opportunities to evaluate specific traits and health significance that come in association with the brans (Borresen & Ryan 2014). Presently, research on different varieties of rice is being conducted actively by researchers from different regions of riceproducing countries. The nutritional compositions of the rice are being assessed and the dietary supplementation of the rice extract was found to possess numerous health benefits, generally attributed to the presence of antioxidant compounds (Hu et al. 2003). Cardiovascular disease (CVD) still remains as one of the largest leading cause of global mortality. The World Health Organization (WHO) has estimated a total number of 17.5 million deaths from CVD in the year 2012, accounted for one-third of the global mortality (WHO 2015). The total numbers of annual fatalities are expected to increase to 20 million of death cases by 2020, and further increase to 24 million by 2030 (WHO 2004). Hence, there is an urgent need for global attention to alleviate mortality rate of CVD. One of the initiating causes of CVD was characterized as oxidative modification (Goldstein et al. 1979; Steinberg et al. 1989). Oxidative modification induces a series of signal transduction cascade events that lead to the progression of CVD. Therefore, strategies of using antioxidant to attenuate CVD via inhibition of inadvertent cellular oxidative damage or signalling pathway may have important implications to both prevention and treatment of CVD (Lönn, Dennis & Stocker 2012). 3

21 Research on nutraceutical compounds from various agricultural crops has become one of the emerging fields of study in the recent years. Various efforts have been devoted to enhance the value of these agricultural crops. A well-thought-out approach that thoroughly assesses the content and bioactivities of natural antioxidants present in various Sarawak local rice varieties is likely to bring social and economic benefits. Hence, it is worthwhile to carry out further investigation on the bioactivities of antioxidants derived from rice bran. This would significantly broaden the knowledge base on the antioxidant protective effects of rice bran extracts (RBE). The outcomes can be applied to further nutraceuticals research and also for more in-depth study of plant-based food product development. The present research was designed to extract and assess the content of natural antioxidants from RBE of different Sarawak local rice varieties. This thesis comprises of two different sections. The first section emphasizes on the extraction of natural antioxidants from rice bran of different Sarawak local rice varieties via solvent extraction method and followed by the determination of antioxidants content in the RBE. The second section focuses on the bioactivity studies of RBE. Two different in vitro systems: (i) in vitro chemical-based system and (ii) in vitro mammalian cell culture-based system were used to evaluate the antioxidant activities of RBE. For the in vitro chemical-based system, 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay and Trolox Equivalent Antioxidant Capacity (TEAC) assay were both used to assess the antioxidant capacity of different RBE. As for the in vitro mammalian cell culture-based system, a neonatal cardiomyocytes (H9c2) derived from Rattus novergicus was used as the mammalian cell culture model to study the antioxidant and cardioprotective potential of RBE via inductions of endogenous cellular antioxidant enzymes. All these sections constitute the main objectives of this research work. 4

22 2.2. Research Aims and Objectives The overall research design embarked on two main aims. Aim 1 of this work was to extract and assess natural antioxidant contents from rice bran of selected Sarawak local rice varieties. In order to achieve the aim, experimental works were designed to fulfil the following objectives: a. Extraction of natural antioxidant compounds from rice bran of different Sarawak local rice varieties via solvent extraction method. b. Assessment of the contents of antioxidant compounds derived from RBE of different Sarawak local rice varieties. c. Quantitative analyses of antioxidant compounds derived from RBE via UV-Visible Spectrophotometer (UV-Vis) and High Performance Liquid Chromatography (HPLC). Aim 2 of this work was to assess the bioactivity of RBE by studying their antioxidant capacities via in vitro antioxidant assays. In order to achieve the aim, experimental works were designed to fulfil the following objectives: a. Study of antioxidant activity of RBE based on in vitro chemicalbased systems. b. Study of antioxidant activity of RBE based on in vitro mammalian cell culture-based system. c. Determination of the optimal and safe dosage of RBE that is appropriate for its maximal antioxidant activity in in vitro mammalian cell culture-based system. d. Assessment of RBE on the induction of endogenous cellular antioxidants in in vitro mammalian cell culture-based system. 5

23 2.3. Research Contributions and Impact to Society The outcomes of this research work are expected to: Promote research on health-improving bioactive compounds derived from rice bran. Promote value-added processing possibilities of rice industries in Sarawak, specifically the management of by-products from rice production, supporting local industry and using natural biodiversity to its full advantage Identify Sarawak local rice varieties that have the highest antioxidant contents. Promote germplasm expansion (for planting) and breeding of new nongenetically modified rice varieties that are nutritious in natural antioxidants. Enhance international knowledge base on the antioxidant properties of RBE in terms of correlation between the concentration of RBE and other factors such as induction of endogenous cellular antioxidants and the effectiveness of their respective antioxidant activity. Establish supporting data for further investigation in carefully planned animal model studies and clinical trials. Ideally, the latter may lead to identification and expansion of local inexpensive rice varieties as potential nutraceuticals for cardioprotection. Additionally, it also offers opportunity for development and manufacture of new plant-based drug and nutraceuticals products. The safe and low post-treatment side effect of these natural bioactive compounds can be a potential candidate to replace chemically synthesised drugs used for treatment of cardiovascular diseases. Such approaches will have high socio-economic impact on the nation s populations in conjunction with the efforts to reduce the nation s mortality rate caused by cardiovascular diseases annually. 6

24 2. Chapter 2: Extraction of Natural Antioxidant from Rice Bran 2.1 Executive Summary Health concerns over the use of synthetic antioxidants as food additives in processed food products have led to an increase in research interests targeting on natural antioxidants. Plant materials such as vegetables, nuts and fruits are good sources of natural antioxidants. Due to the biological diversity of these plant materials, each and every one of them contains different types and amount of antioxidants. Hence, there have been many research works targeting on qualification, elucidation and quantification of bioactive compounds present in plant materials. Rice bran, by products of rice milling process, is known for having high contents of essential proteins, vitamins and various natural antioxidants. Despite its high nutritional value, it remains underutilized as health food. In Malaysia, Sarawak is known as the treasure trove for different local rice varieties. However, the health and nutritional of these local rice varieties remain underexplored. There is very little fundamental information on the distribution and quantification of bioactive compounds/natural antioxidants present in these local rice samples. Hence, the following work was conducted to extract and thoroughly assess the content of natural antioxidants from rice bran of different Sarawak local rice varieties. In this chapter of the thesis, it provides a comprehensive literature review relevant to the field of study. In addition, summary of experimental approaches and presentation of results for the first section of the overall research work are also included in this chapter. 7

25 2.2 Literature Review Rice and Rice Brans Rice is a staple food and remains as the utmost important agricultural commodities in many Asian countries (Van Hoed et al. 2006). It provides sources of calories and nourishments for majority of the Asian population s nutritional requirement (Schramm et al. 2007). In addition, rice continues to play a significant role in sustaining global food security systems and establish a continual capacity to feed the increasing world populations (Swaminathan & Rao 2008). Presently, rice is being cultivated in more than 100 countries with an estimated 475 million tonnes of production capacity annually (Borresen & Ryan 2014). In Malaysia, Sarawak state is known as the treasure trove for many different varieties of aromatic rice. Some of these include Bario, Biris, Bajong, Rotan, Boria, Udang Halus and other less-known rice varieties (Figure 2-1). Overall, there are more than 100 different rice varieties in Sarawak and majority of them are sold in local markets (Teo 2000). Figure 2-1: Local rice varieties of Sarawak 8

26 Rice is primarily consumed in the form of white polished grains (also known as white rice). Its non-milled rice form, otherwise known as brown rice is less popular due to its poor texture and undesirable quality after cooking. The whole rice grain consists of 3 major parts: husk, bran and endosperm. In the rice milling industries, the milling process typically begins with the dehulling of rice grains to remove the husk layer. This later reveals the bran layer which shields the endosperm. Further removal of bran layer yields the endosperm, commonly known as the white rice which is ready-to-cook (Elaine et al. 2004; Ha et al. 2006). The whole rice grain is known for containing rich contents of vitamins, lipids, minerals, proteins, fibres and numerous antioxidants (Singh & Chakraverty 2014) which may aid in disease control (Talwinder 2009). Major composition of these bioactive compounds is found in the bran of rice grain. However, the removal of bran from rice has resulted in the loss of approximately 70% of the essential nutrients present in rice (Elaine et al. 2004). Despite having high content of nutritious components and commercial value, rice bran remains as an underutilized agricultural by-product. Most of them are used as animal feed while only a small portion is used in the production of rice bran oil for human consumption (Sirikul, Moongngarm & Khaengkhan 2009). Several research works have been focusing on the health attributes of rice bran in the prevention and treatment of chronic diseases. The outcomes from the studies revealed positive correlation between the consumption of rice bran (also inclusive of brown rice) and risk reductions in chronic diseases such as cardiovascular disease (Ausman, Rong & Nicolosi 2005; Justo et al. 2013; Wilson et al. 2002), cancers (Bang et al. 2010; Henderson et al. 2012), type 2 diabetes (de Munter et al. 2007), hypertension and hyperlipidaemia (Most et al. 2005). Through the emerging knowledge of rice bran in health and wellness, its consumption begins to gain popularity in recent years (Elaine et al. 2004). The current research trend on rice bran revolves around its innovation in food system that aims to alleviate issues of malnutrition and chronic diseases. In addition, emphasis is also put on the genetic, geographic, nutritional diversities 9

27 of different rice varieties and their associated health attributes (Borresen & Ryan 2014). Hence, by addressing all these research statements, it will provide global health prospects for proper and innovative utilization of rice bran in the management of chronic diseases Extraction and Analysis of Antioxidants The extraction of bioactive compounds from plant materials is the startup procedure for preparation of natural nutraceuticals or dietary supplements. Depending on the nature of the raw materials, natural antioxidants can be extracted from fresh, frozen, freeze-dried or dried plant samples. These plant materials are usually pre-treated by milling, grinding or homogenization which may later be preceded by air-drying or freeze drying for sample preservation and storage (Dai & Mumper 2010). There are various methods available for the extraction of antioxidants from plant materials. These methods are categorized under three different categories, namely physical methods (Moreno et al. 2003), chemical methods (Romero-Pérez et al. 2000), and enzymatic methods (Meyer & Meyer 2005). Among all the extraction methods, solvent extraction (a chemical extraction method) is the most commonly used extraction methodology to extract favourable compounds from plant materials. The stand-out points for such extraction methodology are being easy to perform, efficient and its wide applicability. Solvents such as methanol, ethanol, acetone, ethyl acetate, and water are commonly used in the extraction of bioactive compounds from plant materials (Eloff 1998). Due to the variation in composition of phytochemicals, selection of suitable solvent to be used for extraction is dependent on the nature of targeted sample and bioactive compounds (Gupta, Naraniwal & Kothari 2012). Hence, there is no standardized extraction protocol made available for extraction of bioactive compounds from plant materials. 10

28 Polar and short carbon-chain alcohol such as methanol has been used widely in the extraction of bioactive compounds from rice bran. Targeted bioactive compounds such as phenolic acids, flavonoids, anthocyanins (Chen et al. 2012; Gunaratne et al. 2013; Rao et al. 2010), vitamin E: tocotrienols (Chen & Bergman 2005; Renuka Devi & Arumughan 2007) and, gamma oryzanol (γoryzanol) (Jeng et al. 2012; Miller & Engel 2006) have been successfully extracted from rice bran by using methanol as the main solvent system. Depending on the compound of interest, other solvents such as acetone (Gunaratne et al. 2013), hexane (Xu, Hua & Godber 2001), ethanol, and isopropanol (Chen & Bergman 2005) have also been used to extract these antioxidants from rice bran. Aside from the choice of solvent system, extraction yields of each different types of bioactive compounds also varies and dependent on other extraction parameters such as extraction temperature, extraction duration, solvent concentration, and type of instrument used (Goufo et al. 2014b; Pellegrini et al. 2006). However, extraction temperature appears to be the major factor among all. Different bioactive compounds have variable susceptibilities to thermal degradation (Goufo & Trindade 2014; Stratil, Klejdus & Kubáň 2007). For instance, high extraction temperature (>70 C) is able to degrade anthocyanin rapidly (Havlíková & Míková 1985). In addition, rapid degradation of flavonoids have also been reported at high extraction temperatures beyond 130 C (Rostagno & Prado 2013). Over the past few years, many different analytical methods have been developed to quantify and determine the contents of phenolic acids, flavonoids, anthocyanins, vitamin E: tocotrienols and γ-oryzanol. Most of these methods utilize instrumentation-based analyses involving the use of equipment such as UV-Visible spectrophotometer, high performance liquid chromatography (HPLC), gas chromatography (GC), mass spectrometric (MS) detection, liquid chromatography-mass spectrometry (LC-MS). 11

29 Total phenolic content in plant materials is commonly determined via Folin Ciocalteu s assay method. The method was initially established by Folin and Ciocalteu (1927) and was then altered by Singleton and Rossi (1965). It is a colorimetric assay based on the reduction of Folin Ciocalteu s reagent, a yellow phosphomolybdic phosphotungstic acid reagent through the transfer of electron from phenolic compounds under alkaline condition (Lester et al. 2012; Singleton & Rossi 1965). Gallic acid, a type of phenolic acid is commonly used as the reference standard in this assay. The reaction yields blue colour product which can be analysed spectrophotometrically via UV-Visible spectrophotometer at 750nm (Vázquez et al. 2015). The aluminium complexation-based spectrophotometric assay is a commonly used approach to evaluate the total flavonoid content in plant materials. The method was initially proposed by Christ and Müller (1960) and was fine-tuned several times. Typical concentration of 2% to 10% (weight per volume, w/v) of aluminium chloride (AlCl 3 ) is used in this assay. The complexation of aluminium chloride can take place in either acidic or alkaline condition. Upon the addition of aluminium chloride, a yellow complex solution is formed and it turns red after the addition of sodium hydroxide (NaOH). The absorbance of the final red product is then evaluated spectrophotometrically at 510 nm (Malta & Liu 2014; Pękal & Pyrzynska 2014). Flavonoid reference standards such as quercetin, quercitrin, and galangin are commonly used in the assay. There are several methods to determine the total anthocyanin contents of plant samples. Methods such as direct spectrophotometric approach via HPLC (Sompong et al. 2011) and spectrophotometric ph differential method (Fuleki & Francis 1968; Giusti & Wrolstad 2001) have been used to determine total anthocyanin content. Among the two methods, the rapid and simple spectrophotometric ph differential approach is often used to determine total anthocyanin content. The method determines total content of monomeric anthocyanin via changes in absorbance of anthocyanin chromophore at ph 1.0 and ph 4.5 respectively. Under different ph environment, monomeric anthocyanins exist in different forms by going through a reversible structural transformation. The coloured oxonium form of monomeric anthocyanin 12

30 predominates at ph 1.0 while the colourless hemiketal form predominates at ph 4.5. The total anthocyanin content is often expressed as the equivalents of a commonly found monomeric anthocyanin, cyanidin-3-glucoside (Lee 2005). Vitamin E isomers can be analysed via high performance liquid chromatography (HPLC). The separation of different vitamin E isomers can be performed via both normal-phase HPLC (Kamal-Eldi et al. 2000; Panfili, Fratianni & Irano 2003) and reverse-phase HPLC (Chen & Bergman 2005; Grebenstein & Frank 2012). Various combinations of solvents have been used as the mobile phase of HPLC and detection of the compounds can be done with either ultraviolet (UV) detector or a fluorescence detector. Due to the high sensitivity and selectivity of fluorescence detector as compared to UV detector, it is more commonly used in the analysis of vitamin E isomers (Cunha et al. 2006). Under normal phase HPLC chromatographic method, proper separation of all 8 different isomers of vitamin E can be performed easily. Contrarily, a reversed phase HPLC chromatographic method fails to separate β- and γ- isomers of tocopherol (T) and tocotrienols (T3) (Finocchiaro et al. 2007). Analysis of γ-oryzanol can be performed via UV-spectrophotometry (Bucci et al. 2003), normal phase and reversed phased HPLC (Yoshie et al. 2009), and gas chromatography (Miller et al. 2003). Simultaneous analysis of tocopherols, tocotrienols and γ-oryzanol from rice can be performed via a modified mobile phase in gradient mode (Chen & Bergman 2005). UV spectrophotometric analytical approach of γ-oryzanol has reported higher content of total γ-oryzanol content (by 2-folds) as compared to HPLC approach (Bucci et al. 2003). Two factors were known for causing the difference: (1) the use of oil-based solvent system and (2) low concentration of γ-oryzanol in sample (Bucci et al. 2003). Significant difference in total γ-oryzanol content between the two analytical approaches was observed with samples suspended in n-heptane and those with low concentration of γ-oryzanol. This is due to the fact that UV spectrophotometer tends to pick up non-negligible interference from the oil-matrix at absorbance wavelength of 315nm and hence causing inaccuracies in the reported results. Based on the findings of Bucci et al. (2003), they reported dose-dependent interactions between the concentration of γ-oryzanol in different rice bran oils and the detection accuracy of γ-oryzanol 13

31 via UV spectrophotometer. UV spectrophotometer detected relatively higher total content of γ-oryzanol in samples containing low concentration of solute than those detected via HPLC (0.82mg/g of γ-oryzanol versus 0.40mg/g of γ- oryzanol respectively). As of those samples with higher concentrations of γ- oryzanol, the results of both detection methods were comparable. UV spectrophotometry detected total amount of 10.9mg/g of γ-oryzanol while HPLC detected total amount of 9.8mg/g of γ-oryzanol (Bucci et al. 2003). Depending on the solvent system of the test compound, maximum absorption wavelength of γ-oryzanol varies between the ranges of 315nm to 327nm. Alcohol-based solvent system (max λ = 327nm) has more accurate results when γ-oryzanol is detected via UV spectrophotometric approach with negligible interferences from oil-matrix. For oil-based solvent system (max λ = 315nm), a second derivative analysis can be performed to eliminate the interferences from oil matrix (Bucci et al. 2003). As for HPLC approaches, depending on the choice and alteration in the composition of solvent system, different γ-oryzanol derivatives can be separated. However, quantification of individual γ-oryzanol components remain as a challenge due to lack of commercially available pure reference standards (Goufo & Trindade 2014). 14

32 2.2.3 Rice Antioxidants Controversies over the safety of synthetic antioxidants in processed foods and their use as food additives have sparked the concerns of many health-conscious consumers. Butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT) are the commonly used synthetic antioxidants for preservation of fatty food (Addis 1986). However, long term exposures to these synthetic antioxidants have been reported capable of promote tumour formation and develop carcinogenic effects in organs such as liver, forestomach, and glandular stomach (Hirose et al. 1998; Ito et al. 1983; Ito, Fukushima & Tsuda 1985; Williams 1986; Williams & Iatropoulos 1996). This has led to an increase in research interests that target on natural antioxidants (Islam et al. 2014). Natural antioxidants are defined as phenolic or polyphenolic compounds derived from plant materials. Fruits, vegetables and nuts are common sources of natural antioxidants. Although these foods contain significant amount of natural occurring antioxidants, types and amount of antioxidants present in these foods differ from one another. Some of these natural antioxidants include polyphenols, flavonoids, anthocyanins, vitamins, and resveratrol (Tsuda et al. 2002a). Numerous scientific evidences have shown that frequent dietary intake of antioxidant-rich food are commonly linked with low incidence of oxidative stress associated diseases (Tsuda et al. 2002a). Research on natural antioxidants have shown positive health effects towards cardioprotection, inflammation, antiinfection, liver protection, anti-diabetic, anti-obesity and neurodegenerative processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei & Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012). These naturally occurring bioactive constituents provide a defence system to the body by eliminating free radicals and protect the body against oxidative injuries. They prevent the initial stage of free radicals formation and hinder the progression of oxidative chain reaction that may subsequently lead to production of secondary radical species (Mukhopadhyay 2000). There have been a lot of research works focusing on the identification and elucidation of action mechanisms of rice antioxidants. Such research efforts 15

33 remain on-going and have gained considerable interest since the establishment of positive correlation between rice consumption and low incidence of cardiovascular diseases and cancers among Asian populations (Hudson et al. 2000). In the following, general descriptions on some of the different types of antioxidants present in rice will be highlighted and discussed. These include phenolic acids, flavonoids and anthocyanins which are collectively categorized under the group of polyphenols, and other antioxidants such as γ-oryzanol and vitamin E Polyphenols Polyphenols exist abundantly in the diet. They are known as the dietary antioxidants, accounted for approximately 1g/d of the total dietary intake and considerably much higher than other classes of phytochemicals. Primary sources of polyphenols include fruits, vegetables and legumes (Scalbert, Johnson & Saltmarsh 2005). They are the secondary metabolites produced by plants to protect themselves against aggression by external factors such as ultraviolet radiation and pathogens. Aside from protecting the plants, health effects of polyphenols have come to the attention of food nutrition researchers with research evidences of their credible effects in prevention and treatment of oxidative stress associated diseases (Manach et al. 2004). Figure 2-2: Chemical structure of phenol functional group. All polyphenols have characteristic phenol functional groups, each consisting of a hydroxyl group (-OH) attached to an aromatic ring (Figure 2-2). There are thousands of polyphenols that have been identified to-date. The 16

34 limitless arrangement of polyphenolic structures have accounted for the diversity and complexity of different polyphenols. They are differentiated by the number of phenol group and other structural elements (arrangement of carbon atoms) that link each and every one of the rings. Despite the vast array of structural complexity, polyphenols can still be categorized into two main groups: flavonoid polyphenols and non-flavonoid polyphenols (Navindra 2010). Each group is further sub-divided into smaller groups. Sub-groups of flavonoid polyphenols include flavonols, flavones, isoflavones, flavanones, flavanols, and anthocyanins. As for non-flavonoid polyphenols group of compounds, it consists of phenolic acids, stilbenoids, and lignans (Navindra 2010). The following illustrates the general structures of different types of polyphenols (Table 2-1): Table 2-1: General chemical structures of different sub-groups of polyphenols (Navindra 2010) Flavonoid Polyphenols Flavonol Flavone Isoflavone Flavanone 17

35 Flavanol Anthocyanin Non-Flavonoid Polyphenols Phenolic Acid Stilbenoid Lignans 18

36 In the following literature reviews, three major sub-groups of polyphenols present in rice will be briefly discussed. The three major sub-groups of polyphenols include: phenolic acids, flavonoids and anthocyanins Phenolic Acids in Rice Phenolic acids have a general structure consisting of a phenolic ring and a carboxyl functional group (Goufo et al. 2014b) (general chemical structure of phenolic acid is depicted in Table 2-1). Sinapic acid, gallic acid, ferulic acid, and p-coumaric acid are some of the common types of phenolic acids (Navindra 2010). Antioxidant properties of phenolic acid are attributed to the presence of phenolic ring that neutralize unpaired electrons. The strength of phenolic acid s antioxidant capacity corresponds to both number and position of hydroxyl (-OH) group on the phenolic ring (Heuberger et al. 2010). To date, a total of twelve different types of phenolic acids have been identified and their respective contents varies among different rice varieties as well as in different parts of the rice. In general, ferulic acid accounted for the most abundant type of phenolic acid in the endosperms, whole grains and bran of the rice (Goufo & Trindade 2014). P-Coumaric acid comes in second and later followed by other phenolic acids such as sinapic acid and gallic acid respectively. There are also additional phenolic acids that have been identified in rice but still need to be further validated (Chen et al. 2012; Fujita et al. 2010; Vichapong et al. 2010) Flavonoids in Rice Flavonoids have a general chemical structure, consisting of two 6-carbon aromatic rings and interlinked by carbon chain made of three carbons. Flavonoids are sub-divided into different groups, namely flavonols, flavanols, flavanonols, flavones, isoflavones and anthocyanins (Navindra 2010). As an antioxidant, flavonoids scavenge free radicals by donating electrons to neutralize and stop the chain reactions caused by radical species. Such 19

37 activities are credited to the presence of hydroxyl (-OH) groups on the 3 - and 4 - carbon of the three carbons chain (Figure 2-3) (Cho et al. 2013; Kim et al. 2010). Figure 2-3: Basic structural configurations of different flavone and flavonol derivatives [image source: (Tanaka & Takahashi 2013)] To date, there are seven types of flavonoids in rice that have been reported. These flavonoids include quercetin, myricetin, isorhamnetin, luteolin, kaempferol, apigenin, and tricin which accounted for the major types of flavonoids found in rice (Goufo & Trindade 2014). 20

38 Anthocyanins in Rice Anthocyanins are a group of compounds that is categorized under the flavonoids family. The compounds are the glycosylated and stabilized forms of anthocyanidins (Yonekura-Sakakibara et al. 2009). Anthocyanins are commonly found in plant tissues. They are pigmented and soluble in water, and are responsible for imparting colours to plant materials (Navindra 2010). The free radical scavenging activities of anthocyanins are generally attributed to the chemical structure of the compounds. The compound basically exists in the form of acylglycosides and O-glycosides (in either mono-, di- or triconfiguration) of anthocyanidins in which the sugar functional group can be replaced by hydroxycinnamic, aliphatic or hydroxybenzoic acids (Goufo & Trindade 2014). There are a total of eighteen different types of anthocyanins that have been identified in rice. Among the eighteen, only four types of anthocyanins were quantified (Goufo & Trindade 2014), namely peonidin-3-oglucosides, cyanidin-3-o-galactoside, cyanidin-3-o-glucoside and cyanidin-3-orutinoside. Among the four types of anthocyanins, both cyanidin-3-o-glucoside and peonidin-3-o-glucoside predominate and is then followed by both cyanidin- 3-O-rutinoside, and cyanidin-3-o-galactoside (Hou et al. 2013; Shao et al. 2014) Heath Benefits of Polyphenols Health benefits of polyphenols are largely associated with their prominent antioxidative potency. As antioxidants, polyphenols protect cells from oxidative injuries by scavenging free radicals or trigger the endogenous defence systems. The phenolic functional groups of polyphenols are able to disrupt the oxidative chain reactions in cellular components by accepting free electron and form stable phenoxyl radicals. Thus, this limits the formation of reactive oxygen species (Scalbert et al. 2005). In addition to antioxidant properties of polyphenols, other health protective benefits of polyphenols in prevention of degenerative diseases such as cardiovascular diseases, neurodegenerative diseases and cancers have been widely studied and are evidently supported by positive outcomes in various animals and cell line study models (Scalbert et al. 21

39 2005). An overview of the health benefits and molecular targets of polyphenols is depicted in the following figure (Figure 2-4). 22

40 Cardiovascular Protection Anti-cancer Inhibit oxidation of low density lipoprotein (LDL) cholesterol (Aviram et al. 2000) Prevent disruption of atherosclerotic plaques (Garcia-Lafuente et al. 2009) Improve high density lipoprotein (HDL) cholesterol level (Garcia-Lafuente et al. 2009) Regulates endothelial function that via vasoconstriction and vasodilation (Pirola & Frojdo 2008) Induce cell cycle arrest and cell apoptosis (Garcia-Lafuente et al. 2009) Regulate host immunity system (Sharma & Rao 2009) Inhibit proliferation of cancerous cells (Pandey & Rizvi 2009) Halt the conversion of pro-carcinogens into their active forms (Pandey & Rizvi 2009) Quench cancer-causing free radicals (Kamaraj et al. 2007) Polyphenols Neuro-protection Inhibit nuclear factor kappa-β signaling to prevent microgliadependent β-amyloid toxicity (Markus & Morris 2008) Scavenge free radical to prevent oxidative damage on brain macromolecules (Pandey & Rizvi 2009) Reduce risk of Parkinson s disease (Rossi et al. 2008) Scavenge neurotoxin, N- methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP) and MPTP mediated radicals (Rossi et al. 2008) Activate MAP kinases for cell survival (Rossi et al. 2008) Antioxidant Anti-diabetic Increase plasma antioxidant capacity (Pandey & Rizvi 2009) Absorb pro-oxidative food components (eg. Iron) (Scalbert et al. 2005) Scavenge free radicals (Pandey & Rizvi 2009) Reduce oxidative damage (Luqman & Rizvi 2006) Reduce risk of oxidative stress associated degenerative diseases (Pandey & Rizvi 2010) Prevent uptake of glucose in the gut and peripheral tissues (Matsui et al. 2002) Regulate transport of glucose from stomach to small intestine (Dembinska-Kiec et al. 2008) Modulate sirtuin-1 (SIRT1) to improve glucose homeostasis and insulin sensitivity (Milne et al. 2007) Figure 2-4: General pharmacological properties and biological mechanism/molecular targets of polyphenols 23

41 Gamma-Oryzanol Steryl ferulates (also known as γ-oryzanol) are mixtures of ferulate esters with sterols or triterpenes. There are four main components of steryl ferulates, namely campesteryl ferulates, cycloartenyl ferulates, 24-methylenecycloartenyl ferulates and β-sitosteryl ferulates (Figure 2-5) (Kozuka et al. 2012). These are the phenolic compounds that can be found in cereal grains such as rice, corn, wheat, barley and rye (Kiing et al. 2009). Among all of them, rice has the highest content of steryl ferulates. γ-oryzanol was first being isolated from rice bran oil by Kaneko and Tsuchiya (1954) while other constituents of γ-oryzanol and its derivatives were later discovered by Xu and Godber (1999), and Fang, Yu and Badger (2003). Ever since the discovery of γ-oryzanol, numerous works have been conducted to thoroughly assess the therapeutic properties of the compound Health benefits of γ-oryzanol The antioxidant activity of γ-oryzanol significantly contributes to overall health benefits of the compound. It has phenol and ferulic acid functional groups that are able to quench free radicals. The phenol moiety of the compound is able to accept free radicals to form stable phenoxyl radicals while the ferulic acid functional group donates electrons to disrupt the actions of free radicals (Lemus et al. 2014). γ-oryzanol was found to have strong and superoxide dimutase-alike antioxidant properties as reported from several in vitro systems, animal models and human subjects studies (Gerhardt & Gallo 1998; Hundemer et al. 1991; Vissers et al. 2000). The compound has been proposed as a natural antioxidant additive to food, cosmetic and pharmaceutical products (Kim & Godber 2001; Nanua, McGregor & Godber 2000). In addition to that, γ-oryzanol has been reported to possess cholesterol-lowering, anti-inflammatory, anticancer and anti-diabetic properties as shown in several animal and cell-line models (Islam et al. 2008; Jin Son et al. 2010; Son et al. 2011). The pharmacological activities and biology actions of γ-oryzanol are summarized in Figure

42 (A) (B) (C) (D) Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A) cycloartenyl ferulate; (B) campesteryl ferulate; (C) 24- methlenecycloartenyl ferulate; (D) β-sitosteryl ferulate. 25

43 Antioxidant Anti-cancer Quench organic radicals and prevent lipid peroxidation (Juliano et al. 2005) Enhance activities of cellular antioxidant enzymes in high fat-induced oxidative stress (Jin Son et al. 2010) Improve radical scavenging activities of cellular antioxidant enzyme, glutathione reductase (Jin Son et al. 2010) Inhibit tumor mass and growth (Kim et al. 2012) Promote cytolytic activity of natural killer (NK) cells (Kim et al. 2012) Reduce number of blood vessels in tumor (Kim et al. 2012) Reduce expression and release of pro-angiogenic biomarkers (Kim et al. 2012) Inhibit cancer cell proliferation and alter cancer cell cycle (Henderson et al. 2012) Anti-diabetic γ-oryzanol Stimulate pancreatic release of glucosestimulate insulin (Kozuka et al. 2013) Relieve endoplasmic recticulum for proper regulation of glucose-stimulated insulin (Kozuka et al. 2013) Possess hypoglycemic effect (Ghatak & Panchal 2012) Regulate pancreatic enzymes involved in glucose production (Ghatak & Panchal 2012) Cardioprotection Inhibit lipid peroxidation (Juliano et al. 2005) Lower plasma cholesterol and low density lipoprotein (LDL) cholesterol level (Seetharamaiah & Chandrasekhara 1989) Prevent arterial inflammation by regulating inflammatory cytokines and mediators (Islam et al. 2008) Increase level of high density lipoprotein (HDL) cholesterol (Seetharamaiah & Chandrasekhara 1989) Reduce formation of aortic fatty streak (Rong, Ausman & Nicolosi 1997) Figure 2-6: General pharmacological properties and biological mechanism/molecular targets of γ-oryzanol 26

44 Vitamin E In the human diet, vitamin E is a crucial nutrient and is widely known for its strong antioxidant properties (Wong & Radhakrishnan 2012). Ever since the discovery of vitamin E in 1922, many studies have been focusing on the health and pharmaceutical benefits of the two major forms of vitamin E, namely tocopherol and tocotrienol (Wolf 2005) (Figure 2-7). All derivatives have a hydroxyl functional group (-OH) attached to chromanol rings. Each group consists of four different isomeric forms distinguished by the degree of substitution of methyl groups (-CH 3 ) in the chromanol head (Liva 2008) and. The α-isoform consists of three methyl groups, while both of the γ- and β- isoforms have two methyl groups, and the δ- isoform with only one methyl group (Vasanthi, Parameswari & Das 2012). The key structural difference between tocopherol and tocotrienol lies within their carbon side chains. Tocopherol has a long saturated carbon side-chain (also known as the phytyl tail) while tocotrienol has a short unsaturated carbon side-chain (the farnesyl tail) (Drotleff & Ternes 2001). (A) R 1 R 2 Alpha derivative -CH 3 -CH 3 Beta derivative -CH 3 -H (B) Gamma derivative -H -CH 3 Delta derivative -H -H Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol. [Image source: (Wolf 2005)] 27

45 In rice, major portion of the vitamin E content consists of tocotrienols (Goufo & Trindade 2014). Among the four different derivatives of tocotrienols, γ- tocotrienol accounted for the highest content to the total tocotrienols content in rice and later followed the remaining derivatives such as α-tocotrienols, δ- tocotrienols, and β-tocotrienols (Min, McClung & Chen 2011; Yu et al. 2007). In addition to the four tocotrienols derivatives, two additional novel tocotrienols derivatives were isolated from rice bran and they were characterized as desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al. 2000) Health Benefits of Vitamin E (Tocotrienols) Nonetheless, α-tocopherol was once the most widely studied vitamin and little emphasis was placed on tocotrienols. It was only discovered in the 1980s and 1990s that tocotrienol is 40 to 60 folds more potent antioxidant than tocopherol. Besides that, it has cholesterol lowering properties which are absent in tocopherol (Qureshi et al. 1995; Sen, Khanna & Roy 2006; Tan 2005). Since then, tocotrienols began to draw attention for studies of their health-related biological significance. Evidence suggests that biological actions of tocotrienol are more potent than tocopherol. Such properties are generally attributed to the short carbon side chain of tocotrienol, which allows the compound to have better intra- and inter- cellular mobility between the lipid membranes (Suzuki et al. 1993; Yoshida, Niki & Noguchi 2003). Contrarily, the long carbon side chain of tocopherol has a higher tendency of anchorage into the phospholipids membranes and hence restricts its mobility (Yoshida, Niki & Noguchi 2003). As such, this could possibly justify the stronger antioxidant properties of tocotrienols compared to those of tocopherols (Serbinova et al. 1991). In addition, among the different isomers of tocotrienols, the potency of biological actions is arranged as follows: δ- > γ- > α- > β- derivatives. This is attributed to degree of substitution and location of methyl group at the chromanol ring of each derivatives (Anne & Barrie 2008). It is suggested that the tocotrienol isoform that has fewer substitutions of the methyl group and 28

46 absence of methyl group at the C5 position of its chromanol ring has higher bioactivity. Among the four isomers, only γ- and δ- tocotrienols do not have a methyl group at the C5 position (Tan 2005). The pharmacological effect of tocotrienols is widely linked to its strong antioxidant properties which generally attributed to the presence of redox active hydroxyl group (-OH) in the chromanol ring (Litwack 2007). It was found to regulate various anti-oxidizing enzymes to actively scavenge free radicals, which are among the primary sources for causing various chronic diseases (Hsieh & Wu 2008; Lee, Mar & Ng 2009; Newaz & Nawal 1999). In addition, anti-cancer properties of tocotrienols in growth suppression and antiproliferation of cancer cells have also been described in recent research publications. Other pharmacological properties such as anti-cholestrolemic, anti-hypertensive, anti-diabetic, cardioprotective and neuro-protective have also been reported from in vitro and in vivo study models (Figure 2-8) (Alexander 2008). 29

47 Anticholesterol and Cardioprotection Inhibits the biosynthesis of cholesterol (Qureshi et al. 1986) Prevents arterial inflammation (Aggarwal et al. 2010; Henryk 2008) Reduces concentration of plasma cholesterol and low-density lipoprotein (LDL) cholesterol (Qureshi et al. 1991) Anti-cancer Induces tumour growth suppression (Agarwal et al. 2004) Induces cell apoptosis (cell death) (Kashiwagi et al. 2008) Regulates various growth factors that are responsible for tumour formation and tumour suppression (Agarwal et al. 2004; Weng-Yew et al. 2009; Wu & Ng 2010b) Antioxidant Activates a range of antioxidant enzymes (Adam et al. 1996; Hsieh & Wu 2008; Lee, Mar & Ng 2009; Newaz & Nawal 1999) Removes the reactive oxygen species (ROS) (Renuka Devi & Arumughan 2007) Reduces oxidative stresses (Renuka Devi & Arumughan 2007) Tocotrienols Anti-inflammatory Regulates transcription factors of NF-kappaB (Ahn et al. 2007) Suppresses inflammatory mediators (Ahmad et al. 2005) Suppresses COX-2 activity and inducible nitric oxide synthases (Wu & Ng 2010a) Neuroprotective and Anti-diabetic Prevents glutamate induced neuronal cell death (Sen, Khanna & Roy 2004; Sen et al. 2000) Attenuates diabetic neuropathy (Kuhad & Chopra 2009) Regulates biochemical changes linked to diabetes (Kuhad & Chopra 2009) Figure 2-8: General pharmacological properties and biological mechanism/molecular targets of tocotrienol 30

48 2.3 Research Aims and Objectives The main aim for this part of the research work was to extract natural antioxidants from rice bran of different Sarawak local rice varieties. In order to achieve the aforementioned objective, experimental works were designed to fulfil the following objectives: a. Extraction of natural antioxidant compounds from rice bran of different Sarawak local rice varieties via simple solvent extraction method. b. Assessment of the contents of antioxidant compounds derived from RBE of different Sarawak local rice varieties. c. Quantitative analyses of antioxidant compounds derived from RBE via UV-Visible Spectrophotometer (UV-Vis) and High Performance Liquid Chromatography (HPLC). 2.4 Experimental Design Materials and Chemicals Rice Samples A total of nine different Sarawak local rice samples were used in this study. The whole rice grain samples were provided by Department of Agriculture Sarawak, Malaysia, sourced from local rice plantation sites that are based in Sri Aman and Bario (for Padi Bario ), in Sarawak, Malaysia. The local names for the nine rice samples are Padi Bubuk, Padi Bajong, Padi Bajong LN, Padi Wangi Mamut, Padi Bali, Padi Bario, Padi Biris, Padi Pandan, and MR219, which is a commercially grown rice variety. Among all the test samples, Bajong LN, Bali and Wangi Mamut are pigmented rice. The images of the rice grains are summarized in the table (Table 2-2) as follow: 31

49 Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of different rice samples. Sarawak Local Rice Varieties Local Name: Padi Bubuk Local Name: Padi Bajong Local Name: Padi Bajong LN Local Name: Padi Wangi Mamut Local Name: Padi Bali Local Name: Padi Bario 32

50 Local Name: Padi Biris Local Name: Padi Pandan Name: MR219* *(Commercially cultivated rice grains) Chemicals Analytical grade methanol (MetOH) (EMSURE ), HPLC grade methanol (MetOH), hydrochloric acid (HCl) and Folin-Ciocalteu s reagent were purchased from Merck (Darmstadt, Germany). Absolute ethanol (EtOH) was purchased from Fisher Scientific (Malaysia). Glacial acetic acid (CH 3 COOH) was purchased from J.T Baker (Thailand). Potassium chloride (KCl) and sodium acetate (NaOAc) were purchased from R&M (Malaysia). Sodium carbonate (Na 2 CO 3 ) and sodium hydroxide (NaOH) were purchased from Unichem (Malaysia). Sodium nitrite (NaNO 2 ) was purchased from Bendosen (Malaysia). Aluminium trichloride (AlCl 3 ) was purchased from Acros Organics. Gallic acid was purchased from NextGene. Quercetin was purchased from Sigma Aldrich. Tocomin50 (Carotech, Malaysia) standard was a gift in kind given by Prof. Yuen Kah Hay and Dr. Sherlyn Lim from Universiti Sains Malaysia (USM). 33

51 2.4.2 Rice Sample Treatment and Preparation of Rice Bran Sample All immature and diseased whole rice grains were first removed manually via hand pick from the healthy grains. Then, all the healthy whole rice grains were pre-dried in forced air drying oven (TFAC-136 Drying Oven, Tuff) overnight at 70ᵒC to remove moisture and to minimize deterioration in milling quality of rice grains (Ondier, Siebenmorgen & Mauromoustakos 2012). The dried whole rice grains were then stored in air tight bags and kept in -22ᵒC freezer until further use. For preparation of rice bran sample, rice milling machine (N6.0II, Saint Donkey) was used to separate the husk layer, bran layer and rice of the whole grains. The collected brans were immediately filtered through sieves to remove residual husk layers that were carried over during the milling process. The filtered brans were then stored in air tight bags and kept in -22ᵒC freezer until further use. Storing rice bran at cold temperature helps to stabilize the bran from becoming rancid as a result of oxidation mediated by enzymatic reaction of lipases (Nagendra Prasad et al. 2011; Randall et al. 1985). 34

52 2.4.3 Methodology Figure 2-9 summarises the overview of experimental approaches applied for extraction and analysis of antioxidants derived from rice bran samples of different Sarawak local rice varieties. Rice Bran RBE Extraction with Methanol (MetOH) UV-Visible Spectrophotometry Total Phenolic Content Total Flavonoid Content Total Anthocyanin Content Extract Lyophilization Reconstituted Extract Extracts with known concentration in (µg/ml) Total γ-oryzanol Content High Performance Liquid Chromatography Vitamin E (Tocotrienols) Figure 2-9: Overview of experimental approaches applied for extraction of antioxidants from rice bran samples and determination of the contents of antioxidants in the extracts Simple Solvent Extraction Extraction of antioxidants from rice brans was carried out at a sample mass to solvent ratio of 1:10 [weight (g)/volume (ml)], using 3g of rice bran and 30mL of analytical grade methanol. The mixture was stirred continuously on a stirring hot plate (Stirring Hot Plate HS0707V2, Favorit) for 30 minutes, at room temperature. After 30 minutes, the RBE were centrifuged (Centrifuge 5702, Eppendorf) for 10 minutes at 1,000 RPM. The supernatants were collected and extraction of the residual bran samples were repeated twice more and all the supernatants were combined. 35

53 The solvent in the collected extracts were then evaporated using rotary evaporator at 35 C (RE300, Yamato) and were further concentrated using vacuum concentrator ( , Labconco) until the extracts were fully lyophilized. The lyophilized extracts were then weighed and kept in -22ᵒC freezer until further use. For the analysis of rice bran antioxidants, a known concentration stock solution of crude extract was prepared by dissolving the lyophilized extract samples in absolute ethanol. The prepared stocks were then used to prepare a series of diluted samples Determination of Total Phenolic Content Total phenolic contents of RBE were determined as per method of Singleton and Rossi (1965) with slight modification. Briefly, 10µL of RBE were aliquoted onto a 96-wells plate. Then 40µL of 7.5% (w/v) sodium carbonate (Na 2 CO 3 ) was added into each well and later followed by the addition of 50µL of Folin-Ciocalteu reagent (diluted 10 folds). The solutions were allowed to stand in the dark and at room temperature for 60 minutes. Then, the absorbance of the solutions was measured using a microplate reader (Synergy HT, Biotek) at 765nm. Different concentrations of gallic acid (10-100mg/mL) were used to prepare a standard curve and the total phenolic contents of extracts were expressed in mg of gallic acid equivalents (GAE) per gram of dried extract Determination of Total Flavonoid Content Total flavonoid content of RBE were determined via the aluminium trichloride method as per method of Jia, Tang and Wu (1999) and Herald, Gadgil and Tilley (2012) with slight modification. Briefly, 250µL of RBE were mixed with 1mL of ultra-pure water (Milipore) and 75µL of 5% (w/v) of sodium nitrite (NaNO 2 ). The mixtures were vortexed (Maxi Mix II, Barnstead International) thoroughly for 5 minutes. Then, 150µL of 10% (w/v) aluminium trichloride (AlCl 3 ) was added into all the mixtures respectively and were allowed to incubate for 6 minutes at room temperature. Later, 500µL of 1M sodium 36

54 hydroxide (NaOH) and 500µL of ultra-pure water were added into the mixtures. The mixtures were then centrifuged at 3,000 RPM for 5 minutes to eliminate the precipitates. Finally, the absorbances of the collected supernatants were measured via UV-Visible Spectrophotometer (Cary 50 Conc UV-Visible Spectrophotometer, Varian). Different concentrations of quercetin ( mg/mL) were used to prepare standard curve and the total flavonoid contents of RBE were expressed in the unit of mg of quercetin (QE) equivalents per gram of dried extract Determination of Total Anthocyanin Content Total anthocyanin content of RBE were assessed via ph differential method as per method of Giusti and Wrolstad (2001). Briefly, 25µL of RBE were mixed with 175µL of 0.024M potassium chloride (KCl) buffer (ph 1.00) onto a 96-wells microplate. The mixtures were left aside for 15 minutes before absorbance was measured via microplate reader (Synergy HT, Biotek) at 510nm and 700nm respectively. Another 96-wells microplate was set up, consisting of mixtures of 25µL of RBE and 175µL of 0.025M sodium acetate (NaOAc) buffer (ph 4.5). The mixtures were also left aside for 15 minutes incubation at room temperature before their respective absorbances were read at 510nm and 700nm respectively. The following equations were used to calculate the total anthocyanin content of RBE: Equation 1: Absorbance = (A 510nm A 700nm ) ph 1.0 (A 510nm A 700nm ) ph 4.5 A x MW x DF x 1000 Equation 2: Total Anthocyanin Content = MA x 1 *Equation 1 determines the variation in absorbance between two ph buffer systems. *Equation 2 determines the total anthocyanin content of sample in the unit of mg cyanidin-3-glucoside equivalent per mass of sample, in which: 37

55 A = Difference in Absorbance from Equation 1 MW = Molecular weight of cyanidin-3-glucoside (C3G) (449.2g/mol) DF = Sample dilution factor MA = Molar absorptivity (equivalent to 26900) Determination of Total Gamma Oryzanol (γ-oryzanol) Content Total γ-oryzanol contents of RBE were determined spectrophotometrically as per method of Bucci et al. (2003) with slight modification by using a UV-Visible Spectrophotometer (Cary 50 Conc UV- Visible Spectrophotometer, Varian). Briefly, the analysis was performed at the wavelength in the range between 250nm to 800nm. Maximum absorption spectrum of γ-oryzanol was determined at 327nm. Different concentrations of γ-oryzanol reference standards were used to create a standard calibration curve and the total γ-oryzanol content of RBE were expressed in unit of mg of γ-oryzanol per kg of sample. 38

56 Determination of Vitamin E Content Vitamin E contents of RBE were determined via a reversed phase High Performance Liquid Chromatography (HPLC) system (Agilent 1260 Infinity LC, Agilent Technologies) coupled with a fluorescence detector (Agilent 1260 Infinity Fluorescence Detector, Agilent Technologies). Briefly, stock RBE of each rice varieties was diluted 40 times with HPLC grade methanol. All samples were filtered through 0.45µm PTFE filter prior to sample injection into HPLC. A solvent system consisting of 100% HPLC grade methanol was delivered to a 4.6 x 250mm, 5µm C-18 column (Zorbax SB-C18, Agilent Technologies). Separation of vitamin E isomers was performed in isocratic elution mode at a flow rate of 1.0mL/min and column temperature was kept at 25ᵒC. A sample injection volume of 25µL was injected into the HPLC and the vitamin E derivatives were detected at the excitation wavelength of 296nm and emission wavelength of 330nm. Tocomin50, a mixture of tocotrienols and tocopherol derived from palm oil was used as reference standard Statistical Analysis All results data were presented as mean and standard deviation of three consecutive experimental repetitions on similar sample. Statistical tool, GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data via one-way analysis of variance (ANOVA). The differences among test samples were determined via Tukey s multiple comparison test with significance and confidence level set at P

57 2.4.4 Results and Discussion Determination of Total Phenolic Content In the following study, total phenolic contents of nine different types of rice brans from local rice varieties were analysed. The total phenolic contents of rice brans were determined via a modified Folin Ciocalteu s assay method. The total content was expressed in unit of gallic acid equivalent (in mg) per g of dried extract. As summarized in Table 2-3, only total phenolic contents in RBE of Bajong, Bajong LN, Bali and Pandan varied significantly (P 0.05) while no significant difference was determined between the remaining RBE samples. Based on the result, the total phenolic contents of all the RBE ranged between 1.34mg GAE/g and 46.80mg GAE/g dried extract. Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant difference at P 0.05 (Tukey s Test). GAE = Gallic Acid Equivalent. Graphical representation for the following data is presented in Figure 5-1 (Appendix Section). RBE of Different Rice Varieties Bajong LN Bali Pandan Wangi Mamut Bajong MR219 Bario Biris Bubuk Total Polyphenol Content (mg GAE/g dried extracts) ± 2.80 a ± 2.09 b ± 0.17 b 5.89 ± 0.64 c 3.60 ± 0.43 cd 3.59 ± 0.38 cde 2.04 ± 0.35 def 1.73 ± 0.18 defg 1.34 ± 0.29 deg 40

58 In the present study, three out of nine samples are pigmented rice varieties. The three pigmented rice varieties are Bajong LN, Bali and Wangi Mamut. RBE derived from Bajong LN, Bali and Wangi Mamut generally showed a higher total phenolic content as compared to non-pigmented varieties. Such trend is concurrent with reports from several researchers in which pigmented rice varieties were found to contain more phenolic compounds as compared to none pigmented rice varieties (Huang & Ng 2012; Mohanlal et al. 2013; Seo et al. 2013; Yawadioa, Tanimorib & Moritta 2007). Among the three pigmented rice varieties, RBE of Bajong LN had the highest total phenolic content, and then followed by Bali and lastly Wangi Mamut. Their respective contents were significantly different from one another (P 0.05). However, in the present work, it was discovered that the RBE of nonpigmented rice varieties, Pandan showed a higher total phenolic content when compared Wangi Mamut and the difference was significant (P 0.05). Based on the present result, it is more likely that RBE of Pandan contains more phenolic compounds than RBE of Wangi Mamut. It was suggested that factors such as variation in plant genetic diversities and growth environment factors influence the difference in total phenolic contents of the two rice varieties (Britz et al. 2007; Huang & Ng 2012). To the best of author s knowledge, most of the selected Sarawak local rice varieties in the present study remain underexplored. There is a lack of reference data to be used for comparison with the presently obtained results. There was a study on the total phenolic content of MR219 rice variety by Fasahat et al. (2012). However, direct comparison cannot be performed as their main focus was not emphasized on the phenolic content in rice bran but on the polished rice grain (0.32mg GAE/g) instead (Fasahat et al. 2012). The present study reported average total phenolic contents of 388mg GAE/100g and 2378mg GAE/100g for non-pigmented (white bran) and pigmented (purple bran) rice respectively. Table 2-4 summarizes the total phenolic contents of rice varieties from different locations. As per review of Goufo and Trindade (2014), the present data were comparable to pooled data of total phenolic contents detected in more than 50 different types of rice 41

59 varieties cultivated in different countries (inclusive of China, Taiwan, Brazil, Thailand, India). They were 294.1mg GAE/100g and mg GAE/100g for non-pigmented and pigmented rice respectively. The average total phenolic contents for non-pigmented rice bran reported in this study (338mg GAE/100g) were slightly higher than those reported in Taiwan (196.1mg GAE/100g) (Huang & Ng 2012) and Iran (256.6mg GAE/100g) (Ghasemzadeh et al. 2015) respectively. As of the selected pigmented rice bran in this study, the average total phenolic contents reported was 2378mg GAE/100g which was higher than those detected in Taiwan (949.0mg GAE/100g) (Huang & Ng 2012) and Thailand (1091.0mg GAE/100g) (Muntana & Prasong 2010). Table 2-4: Average total phenolic contents in different rice varieties Average Total Phenolic Content (mg GAE/100g) Location of Rice Varieties Non-Pigmented Rice Pigmented Rice Malaysia (Sarawak) China, Taiwan, Brazil, Thailand, India (Pooled Data) (Goufo & Trindade 2014) n.a not available Taiwan (Huang & Ng 2012) China (Zhang et al. 2010) Thailand (Muntana & Prasong 2010) Iran (Ghasemzadeh et al. 2015) n.a India (Parvathy et al. 2014) Contrarily, the average total phenolic contents reported in this study were slightly lower than those detected in commercial rice varieties cultivated in China (Zhang et al. 2010) and India (Parvathy et al. 2014). The average total phenolic contents detected in non-pigmented and pigmented rice varieties cultivated in China and India were 485mg GAE/100g and mg GAE/100g, and 650mg GAE/100g and 3935mg GAE/100g respectively. The differences in total phenolic contents among different rice varieties cultivated in various parts 42

60 of the world could be due to variations in genetic diversity and environmental factors (Huang & Ng 2012). The effect of bran colour on the phenolic acid composition in rice is one of the most significant factors. Strong correlation between the colour of rice bran and its total phenolic content has been well documented. It has been reported that black rice varieties generally have the highest total phenolic content and followed by red, purple and white rice varieties (Shen et al. 2009; Zhang et al. 2006). In general, rice bran and husk have the highest phenolic content and then followed by polished rice grain (also known as white rice ) (Goufo et al. 2014a). 43

61 Determination of Total Flavonoid Content Total flavonoid contents of different RBE were determined via aluminium complexation-based spectrophotometric assay. Quercetin (QE), a type of flavonoid was used as the reference standard for the assay and results were expressed in mg QE/g dried extract. The flavonoid contents for all test samples are summarized in Table 2-5. Based on the results, total flavonoid contents in crude extracts of different rice bran varied significantly (P 0.05). The determined total flavonoid contents in crude extracts of different rice brans were in the range of 1.80 to 16.30mg QE/g dried extracts. Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). QE = Quercetin Equivalent. Graphical representation for the following data is presented in Figure 5-2 (Appendix section). RBE of Different Rice Varieties Bajong LN Pandan Bali Bajong Bubuk Wangi Mamut MR219 Bario Biris Total Flavonoid Content (mg QE/g dried extracts) ± 0.11 a ± 0.09 b 7.97 ± 0.03 c 5.00 ± 0.05 d 3.21 ± 0.07 e 3.19 ± 0.03 e 2.30 ± 0.06 f 1.88 ± 0.06 g 1.80 ± 0.01 g The highest total flavonoid content was determined from the crude extract of Bajong LN rice bran (16.30mg QE/g dried extract) while the lowest total flavonoid content was detected in RBE of Biris (1.80mg QE/g dried extract). 44

62 The total flavonoid content detected in rice varieties selected for this study in range of 1.80 to 16.30mg QE/g dried extracts. The range was slightly higher than those reported from rice varieties cultivated in India which was in the range of 1.68mg QE/g to 8.51mg QE/g (Rao et al. 2010). The present study reported average total flavonoid contents of 2.72 mg QE/g and 9.15mg QE/g for non-pigmented and pigmented rice respectively. Similar to the total phenolic content, total flavonoid content is evidently higher in pigmented rice when compared to non-pigmented rice (Goufo & Trindade 2014). Based on the pooled data reviewed by Goufo and Trindade (2014), average total flavonoid contents detected in non-pigmented and pigmented rice were 4.09mg catechin equivalent (CE)/g and 11.07mg CE/g respectively. Although different reference standard was used in the studies reviewed, it still showed the trend of pigmented rice having higher total flavonoid content as compared to those nonpigmented rice. Among the three pigmented rice, RBE of Bajong LN reported the highest total flavonoid content, then followed by Bali and lastly Wangi Mamut. Their respective total flavonoid contents were significantly different from one another (P 0.05). However, RBE of Pandan reported a significantly higher (P 0.05) total flavonoid content as compared Bali extract, and the flavonoid content in Bajong extract was also significantly higher (P 0.05) than the latter in Wangi Mamut extract. Based on the present result, it was deduced that the RBE of Pandan (non-pigmented rice) contain more flavonoids as compared to both RBE of Bali and Wangi Mamut (pigmented rice). However, it was suggested that factors such as variation in plant genetic diversities, growth environment factors, and extraction method do influence the total flavonoid contents in different rice varieties (Britz et al. 2007; Huang & Ng 2012). 45

63 Determination of Total Anthocyanin Content Total anthocyanin contents of different RBE were determined via ph differential method. The results are depicted in Table 2-6. Cyanidin-3-glucoside, a type of monomeric anthocyanin was used as reference standard. The data were all expressed in unit mg cyanidin-3-glucoside equivalent/100g of dried extract. Based on the results, only the total anthocyanin contents in RBE of Bali (11.94mg/100g), Bario (12.40mg/100g), and MR219 (11.91mg/100g) were significantly different from Bajong (10.80mg/100g) at P Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of mg cyanidin-3-glucoside equivalent/100g dried extracts. Results were expressed in mean ± standard deviation of three consecutive experimental repetitions (n=3). Graphical representation for the following data is presented in Figure 5-3 (Appendix section). RBE of Different Rice Varieties Total Anthocyanin Content (mg cyanidin-3-o-glucoside/100g dried extracts) Bario ± 0.16* Pandan ± 0.2 Bali ± n.a* MR ± 0.06* Bajong LN ± 0.68 Wangi Mamut ± 0.55 Bajong ± 0.06 Bubuk 9.77 ± 0.51 Biris 8.84 ± 0.88 n.a not available *Significantly different from Bajong at P 0.05 (Tukey s Test) The highest total anthocyanin content was determined in the RBE of Bario (12.40mg cyanidin-3-o-glucoside equivalent /100g) while the lowest total anthocyanin content was determined in the RBE of Biris (8.84mg cyanidin-3-oglucoside equivalent /100g). 46

64 Cyanidin-3-glucoside is the predominant form of anthocyanins present in rice. Its content accounted for 51-84% of the total anthocyanin content in rice, particularly on the bran layer of rice (Goufo & Trindade 2014). Most the literature reported a higher total anthocyanin content in pigmented rice as compared to non-pigmented rice. The average total anthocyanin contents in pigmented rice (440mg cyanidin-3-o-glucoside equivalent/ 100g) were approximately 10 folds much higher than those in non-pigmented rice (4.34mg cyanidin-3-o-glucoside equivalent/ 100g). Within the group of pigmented rice, purple rice has the highest total anthocyanin content, then followed by black rice, red rice, and brown rice respectively (Goufo & Trindade 2014). It has been revealed that black rice contains mainly anthocyanins (Zhang et al. 2010) while the red rice are mainly composed of proanthocyanidins (Min, McClung & Chen 2011). As for purple rice, it contains both anthocyanins and proanthocyanidins (Goufo & Trindade 2014). The present result did not follow the trend of pigmented rice having higher total anthocyanin content as compared to the non-pigmented rice varieties. The total anthocyanin contents of pigmented rice varieties: Bali, Bajong LN, and Wangi Mamut were 11.94, and 10.94mg cyanidin-3-oglucoside equivalent/ 100g respectively. These reported values were lower than some of the non-pigmented rice varieties studied which include Bario (12.40mg cyanidin-3-o-glucoside equivalent/ 100g), Pandan (12.08mg cyanidin-3-oglucoside equivalent/ 100g), and MR219 (11.90mg cyanidin-3-o-glucoside equivalent/ 100g). Such discrepancies could be due to the degradation of anthocyanin compounds over the course of sample storage. Various factors such as ph, temperature, light exposure, compound structure, and storage concentration are known to alter the stability of anthocyanins (He et al. 2012). Anthocyanins are generally more stable in acidified media (lower ph) as compared to the higher ph alkaline media. Different ph will have an effect on the compound structure of anthocyanins (Bordignon-Luiz et al. 2007; Morais et al. 2002). Temperature wise, anthocyanins are more stable at lower temperature (4 C) and usually stored in powder or concentrated forms. These factors have been shown to alter the stability and half-life of anthocyanins (Bordignon-Luiz et al. 2007). 47

65 Determination of Total Gamma Oryzanol (γ-oryzanol) Content Total γ-oryzanol content in RBE of different rice varieties were analysed via a fixed wavelength spectrophotometric method (Bucci et al. 2003). γ-oryzanol was used as reference standard to establish a standard curve for determination of total γ-oryzanol content in all test samples. The total γ-oryzanol contents of RBE were depicted in Table 2-7. Based on the obtained results, total γ-oryzanol contents in RBE of different rice varieties were significantly different (P 0.05) from one another. The highest total γ-oryzanol was determined in RBE of Bajong LN ( mg/kg dried extracts) while the lowest total γ-oryzanol was determined in RBE of Bario ( mg/kg dried extracts). Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation for the following data is presented in Figure 5-4 (Appendix section). RBE of Different Rice Varieties Bajong LN Pandan Bali Bajong Bubuk Wangi Mamut Biris MR219 Bario Total γ-oryzanol Content (mg/kg dried extracts) ± a ± 4.76 b ± 5.36 c ± d ± 6.02 e ± 3.04 f ± 4.69 g ± 8.59 h ± 7.01 i 48

66 In this study, the total γ-oryzanol contents detected in non-pigmented and pigmented rice were in the range of mg/kg to mg/kg and mg/kg to mg/kg respectively. The obtained data were slightly different from data pooled and summarized by Goufo and Trindade (2014) which were in the range of mg/kg and mg/kg γ-oryzanol for non-pigmented and pigmented rice respectively. Aside from that, Min, McClung and Chen (2011) also reported a different range of total γ-oryzanol content ( mg/kg to mg/kg) detected in different types of rice bran. γ-oryzanol is a mixture of ferulate esters with sterols or triterpenes. There are four main components of steryl ferulates, namely campesteryl ferulates, cycloartenyl ferulates, 24-methylenecycloartenyl ferulates and β- sitosteryl ferulates. Among all different types of cereal grains, rice has the highest content of γ-oryzanol (Kozuka et al. 2012). Variation in plant genotypes could be one of the factors causing variation in total γ-oryzanol content among different rice varieties. In addition to that, it has been discovered that environmental factor, such as growth temperature also influence the total γ- oryzanol content in rice (Britz et al. 2007). Other than that, the yield of γ- oryzanol is also highly dependent on the extraction method and solvent used for the extraction (Chen & Bergman 2005). The effects of bran colour on the total γ-oryzanol composition of rice were not apparent. The colour of rice generally does not stipulate the levels of total γ-oryzanol content as there is no significant correlation between the two variables (Huang & Ng 2012). However, the distribution of γ-oryzanol in rice predominantly exists in the bran portion of rice, followed by the whole rice grain, husk and finally the endosperm (Kozuka et al. 2012). This gives an indication that γ-oryzanol is mostly concentrated in the pericarp than the endosperm portion of the rice. 49

67 Determination of Vitamin E Content Total vitamin E contents of different RBE were determined via high performance liquid chromatography (HPLC) method. Tocomin50, a tocotrienols rich fraction derived from palm oil was used as the reference standard for the analysis. A total of 50% of the content in tocomin50 is constituted of delta (δ-) tocotrienols (5.30%), gamma (λ-) tocotrienols (20.60%), alpha (α-) tocotrienols (12.30%) and tocopherol (mainly α-tocopherol: 11.80%) while the remaining 50% of the components are consisting of phytosterols, co-enzyme Q10 and carotenoids. Figure 2-10 depicts the HPLC chromatograms of Tocomin50 standard [Figure 2-10(a)] and RBE sample [Figure 2-10(b)] respectively. (a) (b) Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN. Delta T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α- tocotrienols; Tocopherol: mainly α-tocopherol 50

68 Due to the nature of tocomin50, only δ-t3, γ-t3, α-t3 and tocopherol (mainly α-tocopherol) were determined in different RBE via HPLC. Contents of different vitamin E derivatives were expressed in units of mg/kg sample. Based on the result as shown in Table 2-8, the contents of γ-t3, α-t3 and tocopherol (mainly α-tocopherol) differed significantly (P 0.05) among different RBE. The δ-t3 contents of different RBE were in the range of 3.18 to 15.41mg/kg. As for γ-t3, they were in the range of to mg/kg; α-t3 was in the range of 1.46 to 87.12mg/kg; tocopherols (mainly α-t) were in the range of to mg/kg. Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE were expressed in units of mg/kg. The data represented mean ± standard deviation of three repetitions (n=3). Different letters within the same column denote significant difference at P T3 = tocotrienols; T = tocopherol. Vitamin E Content (mg/kg) Rice Varieties δ-t3 γ-t3 α-t3 T Bajong 9.51±0.24 a ±5.64 a 36.86±0.41 a ±0.52 a Bajong LN 15.41±1.72 a ±5.15 b 68.02±2.34 b ±6.32 b Bali 3.18±0.15 b ±4.61 b 13.72±1.31 c 55.09±1.27 c Bario 9.36±0.23 a ±1.96 c 11.57±0.06 c 61.32±1.47 cd Biris 6.81±0.21 c ±1.15 d 87.12±32.17 d ±7.82 e Bubuk 7.88±0.22 a ±0.67 e 24.47±0.73 e ±0.67 f MR ±0.20 a ±4.40 f 1.46±0.042 f 54.62±1.58 cd Pandan 6.33±0.08 a ± 4.82 g 28.19±2.99 ae ±3.02 g Wangi Mamut 7.94±0.13 a ±1.23 h 49.28±1.10 g ±3.75 h 51

69 The obtained results varied slightly from the contents of different vitamin E derivatives detected in rice varieties grown in Taiwan (Huang & Ng 2012). Higher contents of vitamin E derivatives were detected in Sarawak local rice as compared to those detected in Taiwan s rice varieties. The δ-t3 contents of different Taiwan rice varieties were in the range of 1.34 to 3.53mg/kg. As for γ- T3, they were in the range of to mg/kg; α-t3 were in the range of 8.44 to 67.01mg/kg; tocopherols (mainly α-t) were in the range of to mg/kg (Huang & Ng 2012). Such variations could have been caused the differences in plant genotypes, environmental condition, harvesting method and extraction method. Regardless of the type of rice, γ-t3 appeared to be the predominant form of vitamin E that is present in the rice bran. The second most abundant vitamin E derivative in rice bran is tocopherol, then followed by α-t3 and lastly, δ-t3 which only exist in trace amount (Huang & Ng 2012). Moreover, in addition to the four tocotrienol derivatives, two additional novel tocotrienols derivatives were isolated from rice bran and they were characterized as desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al. 2000). As depicted in Figure 2-11, the compositional percentage of different vitamin E derivatives in different RBE varied from one another. In general, the content of γ-t3 was the highest among other vitamin E derivatives determined, accounting for 41.67% % of the total vitamin E content. Tocopherol was the second most abundant vitamin E derivatives determined, accounting for 13.14% % of the total vitamin E content. As for δ-t3 and α-t3, both vitamin E derivatives only existed in trace amount, with content in the ranges of 0.76% % and 0.39% % of the total vitamin E content determined respectively. Based on the present results, there is no significant correlation between the colour of rice bran and the content of different vitamin E derivatives (Table 2-8). Similar result trend was also reported by Goufo and Trindade (2014). It was suggested that plant genotypes and growth environment are known to be the major factors that contribute to the total contents of vitamin E derivatives (Goufo & Trindade 2014). 52

70 Percentage (%) 100% 80% Vitamin E Composition Analysis δ-t3 γ-t3 α-t3 T 60% 40% 20% 0% Bajong Bajong L.N Bali Bario Biris Bubuk MR219 Pandan Wangi Mamut Rice Varieties Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE were expressed in units of %. The data represented mean ± standard deviation of three repetitions (n=3). T3 = Tocotrienols; T = Tocopherol. 53

71 2.4.5 Conclusion Total contents of phenolic compounds, flavonoids, anthocyanins, γ- oryzanol and vitamin E (specifically on δ-tocotrienols, α-tocotrienols, γ- tocotrienols and tocopherol) in different local rice varieties were thoroughly assessed in this study. The results have demonstrated discrepancies in the contents of bioactive compounds among different RBE of Sarawak local rice varieties. By studying the distribution of these bioactive compounds in different rice sample, it offers useful information for the selection of ideal rice variety as functional food. Among all the nine different Sarawak local rice varieties selected for this part of the study, the RBE of Bajong LN reported the highest contents of phenolic compounds (46.80mg GAE/g), flavonoids (16.30mg QE/g), and total γ- oryzanol ( mg/kg) respectively. Based on the obtained result, average total phenolic contents detected in selected Sarawak local rice varieties were 388mg GAE/100g and 2378mg GAE/100g for non-pigmented and pigmented rice respectively. The obtained value were slightly higher than the average total phenolic contents of more than 50 different rice varieties from various locations in the world (294.1mg GAE/100g and mg GAE/100g for non-pigmented and pigmented rice respectively). In addition to that, higher total flavonoids contents were also detected in Sarawak local rice varieties (1.80mg QE/g to 16.30mg QE/g) as compared to Njavara rice varieties (1.68mg QE/g to 8.51mg QE/g) cultivated in India. Total γ- oryzanol detected in the selected Sarawak local rice varieties was in the range of mg/kg to mg/kg which were comparable to the average range of total γ-oryzanol (1030mg/kg to 9120mg/kg) detected in various rice varieties in the world. As for vitamin E, higher contents of compounds were generally detected in Sarawak local rice as compared to those detected in Taiwan s rice varieties. The δ-t3 contents detected in different Taiwan rice varieties were in the range of 1.34 to 3.53mg/kg (Sarawak local rice: 3.18 to 15.41mg/kg). As for γ-t3, they were in the range of to mg/kg (Sarawak local rice: to 54

72 353.53mg/kg); α-t3 were in the range of 8.44 to 67.01mg/kg (Sarawak local rice: 1.46 to 87.12mg/kg); tocopherols (mainly α-t) were in the range of to mg/kg (Sarawak local rice: to mg/kg). Despite of discrepancies in vitamin E contents, most rice varieties share the same trend in their respective vitamin E composition. γ-t3 appeared to be the predominant form of vitamin E that are present in the rice bran and followed by tocopherol, α- T3 and lastly, δ-t3 which only exist in trace amount. Among nine different types of Sarawak local rice varieties studied, three of them are purple colour pigmented rice varieties (Bajong LN, Bali and Wangi Mamut) while the others are non-pigmented rice. Based on the obtained results, pigmented rice varieties generally have higher content of bioactive compounds when compared to non-pigmented varieties. Such result trend is consistent with reports from literature. Highest contents of phenolic compounds (46.80mg GAE/g), flavonoids (16.30 ± 0.11mg QE/g), γ-oryzanol ( ± 27.16mg/kg), and vitamin E (15.41 ± 1.72mg/kg δ-tocotrienols; ± 5.15mg/kg γ- tocotrienols; ± 2.34mg/kg α-tocotrienols; ± 6.32mg/kg tocopherol) were detected in the RBE of Bajong LN. The contents of bioactive compounds in Bajong LN were significantly higher than those detected in commercial rice variety, MR219. Due to the lack of reference data available for the selected Sarawak local rice varieties, direct comparison with the presently obtained results cannot be performed. Discrepancies in contents of bioactive compounds among different rice varieties could be due to variations in plant genotypes and growth environment. Both are known to have an effect on the production of bioactive compounds in plants. These essential compounds are produced by plants for growth, reproduction, and as part of the defence mechanisms against external stress factors. Besides that, other factors such as plant growth stage, harvesting period and method can also contribute to the differences in contents of bioactive compounds among different rice varieties. 55

73 In addition, the lack of standardized extraction and analytical methods might also contribute to variation in the data obtained. Bioactive compounds in plant material may exist in free form (soluble-free antioxidants) and conjugated forms (insoluble antioxidants) of glycosides or esters with additional compounds like sterols, glucosides, flavonoids, fatty acids, proteins, and alcohols. Due to the use of methanol as the extraction solvent in the present work, most of the extracted compounds were in the soluble-free forms which generally have low molecular weight. Contrarily, the high molecular weight insoluble forms of bioactive compounds tend to trap in food matrix and often present in remains of organic extraction (Goufo & Trindade 2014). Regardless of the discrepancies in the contents of bioactive compounds among different RBE, the present result put forward the potential of rice bran as a good source of essential natural antioxidants for health and wellness. It is an ideal food source that can be used in the development of nutraceuticals and functional food ingredients. 56

74 3. Chapter 3: Bioactivity Studies of Natural Antioxidants Derived from Rice Bran of Different Sarawak Local Rice Varieties 3.1 Executive Summary The existence of reactive oxygen species (ROS) is vital for biological activities of cells. Low amount of ROS can stimulate cellular physiological activities. Cells utilized a series of endogenous and exogenous antioxidant protection systems to regulate and maintain redox homeostasis. However, when the ROS production escalates and failed to be removed by antioxidants in the cells, it causes over-accumulation of ROS and eventually leads to oxidative stress. The presence of oxidative stress has been known to play the central role in the onset and progression of chronic diseases. Several evidences have revealed the involvement of oxidative stress in pathogenesis of cardiovascular diseases (CVD). Oxidative modification of essential biological components initiates a series of signal transduction cascade that eventually leads to the progression of CVD. Hence, the rationale of using natural antioxidant to attenuate the risks of CVD via inhibition of inadvertent cellular oxidative damage or signalling pathway may have important implications to both prevention and treatment of CVD. In the previous chapter (Chapter 2), a preliminary study on the contents of bioactive compounds in different RBE of Sarawak local rice varieties have been conducted. The current work focuses on the antioxidant activities of RBE. Two types of in vitro antioxidant assay systems (in vitro chemical-based and in vitro cell-based assay systems) have been used to assess the antioxidant capacity of Sarawak RBE. For the in vitro cell-based antioxidant assay system, the preliminary study of assessing antioxidant capacity of RBE towards cardioprotection was conducted by using a cardiac cell culture model. 57

75 In this chapter of the thesis, it provides a comprehensive literature review relevant to the field of study. In addition, summary of experimental approaches and presentation of results for the second section of the overall research work are also included in this chapter. 3.2 Literature Review Reactive Oxygen Species (ROS) and Oxidative Stress The existence of reactive oxygen species (ROS) always has been part of the physiological cycles of aerobic cells. ROS is referred as a general term for either free radicals or free radicals generating molecular species (Kunwar & Priyadarsini 2011). Common source of these reactive radicals include the byproducts both endogenous and exogenous metabolisms of aerobic cells, such as the superoxide (O 2 -) and nitric oxide (NO ) radicals while other external noxious sources such as chemicals, environmental toxins, drugs and radiation are also contributing to the increment of overall intracellular ROS content (Helmut 1994). Under normal cellular condition, cellular processes produce considerable amount of O 2 and NO radicals. During mitochondrial respiration and phagocytosis, cells taken up oxygen and converts it to O 2 - radicals. As for NO radicals, they are the enzymatic product of nitric oxide synthase which acts as relaxing factor and neurotransmitter for endothelium. Through a series of complex transformation, these two radicals are converted to stronger radical species such as the hydroxyl radical ( OH), peroxyl radicals (ROO ) and singlet oxygen ( 1 O 2 ). Certain radical species may further be converted to molecular radical species such as the peroxynitrite (ONOO - ) and hydrogen peroxide (H 2 O 2 ) (Kunwar & Priyadarsini 2011). All these reactive radical species are the sources of ROS in cells. 58

76 Certain biological functions of cells require low concentration of ROS. In this case, ROS acts as the stimulant for cellular physiological activities such as maintaining cellular growth, modulating gene expression, defencing the cell against infection and acts as secondary messengers for signal transduction pathways (Droge 2002; Schreck & Baeuerle 1991). However, ROS is relatively unstable due the possession of one or more unpaired electrons within its own electron configuration (Aruoma 1998). At high concentration, ROS are capable of interacting with different biomolecules in various ways to produce certain types of radicals. For example, when ROS interacts with crucial biomolecules like DNA, proteins and lipids, secondary radicals derived from sugar and nitrogenous bases, amino acids and lipids are produced. Oxidations of protein and DNA by ROS impose structural changes and fragmentation that disrupt their proper functions, and consequently result in cell death and mutation. As for cellular membrane, phospholipids are vulnerable to oxidation by ROS and forms lipid peroxides. These secondary radicals are capable of causing cascade reactions and affect the normal physiological functions of cells (Beckman & Ames 1997; Kunwar & Priyadarsini 2011). The balance between ROS production rates and the rates of its removal by various antioxidants is crucial for maintaining intracellular homeostasis of ROS. In all forms of life, the redox state of cells is mediated by cofactors such as glutathione (GSH), nicotinamide adenine dinucleotide (NAD), and flavin adenine dinucleotide (FAD) which are commonly found in cells, tissues and biological fluids. Cells usually have a more negative redox state under normal conditions (Kohen & Nyska 2002; Schafer & Buettner 2001). However, when the ROS production escalates and failed to be removed by antioxidants in the cells, the redox state of the cells will shift to a less negative state and thereby increases their oxidation status. Such situation is known as oxidative stress (Droge 2002). 59

77 Oxidative stress is known to induce intracellular cell damage and cell death that affects all critical biomolecules such as DNA, lipids, sugars and proteins (Dröge & Schipper 2007). For instance, when the level of oxidative stress in the cell elevates, cellular mitochondrial functions will deteriorate and cause the depletion of adenosine triphosphate (ATP) (Droge 2002). The depletion in ATP levels will then triggers cell death via necrosis or apoptosis (Eguchi, Shimizu & Tsujimoto 1997). Other than ATP levels as the determinant of cell death, it has been reported that the shifting of cellular redox state from a more negative to a less negative state also induce apoptosis- or necrosismediated cell death (Schafer & Buettner 2001). Many different chronic diseases such as atherosclerosis, neurological diseases, cancer and diabetics have been associated with oxidative stress. Factors such as molecular targets, mechanism and severity of oxidative stress define the consequence of oxidative stress injury on cells. In general, the hallmark of oxidative stress-mediated chronic diseases is widely linked with involvement of oxidative stress in the signal cascade reaction of inflammation and the production of chemo-attractants (Aruoma 1998) Oxidative Stress Related Disease The progression of chronic diseases such as cardiovascular disease, neurological disease, pulmonary disease, rheumatoid arthritis, nephropathy, and ocular disease has been attributed to complex and multifactorial physiological changes mediated by externally- and internally-driven stimuli (Pham-Huy, He & Pham-Huy 2008). There have been significant evidences supporting the involvement of oxidative stress in the progression of these diseases. Majority of these diseases were originated from the dysregulation of multiple genes as a consequence of oxidative stress (Aruoma 1998; Wang et al. 2011). 60

78 Oxidative stress occurs when excess free radicals fail to be removed and accumulated over time. Excessive accumulation of these free radicals exhibits a deleterious effect to essential biological components such as DNA, lipids, sugars, proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury, Mignotte & Vayssiere 2002). Under oxidative stress condition, normal functions of these essential biological components will undergo progressive oxidative modifications and consequently disturb their usual functions. The biological system will attempt to offset and regulate these stresses by initiating their respective repairing mechanisms. However, if the biological repairing mechanisms fail to counteract the attacks, oxidative stress will trigger the occurrence and progression of various chronic diseases through a series of signal transduction cascade events (Magalhaes et al. 2009) Cardiovascular Diseases Cardiovascular disease (CVD) still remains as one of the largest leading cause of global mortality. The World Health Organization (WHO) has estimated a total number of 17.5 million deaths from CVD in the year 2012, accounted for one-third of the global mortality (WHO 2015). The total numbers of annual fatalities are expected to increase to 20 million of death cases by 2020, and further increase to 24 million by 2030 (WHO 2004). In Sarawak, the disease accounted for the second leading cause of mortality among the local community. In 2012, there were a total of 26,000 cases reported and the number of cases continues to upsurge with 24,000 cases reported within the first eight months of 2013 (Ruekeith 2013). There is an urgent need for global attention to alleviate mortality rate of CVD. The onset and progression of CVD are known to be multifactorial (Pham- Huy, He & Pham-Huy 2008). There has been a huge debate over the potential role of oxidative stress as the primary source for pathogenesis of CVD (Ceriello 2008). Such hypothesis has been supported by evidences (Ceriello 2008; Chatterjee et al. 2007; Droge 2002) that reveal the involvement of oxidative stress in several types of CVDs. Coronary artery disease (CAD) is the most 61

79 common type of CVD that eventually leads to myocardial infarction, a medical event commonly known as heart attack (Ma et al. 2013). The disease begins with the narrowing of coronary arteries as a result of atherosclerosis (Forycki 2010). Progressive narrowing of coronary arteries reduces the blood supply to the heart. If the condition gets worsen, it may cause a blockage in the coronary artery and completely disrupt the blood flow to heart. In such case, this will cause extensive damage to heart muscles and tissue whereby the consequences could be fatal (Chantal et al. 2012) Atherosclerosis Atherosclerosis refers to the hardening of arteries. It is a type of chronic inflammatory disease (Toh et al. 2014) and it has been known as the primary cause of CAD (Lönn, Dennis & Stocker 2012). It typically begins prior to adulthood and progresses slowly. Its slow progression and complicated etiology limit the detection of early atherogenic events for prevention measures (Lönn, Dennis & Stocker 2012). Some of the contributors to the development of atherosclerosis include smoking, unhealthy diet (high fat diet) and the lack of physical exercises. In addition, medical conditions such as hyperlipidemia, high blood pressure, and diabetes are also among the risk factors that closely associate with the development of atherosclerosis (Anand et al. 2008; Toh et al. 2014). One of the initiating causes of atherosclerosis was characterized as oxidative modification (Goldstein et al. 1979; Steinberg et al. 1989). Both oxidative stress and oxidation of low density lipoprotein (LDL) have been regarded as the key issues in pathogenesis of atherosclerosis (Muid et al. 2013). Excessive reactive oxygen species (ROS) produced from cellular metabolism add on to the oxidative stress, which in turn promotes various mechanisms of atherosclerosis, including endothelial dysfunction, migration of monocytes, LDL peroxidation and proliferation of smooth muscle cells (Berliner et al. 1995). The latter induce additional events that lead to progression of atherosclerosis. 62

80 The progression of atherosclerosis is complicated and multifactorial throughout different developmental stages. Progression of atherosclerosis was depicted in Figure 3-1 and the pathogenesis of atherosclerosis was summarized in Figure 3-2. Briefly, it begins with the entrance of low-densitylipoproteins (LDLs) into the sub-endothelial region (also known as intima) of the blood artery (Swirski & Nahrendorf 2013; Toh et al. 2014). Through a series of biochemical reaction and signal transduction cascade, it progressively leads to the formation of atherosclerotic plaque and narrowing of blood vessel. Blockage of blood artery will restrict the blood flow to the heart and consequently increase the likelihood of ischemia, a condition in which the supplies of oxygen and nutrients to the heart get disrupted (Lusis 2000). Prolonged condition of ischemia will induce extensive damage to heart muscles and tissues. Such event is known myocardial infarction, commonly known as heart attack (Chantal et al. 2012; Ma et al. 2013; Swirski & Nahrendorf 2013). 63

81 Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image source:(quillard & Libby 2012a)] 64

82 Different Stages in Pathogenesis of Atherosclerosis 1. Accumulation of low-density-lipoproteins (LDLs) occurs in intima matrix of the blood vessel. The LDLs undergo oxidation mediated by ROS produced from metabolic activities of surrounding cells and promote up-regulation of cell adhesion molecules to attract circulating monocytes. 2. Monocytes migrate into the intima matrix of blood vessel and undergo differentiation to form mature macrophages. Activated macrophages begin to uptake oxidized LDL and form foam cells (macrophage loaded with lipoproteins). Foam cells release pro-inflammatory cytokines and initiate localized inflammatory response and oxidative stress. This results in the recruitment of more macrophages in the intima matrix of blood vessel. 3. Foam cells begin to accumulate and form a lipid core (also known as atherosclerotic plaque) within the intima matrix of the blood vessel. Smooth muscle cells and collagen matrix begin to overlie the plaque and form a thin fibrous cap. Continuous accumulation of foam cells further increase the size of the plaque and narrow the diameter of the blood vessel. This begins to restrict the blood flow and potentially leads to ischemia. 4. Plaque ruptures occur as a result of over-accumulation of foam cells. It leads to the revelation of pro-thrombic content which subsequently initiates platelet aggregation and localized formation of thrombus. Delocalization of thrombus may cause blockage in the narrowed blood vessel and consequently leads to the onset of ischemia and myocardial infarction. Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b; Toh et al. 2014) 65

83 Although the causal role of oxidative stress in pathogenesis of atherosclerosis has been well documented (Goldstein et al. 1979; Steinberg et al. 1989), the exact underlying mechanisms for oxidative stress mediated cardiovascular pathophysiology remain complicated. Various in vivo studies have revealed ROS contributing to oxidative can be derived from exogenous or endogenous sources (Singh & Jialal 2006; Stocker & Keaney 2004). Therefore, a better understanding of the involvement ROS in progression of atherosclerosis is crucial. This will likely drive future research towards strategies of using antioxidants to attenuate atherosclerosis via inhibition of inadvertent cellular oxidative damage or signalling pathway. Ultimately, this may have important implications to both prevention and treatment of atherosclerosis (Lönn, Dennis & Stocker 2012) Myocardial Infarction (MI) and Myocardial Reperfusion Injury Myocardial infarction (MI) (Figure 3-3) is the medical terms commonly referred as an event of a heart attack. It is a type of cardiovascular disease (CVD) that occur when normal blood flow to heart is obstructed, causing injuries to the heart muscles and tissues. During such event, cardiac cells experienced apoptosis or cell death as a result of oxidative stress by ischemia and reperfusion injuries. Normal heart function begins to deteriorate along with the extensive cardiac cell apoptosis (Ma et al. 2013). Common themes for causality of MI are oxidative stress and inflammation. Both components have been implicated in pathogenesis of MI and their respective prevalence has strong positive correlation with reactive oxygen species (ROS) and free radicals. Although the involvement of oxidative stress and inflammation in progression of cardiac disorders has been evidently established, a complete picture of the mechanisms involved is still remains unclear. Through oxidative modification of essential cellular components, ROS and free radicals are capable of damaging both physical and physiological properties of cardiac cells or cardiomyocytes. Inflammatory responses triggered by damaged cells step-in in later stage and subsequently create cycles of 66

84 chronic damages that are difficult to breakdown. With extensive cardiac cell death or apoptosis, it ultimately leads to the deterioration of cardiac function (Li et al. 2013; Ma et al. 2013). Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal blood flow to heart is disrupted at site of arterial blockage and subsequently damages the heart muscles and tissues. [Image source: (Antipuesto 2014) ] Reperfusion of myocardium refers to the condition in which the blood supply returns to the heart tissue after myocardial ischemia. During the event of myocardial ischemia, cardiac muscles can endure injuries from the event for up to 15 minutes, following an immediate myocardial reperfusion before the death of cardiomyocytes occurs (Verma et al. 2002). However, with the extended duration and severity of ischemic injuries, the damage to myocardium is irreversible even after reperfusion and the consequences can be fatal. Such damage to myocardium is referred as ischemic reperfusion injury (Arslan et al. 2010). 67

85 At the event of severe reperfusion injury, extensive damages to the myocardium occur through endothelial injuries and permanent myocytes apoptosis. Though numerous factors have been known for causing the injuries, it has been evidently suggested that oxidative stress and ROS play the key central role in mediating multiple signal transduction mechanisms and signalling pathways in myocardial reperfusion injury (Hori & Nishida 2009). Substantial amount of ROS is generated after the event of myocardial reperfusion. The cellular redox mechanism and enzymes such as nicotinamide adenine dinucleotide phosphate (NADPH oxidase), mitochrondria and xanthine oxidase were among the major contributors of ROS (Chen et al. 1998; Wang et al. 1998). Localized accumulation of ROS will eventually leads to the onset of oxidative stress and cause cell death. In additional, ROS also mediate signalling pathway that further induce the expression of inflammatory cytokines such as interleukin-6 (IL-6), interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) (Irwin et al. 1999). Overexpression of these inflammatory cytokines can also trigger additional inflammatory responses that further threaten the survival and death of myocyte cells (Nian et al. 2004). Both ROS and inflammatory cytokines are capable of interrupting mitochondrial energy production and ultimately induce myocyte cell death (Hausenloy & Yellon 2008). After reperfusion injuries, impairment of intracellular homeostasis of calcium (Ca 2+ ) ions occurs at cardiomyocytes level. Extensive production of ROS mediates the overloading of Ca 2+ and further enhances the permeability of cardiomyocytes mitochondrial membranes (known as mitochondrial permeability transition pore, MPT pore) through a series of signal transduction cascades (Hori & Nishida 2009; Javadov & Karmazyn 2007). The opening of MPT pore ceases the normal function of mitochondria in ATP production and halts the energy supports for sustaining the survival of myocyte cells. Consequently, the cells died of energy depletion (Hausenloy & Yellon 2008). 68

86 3.2.3 Antioxidants Cells developed a series of antioxidant protection systems to regulate and maintain redox homeostasis. The cellular antioxidant protection systems can be derived from endogenous and exogenous origins (Krishnamurthy & Wadhwani 2012). These systems work synergistically to maintain the balance between oxidants and antioxidants within the physiological system. The prevalence of oxidative stress arises when oxidation-reduction balance in cells is disrupted. Normal cellular metabolic processes produce small amount of ROS and free radicals. These radicals are usually scavenged by the cellular antioxidant defence system which consists of endogenous cellular antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) (Pham-Huy, He & Pham-Huy 2008). However, in disease state such as cardiac ischemia and reperfusion injuries, overproduction of ROS and free radicals substantially deplete the available antioxidants and disrupt the cellular redox homeostasis. With the elevation of ROS and free radicals status in cells, it creates oxidative stress environments which promote cell death (Ma et al. 2013; Noori 2012). Apart from endogenous cellular antioxidants, natural exogenous antioxidants are also involved in quenching of ROS and free radicals within the biological system. These antioxidants are usually derived from food and often require replenishment via dietary sources. Through years of extensive research on natural antioxidants, they have been proven to quench free radicals effectively and improve the antioxidant status of cells and provide protection against cellular oxidative injuries (Magalhaes et al. 2009). With the fact that chemistry between oxidants and antioxidants controls various crucial cellular pathway and metabolism, the simple oxidant-antioxidant imbalance theory has now grown to be incorporated into the progression of various chronic diseases. Hence, the rationale for strategies of utilizing exogenous natural antioxidants as therapeutic intervention to attenuate cardiac injury through inhibition of inadvertent cellular oxidative damage or signalling pathways may have important implications to both the prevention and treatment of these diseases (Tsuda et al. 2002b). 69

87 Endogenous antioxidant Endogenous antioxidants are the antioxidant protection system produced by the body. They can be sub-categorized into non-enzymatic- and enzymatic antioxidants (Krishnamurthy & Wadhwani 2012). Non-enzymatic antioxidants refer to components such as bilirubin, coenzyme Q10, uric acid, glutathione and cellular redox system, NADPH and NADH (Krishnamurthy & Wadhwani 2012). Endogenous enzymatic antioxidants often refers to cellular antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) (Pham-Huy, He & Pham-Huy 2008). They are the first line of enzyme-based cellular defensive systems. Each enzyme plays a different role is alleviation of oxidative injury (Rodrigo et al. 2013). Briefly, SOD involves in the neutralization of superoxide anions (O - 2 ) into hydrogen peroxide (H 2 O 2 ) and oxygen (O 2 ). H 2 O 2 later becomes the substrate for both CAT and GPX. CAT transforms H 2 O 2 to water (H 2 O) and oxygen (O 2 ) molecules while GPx catalyses the reduction of H 2 O 2 and hydroperoxides in the presence of co-substrate, reduced glutathione (GSH) (Pham-Huy, He & Pham-Huy 2008) Superoxide Dismutase (SOD) To date, four different isoforms of SOD have been identified. Each of these metalloproteins contains different metal ions: manganese (Mn), Copper- Zn (Cu/Zn), nickel (Ni) and Iron (Fe) (Meier et al. 1998). Most eukaryotes have three forms of SOD. They are Mn-SOD, Cu/Zn-SOD, and EC-SOD (known as extracellular SOD, the secreted form of Cu/Zn-SOD) (Kang & Kang 2013). Mn- SOD present mostly in mitochrondria while Cu/Zn-SOD occupies areas within the nucleus, cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani 2012). Bacteria mostly utilize Fe-SOD or Mn-SOD which localized predominantly in the mitochondria (Dos Santos et al. 2000). Catalytic reaction of SOD can be represented in the reaction equation below (Equation 3): 70

88 Equation 3: 2 O H + SOD H 2 O 2 + O 2 The highly reactive superoxide anions (O - 2 ) are neutralized by SOD to yield H 2 O 2 and O 2. The less reactive H 2 O 2 is further co-ordinately neutralized by CAT and GPx. The metal ions located at the active site of the enzymes are - responsible for the catalytic conversion of O 2 to H 2 O 2 and O 2 through redox reactions (Meier et al. 1998). Majority of the SODs have affinity towards fluoride ion (F - ) and azide ion (N - 3 ) which are both singly-charged anions. However, each isoform of SOD has distinctive response towards different anions. It was noted that F -, N - 3 and cyanide (CN - ) are the competitive inhibitors of Cu/Zn SOD (Leone et al. 1998; Vance & Miller 1998) Catalase (CAT) CAT enzyme has four porphyrin heme (iron-containing) groups. The enzyme catalyses the conversion of H 2 O 2 to H 2 O and O 2 in a two-steps reaction (Equation 4) (Kang & Kang 2013). First step involves the oxidation of heme group in CAT by a molecule of H 2 O 2. First step of the reaction yields an oxyferryl heme and a radical of porphyrin cation. Second step of the reaction involves the reduction of the enzyme back to its ground state and generate one molecule of H 2 O and O 2 respectively (Krishnamurthy & Wadhwani 2012). Equation 4: 2 H 2 O 2 CAT 2 H 2 O + O 2 ROOH + AH 2 H 2 O + ROH + A CAT protects intracellular ROS homeostasis by detoxifying H 2 O 2 produced from cellular metabolic activities. The enzyme primarily localized in peroxisomes of the cells and actively neutralize H 2 O 2 that diffuses into the peroxisomes (Slater 1984). It is also a highly conserved protein and gets encoded by a single gene. The presence of CAT is abundant in erythrocytes, 71

89 kidneys and liver. It has also been reported that its enzymatic activity is the highest in these components (Kang & Kang 2013; Nishikawa et al. 2002) Glutathione Peroxidase (GPx) GPx is a selenocysteine (Sec)-containing enzyme. The enzyme protects the cells against low level of oxidative injury by neutralizing H 2 O 2 and organic hydroperoxides in the presence of its co-substrate, GSH and the cellular NADPH-NADH redox system. The catalytic reaction involves the oxidation of GSH to oxidized form of glutathione (GSSG). GSSG is then reduced back to GSH by glutathione reductase (Equation 5) (Pham-Huy, He & Pham-Huy 2008). Equation 5: ROOH + 2 GSH GPx ROH + GSSG + H 2 O Eight different isoforms of GPx have been detected in mammals. Majority of the GPx isoforms (GPx1, GPx2, GPx3, GPx4 and GPx6) are selenocysteinecontaining enzymes while the remaining isoforms contain only cysteine at the active site of the enzymes. Among all the isomeric forms of GPx, only the functions of GPx1, GPx3 and GPx4 have been characterized to date (Kang & Kang 2013). Both GPx1 and GPx4 genes encode cytosolic GPx that are mainly distributed in cytoplasm. GPx1 gene has also involved in encoding mitochondrial GPx while GPx4 also encodes phospholipid hydroperoxide GPx that mainly localized in associated membrane. As for GPx3, it encodes extracellular GPx which is the secreted form of GPx (Esworthy, Ho & Chu 1997; Imai & Nakagawa 2003; Kang & Kang 2013). 72

90 Exogenous Antioxidants Exogenous antioxidants are dietary antioxidants that are not produced in the body. They are usually supplied to the body as food or supplements and need to be replenish regularly at moderate amount. Examples of exogenous antioxidants include polyphenols (flavonoids), vitamins (vitamin C and E), beta carotene, carotenoids, and polyunsaturated fatty acids (omega-3 and omega-6 fatty acids) (Pham-Huy, He & Pham-Huy 2008). Both vitamin C and E have been widely studied and they are known as the most important vitamin-based antioxidants in the biological system. Vitamin C (ascorbic acid) is hydrophilic in nature. Due to its instable and hydrophilic nature, it is readily excreted from the body and hence it requires constant replenishment. It is an important ROS scavenger in the extracellular fluids and essentially required for the biosynthesis of neurotransmitters and collagen (Li & Schellhorn 2007), Vitamin C has been shown to exhibit antioxidant, carcinopreventive- and immunomodulatory-properties. Synergistic effect of vitamin C and E in quenching of free radical has also been reported (Pham-Huy, He & Pham-Huy 2008). However, overdose (> 2000mg/day) of vitamin C was found to exhibit the properties of pro-oxidants (Naidu 2003). Vitamin E is lipophilic in nature. It exists in two major forms: tocopherol and tocotrienols. Each form is further sub-divided into four different derivatives (α-, γ-, β-, and δ-isomers) (Wolf 2005). The different isomeric forms of vitamin E are distinguished by the degree of substitution of methyl groups (-CH 3 ) in the chromanol head (Liva 2008). The antioxidant activity of vitamin E is largely attributed to the presence of redox active hydroxyl (-OH) group on its chromanol ring. It protects fatty acids of the cell membrane from lipid peroxidation (Litwack 2007). Aside from its antioxidant properties, other health attributes of vitamin E includes, anticancer, anti-cholestrolemic, anti-hypertensive, anti-diabetic, cardioprotective- and neuroprotective-effects have also been reported from in vitro and in vivo study models. (Alexander 2008; Hsieh & Wu 2008; Lee, Mar & Ng 2009; Newaz & Nawal 1999). 73

91 The research on plant-derived natural antioxidants becomes one of emerging field of study in the recent years (Islam et al. 2014). These phytochemicals are natural antioxidants comprise of phenolic or polyphenolic compounds such as polyphenols, flavonoids, anthocyanins, vitamins, and resveratrol which are commonly found in fruits, vegetables and nuts (Tsuda et al. 2002a). It has been revealed that frequent dietary intakes of antioxidant-rich food are commonly linked with low incidence of oxidative stress associated diseases. These naturally occurring bioactive constituents provide a defence system to the body by eliminating free radicals and protect the body against oxidative injuries (Mukhopadhyay 2000). Research on natural antioxidants have shown positive health effects towards cardioprotection, inflammation, antiinfection, liver protection, anti-diabetic, anti-obesity and neurodegenerative processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei & Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012). All these health benefits are proposed to be attributed to the synergistic antioxidant protective effects of different phytochemicals present in plant materials (de Kok, van Breda & Manson 2008).. 74

92 3.3 Research Aims and Objectives The main aim for this part of the research work was to study the bioactivities of RBE derived from different Sarawak local rice varieties via selected in vitro antioxidant assays. In order to achieve the aforementioned aim, experimental works were designed to fulfil the following objectives: a. Study of antioxidant activity of RBE based on in vitro chemical-based systems. b. Study of antioxidant activity of RBE based on in vitro mammalian cell culture-based system. c. Determination of the optimal and safe dosage of RBE that is appropriate for its maximal antioxidant activity in in vitro mammalian cell culture-based system. d. Assessment of RBE on the induction of endogenous cellular antioxidants in in vitro mammalian cell culture-based system. 3.4 Experimental Design Antioxidant activities of RBE were studied based on two different types of in vitro systems: chemical-based system and cell culture based system Materials and Chemicals In vitro chemical-based systems: 2,2-diphenyl-1-picrylhydrazyl (DPPH) and trolox standard were purchased from Sigma Aldrich. Absolute ethanol (EtOH) was purchased from Fisher Scientific (Malaysia). Tocomin50 (Carotech, Malaysia) standard was a gift in kind given by Prof. Yuen Kah Hay and Dr. Sherlyn Lim from Universiti Sains Malaysia (USM). 75

93 In vitro cell culture-based system: H9c2(2-1) Rattus norvegicus rat s cardiomyocytes (ATCC CRL-1446 TM ) was purchased from ATCC. CellTiter 96 Aqueous Non-Radioactive Cell Proliferation assay kit was purchased from Promega, Dulbecco s Modified Eagle Medium (DMEM) and phosphate buffer saline (PBS) were purchased from Gibco. Fetal Bovine Serum (FBS), Penicillin-Streptomycin (10,000 units), 0.25% Trypsin-EDTA, trypan blue, and dimethyl sulfoxide (DMSO) were purchased from Sigma Aldrich. Hydrogen peroxide (30% v/v) was purchased from Bendosen (Malaysia). Absolute ethanol (EtOH) was purchased from Fisher Scientific (Malaysia). AxyPrep multisource total RNA miniprep kit was purchased from Axygen. QuantiFast SYBR Green RT-PCR kit was purchased from Qiagen. Superoxide dismutase assay kit and catalase assay kit were purchased from Cayman Chemical. Glutathione peroxidase activity colorimetric assay kit was purchased from Biovision Test Samples Nine different types of RBE prepared in Chapter 2 were all used to assess their respective antioxidant activities via in vitro chemical-based systems. Tocomin50 was used as a positive control for comparison. After the assessment of antioxidant activities of different RBE via in vitro chemical-based systems, rice bran extract that gave the high antioxidant activity along with rice bran extract of commercial rice, MR219 were selected to further assess their respective antioxidant activities via in vitro cell culture-based system Methodology Two In vitro chemical-based systems (DPPH free radical scavenging assay and Trolox Equivalent Antioxidant Capacity (TEAC) assay) and in vitro cell culture-based system were used to determine the antioxidant activities of different RBE. As depicted in Figure 3-4, it showed the schematic representation of experimental approaches used to determine the antioxidant activities of RBE. 76

94 In Vitro Chemical-Based System In Vitro Cell Culture-Based System Rice Bran Extracts Hydrogen Peroxide Antioxidant Capacity Assays Rice Bran Extracts H9c2(2-1) Cardiomyocyte DPPH Free Radical Scavenging Assay Tocomin50 (Positive Control) Trolox Equivalent Antioxidant Capacity (TEAC) Assay Trolox (Positive Control) Cell Viability Assay Cell viability assay via: Microscopic Observation Trypan Blue Exclusion MTS Assay Cellular Antioxidant Activity Assay Activity Assay on: SOD enzyme CAT enzyme GPx enzyme Gene Expression Study of Cellular Antioxidants Gene expression assessment via qpcr on: SOD enzyme CAT enzyme GPx enzyme Figure 3-4: Overview of experimental approaches applied for bioactivity studies of antioxidants from rice bran extracts 77

95 In Vitro Chemical-Based System DPPH Free Radical Scavenging Assay DPPH free radical scavenging assay was performed as per method of Herald, Gadgil and Tilley (2012) with minor modifications. Briefly, 0.2mM DPPH free radical solution was prepared in absolute ethanol. Different serially diluted (2x) concentrations (156.25µg/mL to 5000µg/mL) of RBE and positive control, Tocomin50 were serially diluted and 50µL of each serially diluted sample were aliquoted into 96 wells microplate. Absolute ethanol was used as negative control and reagent blank. A total volume of 50µL of 0.2mM DPPH free radical solution was then added to each well and the plate was allowed to incubate for 30 minutes and kept away from light. The absorbance was later measured at 517nm via microplate reader (Synergy HT, Biotek). DPPH free radical scavenging capacity of different RBE was determined via the following equation (Equation 6): Equation 6: DPPH free radical scavenging capacity = (A 0 A) A 0 x 100 % *where A 0 = absorbance of control sample; A = absorbance of test sample Trolox Equivalent Antioxidant Capacity (TEAC) Assay TEAC assay was performed based on the DPPH-scavenging capacities of different RBE. The assay method was performed as per method of Pisoschi, Cheregi and Danet (2009) with minor modifications. Briefly, different concentrations of trolox were prepared (n=3) to establish a reference standard curve. A total volume of 50µL of serially diluted (2x) concentrations (156.25µg/mL to 5000µg/mL) of RBE (n=3) were aliquoted into 96 wells microplate and was then followed by the addition of 50µL of the prepared DPPH free radical solution (0.2mM). The plate was later incubated in the dark for 30 minutes before the absorbance was measured at 517nm via microplate reader (Synergy HT, Biotek). Equation 6 was used to determine the DPPH free radical 78

96 scavenging capacity of different RBE and results were expressed in unit of nmol of Trolox equivalent/100 g dry extract Statistical Analysis All results data were presented as mean and standard deviation of three consecutive experimental repetitions on similar sample. Statistical tool, GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data via one-way analysis of variance (ANOVA) and Student s t-test. Statistical significance and confidence level of data were set at P

97 In Vitro Cell Culture-Based System Cell Culture and Growth Curve Study H9c2(2-1) Rattus norvegicus rat s cardiomyocyte was used as the mammalian cell culture model for in vitro cell culture-based antioxidant assay. The cells were cultivated in DMEM media supplemented with 10% fetal bovine serum (FBS) and 100 units/ml of penicillin-streptomycin (final concentration). Cells were incubated at 37 C and 5% CO 2. Sub-cultivation of cells was performed when cells achieved 70% - 80% confluence. Cells in passage number were used in all experiments and appropriate concentration of cells was seeded for different experiments accordingly. Growth curve study: Growth curve study of H9c2(2-1) cardiomyocytes was performed as per method of Iloki Assanga et al. (2013) with slight modifications. Briefly, cells were initially plated on 25cm 2 cell culture flask at a density of 6000 cells (initial cell density). The cells were allowed to incubate for 24 hours at 37, 5% CO 2. The cells were allowed to incubate over a period of 8 days and cell counting was performed at one day interval using the trypan blue dye exclusion method on a haemocytometer. Microscope cell images were taken manually through an inverted microscope system (Nikon Eclipse Ti-S). The growth curve of the cells was presented in the form of non-linear fitting of polynomial curve. The doubling time (D T ) of H9c2(2-1) cardiomyoctes was determined via the following equation (Equation 7): Equation 7: DT= T x ln (2) ln (Xe/Xb) In which: T - Incubation time (in any units). Xb - Cell number at the initial of the incubation time. Xe - Cell number at the end of the incubation time. 80

98 Cell cytotoxicity Assay The cell toxicities of selected RBE and hydrogen peroxide were studied by using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2h-tetrazolium (MTS)-based assay kit (CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). Appropriate concentrations of cells were plated onto 96 wells microplate and pre-incubated for 24 hours before the cells were further treated with RBE and hydrogen peroxide. A. Cell cytotoxicity study of selected RBE Different concentrations (6.25µg/mL to 500µg/mL) of selected RBE were prepared by diluting the prepared stocks in two-fold dilutions with serum-free DMEM. The range of concentration was prepared to identify the inhibition concentration (IC 50 ) of RBE. The final concentration of ethanol content in each sample was kept below 1% (v/v) and ethanol (1% v/v) was used as negative control in the assay. The treated cells were incubated for 24, 48 and 72 hours respectively. Cell viability was determined via the MTS assay kit (CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). Briefly, after the incubation period, media were discarded and cells were washed and replaced with fresh serum-free DMEM. MTS reagent was then added to each well and the microplate was incubated for 4 hours before the absorbance was measured at 490nm through a microplate reader (Synergy HT, Biotek). IC 50 of rice bran extracts were determined from the cell viability curves. B. Cell cytotoxicity study of hydrogen peroxide (H 2 O 2 ) Different concentrations (15.625µM to 1000µM) of H 2 O 2 were prepared by diluting the prepared stock in two-fold dilutions with PBS buffer. The range of concentration was prepared to identify the inhibition concentration (IC 50 ) of H 2 O 2. Standardisation of H 2 O 2 was performed spectrophotometrically by measuring the absorbance of prepared samples at 240nm and a molar extinction coefficient of 43.6M -1 cm -1 was used to calculate the actual concentration of 81

99 hydrogen peroxide prepared. PBS buffer was used as negative control in the assay. H 2 O 2 treated cells were incubated for 24 hours and cell viability was determined via the MTS assay kit (CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). Briefly, after the incubation period, media were discarded and cells were washed and replaced with fresh serum-free DMEM. MTS reagent was then added to each well and the microplate was incubated for 4 hours before the absorbance was measured at 490nm through a microplate reader (Synergy HT, Biotek). Inhibition (IC 50 ) of hydrogen peroxide was determined from the cell viability curve Induction of Oxidative Stress H9c2(2-1) cells were seeded and incubated at 37 C and 5% CO 2 for 24 hours before they were treated with RBE. The cells were treated with specific concentrations of the selected RBE, and were incubated for 24 hours. After 24 hours incubation, growth media were replaced and oxidative stress was induced by treating the cells with different concentrations (62.5µM to 1000µM) of hydrogen peroxide. The treated cells were incubated for another 24 hours before the cell viability was determined via MTS assay kit (CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). MTS reagent was then added to each well and the microplate was incubated for 4 hours before the absorbance was measured at 490nm through a microplate reader (Synergy HT, Biotek) Endogenous Antioxidant Enzyme Activity Studies Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxide (GPx) were the targeted endogenous antioxidant enzymes in this experiment. The activities of targeted endogenous antioxidant enzymes were studied by using commercially available ELISA kits. Samples were prepared as per protocols stated in the kits manual. Briefly, cells were detached by using rubber 82

100 policeman and collected in ice cold PBS buffer (ph 7.4). Cell lysis was performed via physical disruption by sonicating the cells in ultrasonic water bath for 2 minutes. The superoxide dismutase activity was examined via Superoxide Dismutase Assay kit (Cayman Chemical); catalase activity was examined via Catalase Assay Kit (Cayman Chemical); glutathione peroxidase activity was examined via Glutathione Peroxidase Activity Colorimetric Assay Kit (Biovision Incorporated). The absorbances of reaction mixtures were measured at respective wavelength defined for each assay kit Endogenous Antioxidant Enzyme Gene Expression Studies Superoxide dismutase 2 (SOD2), catalase (CAT) and glutathione peroxide 1 (GPx1) were the targeted endogenous antioxidant enzymes in this experiment. The effects of RBE and hydrogen peroxide inductions on the gene expression of targeted endogenous antioxidant enzymes were assessed through quantitative Real Time Polymerase Chain Reaction (qrt-pcr) approach. Cell cultivation: H9c2(2-1) cells were seeded and incubated at 37 C and 5% CO 2 on 6-wells plates for 24 hours before they were treated with RBE and hydrogen peroxide respectively. Total RNA extraction: Extraction of RNA from H9c2(2-1) cardiomyocytes was performed through AxyPrep Multisource Total RNA Miniprep kit (Axygen Biosciences). Prior to RNA extraction, supernatants were discarded and cells were washed twice with ice cold PBS buffer (ph 7.4). Then, the extraction of RNA from cells was performed as per method described in the kit protocol. RNase-free water was used to elute the purified total RNA. RNA samples were kept on ice when they are in used or stored in -80 until further use. Nucleic acid quantitation and qualification: The concentration and purity of extracted RNA were assessed spectrophotometrically through a microplate reader (Synergy HT, Biotek) by using Take3 Micro-Volume Plates. The pre-set settings for nucleic acid quantitation and qualification were selected, and the 83

101 absorbances of samples were measured at the wavelengths of 230nm, 260nm, 280nm, and 320nm (background check) respectively. RNase-free water was used as blank reagent. The absorbance ratios of 260/280 and 260/230 were used to determine the purity of RNA samples. The acceptable absorbance ratio for 260/280 as pure RNA is 2.0 while the acceptable range of absorbance ratio for 260/230 as pure RNA is between 2.0 to 2.2. Relative quantitation of gene expression: Gene expression studies of targeted endogenous cellular antioxidant enzymes were performed through qrt-pcr approach. A one-step qrt-pcr kit (Quantifast SYBR Green RT- PCR kit, Qiagen) was used to quantify the RNA targets. A total 20ng of RNA sample (final amount per reaction tube = 2ng) was mixed with reagent kits and oligonucleotide primers sets as per manufacturer s instructions. The sequences of oligonucleotide primers used in this experiment are as follow (Table 3-1): Table 3-1: Oligonucleotide primer sequences Primer Set Superoxide Dismutase 2 (SOD2) Catalase (CAT) Glutathione Peroxidase 1 (GPx1) Glyceraldehyde 3-phosphate dehydrogenase (GADPH) Primer Sequence Forward Primer: 5'-GTGTCTGTGGGAGTCCAAGG-3' Reverse Primer: 5'-TGATTAGAGCAGGCGGCAAT-3' Forward Primer: 5'-CGCCTGTGTGAGAACATTGC-3' Reverse Primer: 5'-TAGTCAGGGTGGACGTCAGT-3' Forward Primer: 5'- CTCGGTTTCCCGTGCAATCA -3' Reverse Primer: 5'-ACCGGGTCGGACATACTTGA-3' Forward Primer: 5 - CAG GGC TGC CTT CTC TTG TG -3 Reverse Primer: 5 - CTT GCC GTG GGT AGA GTC AT -3 84

102 Amplification reactions of RNA targets were performed via Rotor-Gene Q 2plex HRM Platform (Qiagen). Settings for reaction cycles were configured as per method specified in the kit manual (Table 3-2). Table 3-2: qrt-pcr Reaction Cycle Condition (Qiagen 2011) Step Time Temperature Reverse Transcription 10 minutes 50 PCR Initial Activation Step 5 minutes 95 Two-Step Cycling 40 cycles Denaturation 10 seconds 95 Annealing/Extension 30 seconds 60 Melt Curve 90 seconds Ramp from 72 to 95 5 seconds 95 All amplification reactions were normalized to mrna expression of housekeeping gene, Glyceraldehyde 3-phosphate dehydrogenase (GADPH) for Rattus norvegicus. All samples were prepared in triplicates and relative gene expression levels of RNA targets were normalized to that of negative control cells Statistical Analysis All results data were presented as mean and standard deviation of three consecutive experimental repetitions on similar sample. Statistical tool, GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data via one-way analysis of variance (ANOVA) and Student s t test. Statistical significance and confidence level of data were set at P

103 3.4.4 Results and Discussions In Vitro Chemical-Based System DPPH Free Radical Scavenging Assay The DPPH free radical scavenging assay was used to assess the antioxidant capacities of different RBE. The inhibitory concentrations (IC 50 ) of RBE represent the concentration of extract required to scavenge the initial concentration of DPPH free radicals by 50%. The lower the IC 50 value of extract, the stronger the efficacy of extract in DPPH free radical scavenging activity. Table 3-3: Inhibitory concentration (IC 50 ) of different RBE for DPPH free radical scavenging assay. Values represents mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation for the following data is presented in Figure 5-5 (Appendix section). Sample Tocomin50 (Positive control) Bajong LN Bali Pandan Bajong Wangi Mamut MR219 Bubuk Biris Bario Inhibitory Concentration (IC 50 ) for DPPH Free Radical Scavenging Assay (µg/ml) ± 1.29 a ± b ± 4.36 b ± c ± d ± de ± 9.14 de ± def ± def ± 25.9 g 86

104 Table 3-3 shows the (IC 50 ) of different RBE for DPPH free radicals scavenging assay. Based on the obtained data, the IC 50 values of different RBE were significantly different from one another (P 0.05). The values were in the range of µg/mL to µg/mL respectively. The RBE of Bajong LN showed the lowest IC 50 value (188.46µg/mL) among all the RBE while the highest IC 50 value was determined in the RBE of Bario ( µg/mL). DPPH free radical, also known as 2,2-diphenylpicrylhydrazyl assay is one of the commonly used chemical assays for antioxidant activity (Pyrzynska & Pekal 2013). DPPH is a stable free radical that lacks of one hydrogen atom. It can be neutralized via transfer of electron or hydrogen atom and form corresponding hydrazine, DPPH2. When the DPPH free radical is neutralized to form DPPH2, the initial colour of the chemical changes from purple to yellow (Sharma & Bhat 2009). As a result of the nature of the chemical, it is suitable for antioxidant activity studies. The DPPH free radical scavenging activities of different concentrations of RBE were depicted in Figure 3-5. Based on the results, the DPPH free radical scavenging activities of RBE were proportional to their respective concentrations. In this experiment, the effects of different concentrations of various RBE on DPPH free radical scavenging were studied. A significant decrease in DPPH concentration was determined with higher concentration of RBE used in the assay. In addition, the DPPH free radical scavenging activities of RBE also varied among different RBE. Such discrepancies were attributed to the differences in the contents of bioactive compounds among different RBE. The efficacies of different RBE in DPPH free radical scavenging were expressed by identifying the concentration of test sample required to neutralize 50% of the initial concentration of DPPH, also known as the inhibition concentration (IC 50 ). A low IC 50 value indicates a relatively strong antioxidant activity of the extract samples and vice versa (Sirikul, Moongngarm & Khaengkhan 2009). 87

105 DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) 100% Wangi Mamut 100% Bubuk 100% Bario 80% 80% 80% 60% 40% 20% 1.12 Wangi Mamut IC50 60% 40% 20% 1.30 Bubuk IC50 60% 40% 20% 2.28 Bario IC50 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) Biris Bajong LN Pandan 100% 100% 100% 80% 80% 80% 60% 40% 1.53 Biris IC50 60% 40% 0.19 Bajong LN IC50 60% 40% 0.75 Pandan IC50 20% 20% 20% 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) *[Figure continues on to next page] 88

106 DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) DPPH Radical Scavenging Activity (%) MR219 Bali Bajong 100% 100% 100% 80% 80% 80% 60% 40% 20% 1.13 MR219 IC50 60% 40% 20% 0.22 Bali IC50 60% 40% 20% 1.06 Bajong IC50 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) 0% Concentration (x10 3 µg/ml) Figure 3-5: DPPH free radical scavenging activities of different concentrations of different crude RBE. The data represented mean ± standard deviation of three repetitions (n=3). 89

107 The lowest IC 50 value was detected from RBE of pigmented rice variety, Bajong LN (188.46µg/mL). The obtained data was comparable to some of reports from the literature, IC 50 values from 15 different pigmented rice varieties were in the range of 117µg/mL and 121µg/mL (Goufo & Trindade 2014). Rao et al. (2010) conducted a similar study on some Indian medicinal rice varieties. Contrarily, they reported IC 50 values in the range of to 87.72µg/mL which is lower than the results obtained in this study. In addition, another study on defatted rice bran of Thai rice varieties also reported a relatively low range of IC 50 values (9.19 to 19.73µg/mL) (Sirikul, Moongngarm & Khaengkhan 2009). The relatively low IC 50 values reported from both Indian medicinal and Thai rice varieties indicate stronger antioxidant activities and higher efficacies of the extracts in DPPH free radical scavenging as compared to the extracts of Sarawak local rice varieties in the present study. It was suggested that variation in plant genotypes could be one of the factors causing the difference in IC 50 values between the presently obtained data and those reported from the literature. Other factors such as environmental factor (Britz et al. 2007) and extraction method (Chen & Bergman 2005) also significantly influence the total content of natural antioxidants present in the extracts. Therefore, direct comparison cannot be made unless experimental protocols are standardized among all samples. Nevertheless, the present data have demonstrated the free radical scavenging capabilities of RBE derived from different Sarawak rice varieties. This was observed through successive dose-dependent free radical scavenging effects of RBE in comparison to negative control. Regression and correlation analyses of 1/DPPH (IC 50 ) with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE were represented in Table 3-4. Strong positive (R 0.8) and significant (P 0.05) correlations were observed in DPPH free radical scavenging activity against total phenolic content, total flavonoid content, and total γ-oryzanol content respectively. Such observations suggest the contributions of phenolic compounds, flavonoids, and γ-oryzanol from RBE in DPPH free radical scavenging; indicating the significance of phenolic compounds, flavonoids, and γ-oryzanol as the potential 90

108 sources of natural antioxidants contributing to the efficacy of total antioxidant activities in RBE. Among the three, the highest correlation value of 1/DPPH (IC 50 ) was observed with the total phenolic content in RBE (R = ), followed by γ- oryzanol (R = ) and flavonoids (R = ) respectively. It was discovered that sample s total phenolic and flavonoid contents have more profound effects on DPPH free radical scavenging (Goufo & Trindade 2014). Rao et al. (2010) also reported the significant contribution of phenolic compounds as the potential source of natural antioxidants responsible for the total antioxidant activities in RBE. Poor correlations between 1/DPPH (IC 50 ) and vitamin E derivatives (tocotrienols and tocopherol) were reported, with R values ranged from to The poor correlations were due to the lipophilic nature of vitamin E derivatives (Cederberg, Siman & Eriksson 2001). DPPH assay was conducted with aqueous alcohol (absolute ethanol) which is favourable for hydrophilic antioxidants (Kedare & Singh 2011). In the absence of solubilizing agent, factors such as solvent properties and nature of targeted compounds have been shown to hinder the reactions between antioxidants and DPPH radicals (Yu 2008). Several reports from literature have highlighted on the radicalscavenging activity of γ-oryzanol. The compound is known to exhibit higher activity in DPPH free radical scavenging as compared to different derivatives of vitamin E (Chotimarkorn & Silalai 2008). As of different derivatives of vitamin E, correlation analysis between 1/DPPH (IC 50 ) and total vitamin E content in RBE reported a statistically significant (P 0.05) R value of Among the different targeted vitamin E derivatives, the highest R value was observed in γ- tocotrienol content (R = ), then followed by δ-tocotrienol (R = ), α- tocopherol (R = ), and α-tocotrienol (R = ). Such observations suggest that γ-tocotrienol as the potential vitamin E derivative that contribute more to the overall antioxidant activity of RBE while the remaining vitamin E derivatives reported a weak correlation with DPPH free radical scavenging activity. 91

109 Table 3-4: Regression and correlation analyses of 1/DPPH (IC 50 ) with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α- tocopherol from RBE. Correlation graphs for the following data were depicted in Figure 5-6 (Appendix section). 1/DPPH (IC 50 ) vs Total Phenolic Content 1/DPPH (IC 50 ) vs Total Flavonoid Content 1/DPPH (IC 50 ) vs Total Anthocyanin Content 1/DPPH (IC 50 ) vs Total γ- Oryzanol Content R value R P value Slope /DPPH (IC 50 ) vs Total Vitamin E Content 1/DPPH (IC 50 ) vs δ- Tocotrienol Content 1/DPPH (IC 50 ) vs γ- Tocotrienol Content 1/DPPH (IC 50 ) vs α- Tocotrienol Content R value R P value Slope /DPPH (IC 50 ) vs Tocopherol (α-tocopherol) Content R value R P value Slope Remarks: Number of observations in all experiments was 3 (n=3). Positive correlation (R value) represents a positive fit while negative R value represents a negative fit. P value less than 0.05 (P 0.05) represents statistically significant between two test variables (paired T-test). The R 2 value represents the coefficient of determination for a fitted regression line. 92

110 Trolox Equivalent Antioxidant Capacity (TEAC) Assay Trolox equivalent antioxidant capacity (TEAC) assay was conducted based on the DPPH free radical scavenging assay. Trolox (6-hydroxy-2, 5, 7, 8- tetramethylchroman-2-carboxylic acid), a water soluble analogue of vitamin E (Sagach et al. 2002) was used as the positive control in this assay. The results were expressed in trolox equivalent (nmol). Table 3-5 shows trolox equivalent antioxidant capacities (TEAC) of different RBE for TEAC assay. High TEAC value of RBE is proportional to its antioxidant capacity, indicating its efficacy in free radical scavenging. Based on the obtained data, the TEAC values of different RBE were significantly different from one another (P 0.05). The values were in the range of 12.79nmol/100g to 61.49nmol/100g respectively. The RBE of Bajong LN showed the highest TEAC value (61.49nmol/100g) among all the RBE while the lowest TEAC value was determined in the RBE of Bario (12.79nmol/100g). The DPPH free radical was used as the radical source for TEAC assay. The neutralization of the radical occurs through electron or hydrogen transfer in which it causes decolouration of DPPH solution from purple colour to yellow colour. The antioxidant efficacy of test sample is proportional to the degree of conversion of DPPH to corresponding hydrazine, DPPH2 which is yellow in colour (Sharma & Bhat 2009). In this study, significant discrepancies in TEAC values were observed among different RBE. Factors such as plant genotypes, environmental factors (Britz et al. 2007) and extraction method (Chen & Bergman 2005) of bioactive compounds from samples were known to collectively affect the total content of natural antioxidants and the total antioxidant activities of the extracts. 93

111 Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values expressed represent mean ± standard deviation of 3 concecutive repetitions (n=3). Different letters within the same column denote significant differences at P 0.05 (Tukey s Test). Graphical representation of the data was depicted in Figure 5-7 (Appendix section) Sample Bajong LN Bali Pandan Bajong Wangi Mamut Bubuk Biris MR219 Bario Trolox Equivalent Antioxidant Capacity (TEAC) (nmol/100g) ± 1.13 a ± 0.46 b ± 0.78 b ± 1.14 c ± 2.26 cd ± 0.67 cd ± 1.29 e ± 0.29 ef ± 0.25 ef Table 3-6 shows the regression and correlation analyses of TEAC value with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE. Based on the obtained results, strong positive (R 0.8) and significant (P 0.05) correlations were observed in TEAC value against total phenolic content, total flavonoid content, and total γ-oryzanol content respectively. Such observations suggest the contributions of phenolic compounds, flavonoids, and γ-oryzanol from RBE as potential sources natural antioxidants that involve in DPPH free radical scavenging. All these potential sources of natural antioxidants collectively contributed to the efficacy of total antioxidant activities in RBE. 94

112 Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant capacity (TEAC) of RBE with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ- tocotrienol, α-tocotrienol, and α-tocopherol. Correlation graphs were depicted in Figure 5-8 (Appendix section) TEAC vs Total Phenolic Content TEAC vs Total Flavonoid Content TEAC vs Total Anthocyanin Content TEAC vs Total γ-oryzanol Content R value R P value Slope TEAC vs Total Vitamin E Content TEAC vs δ- Tocotrienol Content TEAC vs γ- Tocotrienol Content TEAC vs α- Tocotrienol Content R value R P value Slope TEAC vs Tocopherol (α- Tocopherol) Content R value R P value Slope Remarks: Number of observations in all experiments was 3 (n=3). Positive correlation (R value) represents a positive fit while negative R value represents a negative fit. P value less than 0.05 (P 0.05) represents statistically significant between two test variables (paired T-test). The R 2 value represents the coefficient of determination for a fitted regression line. 95

113 Total γ-oryzanol content in RBE reported the highest correlation value with TEAC value (R= ), followed by total flavonoid content (R= ), and total phenolic content (R = ). Goufo and Trindade (2014) reported the significant effects of phenolic and flavonoid compounds on DPPH free radical scavenging. Rao et al. (2010) also reported the similar significant contribution of phenolic compounds as the potential source of natural antioxidants responsible for the total antioxidant activities in RBE. All the reports were concurrent with the presently obtained data and hence indicating the significant contribution of phenolic compounds to the overall antioxidant activity of RBE. In addition, it was also reported that the antioxidant efficacy of phenolic compounds outrun those of anthocyanins (Chen et al. 2012; Min, McClung & Chen 2011) and α-tocopherol (Goffman & Bergman 2004). As of different derivatives of vitamin E, poor correlations between TEAC and vitamin E derivatives (tocotrienols and tocopherol) were reported, with R values ranged from to The poor correlations were due to the lipophilic nature of vitamin E derivatives (Cederberg, Siman & Eriksson 2001). TEAC assay was conducted with aqueous alcohol (absolute ethanol) which is favourable for hydrophilic antioxidants (Kedare & Singh 2011). DPPH was used as the radical source for TEAC assay. In the absence of solubilizing agent, factors such as solvent properties and nature of targeted compounds are known to affect the reactions between antioxidants and the radical source (Yu 2008). It has been reported that the antioxidant activity of γ-oryzanol in rice is approximately 10 times stronger than those of vitamin E, particularly α- tocopherol (Xu, Hua & Godber 2001). The statement is in agreement with the presently obtained data. The TEAC value showed a stronger correlation value to γ-oryzanol content (R = ) in RBE than that of α-tocopherol (R = ). When compared to α-tocopherol and the remaining vitamin E derivatives, the presently obtained data suggest the significant role of γ- oryzanol as the potential source of natural antioxidant that contribute to the total antioxidant activity of RBE. The abilities to quench radicals and prevent lipid peroxidation (Juliano et al. 2005), to enhance endogenous cellular antioxidant 96

114 enzymes in high fat-induced oxidative stress (Jin Son et al. 2010), and to improve the radical scavenging activities of glutathione reductase (Jin Son et al. 2010) are among the antioxidant properties of γ-oryzanol reported from the literature. 97

115 In Vitro Cell Culture-Based System Morphology and Growth of H9c2(2-1) Cardiomyocytes Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an inverted light microscope (Magnification: 200x) Morphological characteristics of healthy H9c2(2-1) cardiomyocytes were depicted in Figure 3-6. Under normal and healthy condition, H9c2(2-1) cardiomyocytes have thin and elongated morphologies. In addition, the cells appeared to be multinucleated (having multiple nuclei in a cell). The cells were attached cells and grow in monolayer. Figure 3-7 shows the growth curve of H9c2(2-1) cardiomyocytes over a growth period of 8 days. Three different stages of growth curve were observed. The cells were in the lag phase within the first 24 hours of incubation period. As the cells were still adapting to the new environment in the first 24 hours, cell division was minimal and thus there was no apparent increment in cell number (Sigma-Aldrich 2010). At day 2 to day 5, a rapid increment in cell population was observed; indicating the exponential phase of cell growth. At this growth 98

116 Cell Number (x10 3 Cells/cm 2 ) stage, cells were at their optimal condition and divide at a rapid rate until the maximum cell number is achieved (Sigma-Aldrich 2010). Beyond day 5, the cells began to enter the stationary phase in which cell population begin to confluent. Cell growth was compromised by the depletion of essential nutrient and built up of toxic wastes. Based on the calculation, the doubling time of H9c2(2-1) cardiomyocytes was between day 2 to day 3 (~2.73 days). Growth Curve of H9c2(2-1) 60 (b) (c) (d) (a) Incubation Period (Day) Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation period. Each alphabet represents different growth phases of the cells. (a): Log phase; (b): Exponential phase; (c): Stationary phase; (d): Doubling time (~2.73 days) The growth curve of H9c2(2-1) cardiomyocytes was depicted in Figure 3-8 shows the microscope (40x magnification) images of H9c2(2-1) cells over a growth period of 8 days. There was no apparent growth in cell population in the first 48 hours of incubation period indicating the lag phase of H9c2(2-1) cell growth. After 48 hours (2 days) of growth period, H9c2(2-1) cells began to proliferate actively. A significant growth in cell population was observed in between Day 2 and Day 6. At Day 6, the cell population achieved ~90 % confluence and achieved 100% confluence at Day 7 and Day 8. 99

117 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Day 8 Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at different time points (1 st to 8 th day). 100

118 Cell Cytotoxicity Assay (RBE) (a) (b) Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative control) and (b) H9c2(2-1) cells induced with lethal dosage of Bajong LN extract (500 µg/ml). Red oval inset in (b) showed apoptotic H9c2(2-1) cells. *Magnification: 40x 101

119 Based on the screening outcomes of total antioxidant activities from different RBE, the highest antioxidant activity in free radical scavenging was detected in Bajong LN rice bran extract. The Bajong LN extract was then selected for in vitro cell culture-based system to further assess the antioxidant capacity of the extract. RBE of commercial rice variety, MR219 was selected for comparative study. Figure 3-9 shows the cell images of normal cells of H9c2(2-1) cardiomyocytes (negative control) and cells that were induced with lethal dose (500µg/mL) of Bajong LN RBE. In this experiment, it was discovered that 1% final concentration of ethanol in media did not induce cell death [data not shown]. Therefore, all concentrations of RBE were adjusted to less than 1% while negative control cells were treated with 1% final concentration of ethanol in media. Based on the cell image in Figure 3-9(a), the negative control H9c2(2-1) cardiomyocytes treated with 1% ethanol were healthy and appeared to have multiple nuclei, thin and elongated morphologies. Contrarily, cells treated with 500 µg/ml of Bajong LN RBE showed signs of cell apoptosis, as shown in Figure 3-9(b). Disintegration of cell membrane and nucleus were observed in the culture with cellular debris spread across the surface area of the tissue culture flask. Such observation indicates dosage of Bajong LN RBE at 500µg/mL is cytotoxic to H9c2(2-1) cells with cell viability significantly dropped to only 18.58% (P < 0.01). H9c2(2-1) cardiomyocytes were induced with different concentrations of RBE to identify their respective safe dose range. Cell toxicities of selected RBE were examined via 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2- (4-sulfophenyl)-2H-tetrazolium (MTS)-based assay kit. The assay measures the metabolic rate of mitochondrial activities through conversion of MTS to formazan by viable cells (Wang, Henning & Heber 2010). Figure 3-10 shows the cell viability curves of H9c2(2-1) cells treated with different concentrations of RBE over 24, 48 and 72 hours respectively. Data were presented in terms of relative cell viability versus log of extract dosage. Based on the results, dosedependent cytotoxicity effects were observed in cells treated with RBE of Bajong LN and MR219 respectively. 102

120 Cell Viability (%) Cell Viability (%) (A) Bajong LN 120% 100% 80% Bajong LN Day 1 Bajong LN Day 2 Bajong LN Day 3 60% 40% 20% 0% Log [Bajong LN], µg/ml (B) 140% 120% 100% MR219 MR219 (Day 1) MR219 (Day 2) MR219 (Day 3) 80% 60% 40% 20% 0% Log [MR219], µg/ml Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with different concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN and (B) MR219 RBE over 24, 48 and 72 hours of incubation time respectively. Best fit curves were drawn by using excel for visual purposes. 103

121 The concentrations of extracts used for the induction were in the range of 6.25µg/mL to 500µg/mL (2-fold). For RBE of Bajong LN, extract concentrations beyond 75µg/mL induced critical cell death with cell viabilities dropped below 32% (Table 3-7). Cell viabilities dropped below 20% after 48 hours and 72 hours of incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated with Bajong LN extract in the concentration ranges of 6.25µg/mL to 50µg/mL were beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore, it gave an indication that the safe working concentration range of Bajong LN extract were in the approximate range of 6.25µg/mL to 50µg/mL. Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations of Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control. Log (Dose) Dose (µg/ml) Day 1 (24 hours) Bajong LN-Cell Viability (%) Day 2 (48 hours) Day 3 (72 hours) ± ± 1.45* ± 2.70* ± 5.95* ± 2.38* ± ± 5.79* ± ± ± 5.86* ± ± ± 4.83* 8.81 ± 0.00* ± 1.12* ± 0.74* ± 0.48* ± 1.29* ± 1.61* ± 0.66* ± 1.09* ± 0.61* ± 0.94* ± 0.00* 104

122 Table 3-8 shows the inhibitory concentration (IC 50 ) of Bajong LN RBE on H9c2(2-1) cells. The IC 50 value referred to the concentration of Bajong LN RBE that will kill half (50%) of the original population of the cells. Based on the obtained results, the IC 50 values of Bajong LN RBE were in the range of 61.67µg/mL to 63.10µg/mL over 24, 48 and 72 hours of incubation time respectively. Table 3-8: Inhibitory concentration (IC 50 ) of Bajong LN RBE over 24, 48 and 72 hours of incubation time. The IC 50 values were determined from respective cell viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3). Graphical representations of data were depicted in Figure 5-9 (Appendix section). Bajong LN (IC 50 ) (µg/ml) Dose (µg/ml) Log (Dose) Day 1 (24 hours) Day 2 (48 hours) Day 3 (72 hours) ± ± ± ± ± ± 0.04 For RBE of MR219, extract concentrations beyond 250 g/ml induced critical cell death with cell viabilities dropped below 13% (Table 3-9). Cell viabilities further dropped below 12% with 500µg/mL after 24, 48 and 72 hours of incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated with MR219 extract in the concentration ranges of 6.25µg/mL to 75µg/mL were beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore, it gave an indication that the safe working concentration ranges of MR219 extract were in the range of 6.25µg/mL to 75µg/mL. 105

123 Table 3-9: Cell viability of H9c2(2-1) after inductions with different concentrations of MR219 RBE for 24, 48 and 72 hours respectively. Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control. Log (Dose) Dose (µg/ml) Day 1 (24 hours) MR219-Cell Viability (%) Day 2 (48 hours) Day 3 (72 hours) ± ± ± ± ± ± 5.63* ± ± ± 1.61* ± 1.42* ± ± 3.65* ± 3.68* ± 1.27* ± 2.64* ± 3.21* ± 2.38* ± 3.21* ± 0.61* 8.18 ± 0.55* ± 1.12* ± 1.13* 6.30 ± 1.09* ± 1.86* 106

124 Table 3-10 shows the inhibitory concentration (IC 50 ) of MR219 RBE on H9c2(2-1) cells. Based on the obtained results, the IC 50 values of MR219 RBE were in the range of 95.44µg/mL to µg/mL over 24, 48 and 72 hours of incubation time respectively. Table 3-10: Inhibitory concentration (IC 50 ) of MR219 RBE over 24, 48 and 72 hours of incubation time. The IC 50 values were determined from respective cell viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3). Graphical representations of data were depicted in Figure 5-10 (Appendix section). MR219 (IC 50 ) (µg/ml) Dose (µg/ml) Log (Dose) Day 1 (24 hours) Day 2 (48 hours) Day 3 (72 hours) ± ± ± ± ± ± 0.02 The present study showed the dose-dependent cytotoxic effects of Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes. In general, cell viabilities dropped below 20% when high doses (>250µg/mL) of RBE were used for induction. Contrarily, positive time-dependent induction effects were observed in cells treated with safe dose range of extracts (Bajong LN: 6.25 to 50µg/mL; MR219: 6.25 to 75µg/mL). Induction of cells with RBE within the range of safe dosage showed improvements in cell viabilities with longer incubation period. Possible deductions for such observation could be due to the potential cell proliferation induction effects from the extracts or activation cellular protective response that counteract the stress for adaptation and survival (Fulda et al. 2010). However, further studies are needed to support the statement. 107

125 The IC 50 of Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes were calculated by using GraphPad Prism (GraphPad Software, Inc. USA). The present data revealed that the range of IC 50 values of Bajong LN and MR219 RBE differed from one another. To recap, the IC 50 values of Bajong LN and MR219 were in the range of 61.67µg/mL to 63.10µg/mL and 95.44µg/mL to µg/mL respectively. The discrepancy in IC 50 values between the two RBE could be due to the difference in their respective total antioxidant contents. According to the results obtained from previous study (Chapter 2), RBE of Bajong LN has significantly higher contents of antioxidants (total phenolic, total flavonoid, total γ-oryzanol, and total vitamin E contents) as compared to MR219 extract. Therefore, the extract of Bajong LN may require a lower concentration to achieve similar antioxidant activities as of the MR219 extract. Cytoprotective effects of natural antioxidants derived from plant food have been highlighted in several in vitro cell studies. Cells treated with these exogenous natural antioxidants were protected from oxidative stress mediated cell death (Heo et al. 2008; Romier et al. 2008). However, it was discovered that too much antioxidants did not further improve the overall antioxidant activity of the exogenous natural antioxidants in cytoprotection. In this experiment, viability of H9c2(2-1) cells dropped when high doses of extracts were used and hence suggesting the dose-dependent cytotoxic effects of the extracts. There have been several reports on cell cytotoxicity of polyphenols when high doses of the antioxidants were used. Counter effects can arise from these natural antioxidants at high doses, in which they act as prooxidants that threaten survival and viability of cells (Azam et al. 2004; Decker 1997; Watjen et al. 2005). In addition, it was also reported that antioxidant activities of endogeneous cellular antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), and gluthatione S-transferase can be affected when cells were induced with high concentrations of exogenous antioxidants (Robaszkiewicz, Balcerczyk & Bartosz 2007). This could be arising from the production of radicals by polyphenols through autoxidation and redox cycling processes (Gaspar et al. 1994; Hodnick et al. 1986; Metodiewa et al. 1999). 108

126 Cell viability (%) Cell Cytoxicity Assay (Hydrogen Peroxide) H9c2(2-1) cardiomyocytes were induced with different concentrations of hydrogen peroxide (H 2 O 2 ) to identify the suitable range of working concentrations that do not induce cell death. Figure 3-11 shows the cell viability curve of H9c2(2-1) cells treated with different concentrations of H 2 O 2. Data were presented in terms of relative cell viability versus log of extract dosage. Based on the results, a dose-dependent cytotoxicity effect was observed in cells treated with different concentrations of H 2 O 2. The range of H 2 O 2 concentration between 15.63µM to 250µM did not decrease the viability of H9c2(2-1) cells. Therefore, H 2 O 2 in the range of these concentrations were considered as the safe dose range of H 2 O % 120% H 2 O 2 Induction 100% 80% 60% 40% IC % 0% Log [H 2 O 2 ], µm Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different concentrations of hydrogen peroxide (H 2 O 2 ). The insets showed the inhibition concentration (IC 50 ) of H 2 O 2 on H9c2(2-1) cells determined via GraphPad Prism (GraphPad Software, Inc. USA). Best fit curve were drawn using excel for visual purpose. 109

127 Table 3-11: Cell viability of H9c2(2-1) after inductions with different concentrations of hydrogen peroxide (H 2 O 2 ). Data presented were the mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control. Log (Dose), µm H 2 O 2 Induction on H9c2(2-1) Cardiomyocytes Dose (µm) Cell Viability (%) ± 3.39* ± 5.48* ± 2.07* ± ± 2.49* ± 3.34* ± 1.00* Cell viabilities were more than 87% after treatment with H 2 O 2 within the aforementioned concentration range of H 2 O 2. Contrarily, the cell viability significantly decreased (Table 3-11) after cells were treated with H 2 O 2 at concentration beyond 250µM. Cell viability was less than 5% for H9c2(2-1) cells that were treated with 500µM H 2 O 2. In addition, the inhibitory concentration (IC 50 ) of H 2 O 2 on H9c2(2-1) cells was detected at µM (refer to Table 3-12). Under normal cellular metabolic activities, low concentrations of H 2 O 2 are produced as the by-product that is relatively harmless and rather beneficial to most cells. Cells utilize the H 2 O 2 for processes such as oxidative biosynthesis and host defence. In addition, there are also evidences showing the potential of H 2 O 2 as signalling messenger in cellular signal transduction pathways (Stone & Yang 2006). However, over accumulation of H 2 O 2 in cells can be deleterious. It will lead to the onset of oxidative stress and subsequently induce oxidative stress mediated diseases over time (Nindl et al. 2004). 110

128 Table 3-12: IC 50 of H 2 O 2 on H9c2(2-1) cell. The IC 50 value was determined from respective cell viability curves (Figure 3-11) via GraphPad Prism (GraphPad Software, Inc. USA). Data represents mean ± standard deviation of 3 consecutive repetition (n=3). IC 50 of H 2 O 2 on H9c2(2-1) cell Dose ( µm ) Log (Dose), µm Hydrogen Peroxide (IC 50 ) (µm) ± ± 0.09 Based on the results, H9c2(2-1) cells induced with low concentrations of H 2 O 2 (15.63µM and 31.25µM) showed proliferative effect. The cell viabilities were more than 100% in relation to the negative control. Such observation suggests the potential of low concentration of H 2 O 2 in stimulating cell growth of H9c2(2-1). Low concentration of H 2 O 2 has been reported capable of stimulating cell proliferation (Burdon & Rice-Evans 1989). In addition, the present data were in agreement with the general response trend of proliferating mammalian cells to H 2 O 2 (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995). It was reported that low concentration of H 2 O 2 in range of 3 to 15µM has the potential of inducing growth stimulation while the higher concentration range, 120 to 150µM can cause growth arrest temporarily. Growth arrest may occur permanently when cells were induced with H 2 O 2 in the concentration range between 250µM and 400µM while concentration of H 2 O 2 beyond 1000µM will induce cell necrosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995). Therefore, variation in cellular responses towards different concentrations of H 2 O 2 could be the potential deduction for dose-dependent cytotoxicity effect of H 2 O 2 on H9c2(2-1) cells. However, further studies are needed to support the statement. 111

129 Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide) There have been several reports of H 2 O 2 -mediated cell cytotoxicity and apoptosis in H9c2(2-1) cells after gaining exposure to H 2 O 2 (Cheng et al. 2009; Sheng et al. 2010; Zhang et al. 2011). In this study, the potential of RBE to alleviate oxidative stress in H9c2(2-1) cells mediated by H 2 O 2 was investigated. H9c2(2-1) cells were pre-treated with different concentrations of each Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) extracts respectively before they were induced with various concentrations of H 2 O 2. Negative control cells were pre-treated with media + 1% EtOH before induction with different concentrations of H 2 O 2. The effects of H 2 O 2 -inductions on the cell viability of H9c2(2-1) cardiomyocytes pre-treated with different RBE were shown in Table 3-13 and Figure 3-12 (cell viability curves) respectively. Based on the results, H 2 O 2 -induction of H9c2(2-1) cells pre-treated with different concentrations of RBE revealed their respective dose-dependent cytoprotective effects. Such observations suggest the potential protective effects of RBE against H 2 O 2 -induced cell cytotoxicity. In general, cells pretreated with lower concentrations of RBE (Bajong LN: 25µg/mL; MR219: 50µg/mL) revealed their potential cytoprotective role in alleviating H 2 O 2 -induced cell cytotoxicity. These were observed through right shifts in cell viability curve of H9c2(2-1) cells pre-treated with the low concentration of both extracts (Appendix: Figure 5-11). IC 50 values of H 2 O 2 (inhibitory concentration of H 2 O 2 that decreases cell viability to 50%) have also increased significantly (P 0.05) for cells that were pre-treated with the low concentration of extracts (as compared to negative control cells). As presented in Table 3-14, IC 50 values of H 2 O 2 for H9c2(2-1) cells pre-treated with Bajong LN (25µg/mL) and MR219 (50µg/mL) before H 2 O 2 induction were µM and µM respectively as compared to that of negative control, µM. 112

130 Table 3-13: Cell viability of H9c2(2-1) after inductions with different concentrations of H 2 O 2. Cells were pre-treated with different concentrations of Bajong LN and MR219 RBE before H 2 O 2 - induction. Data represent mean ± standard deviation of three replicates (n=3). * on each column denotes significant differences at P 0.05 as compared to negative control (nontreated cells). Log [H 2 O 2 ], µm H 2 O 2 (µm) Negative Control (media + 1% EtOH) Cell viability (%) Bajong LN (25µg/mL) Bajong LN (50µg/mL) ± ± 4.83* ± 5.55* ± 3.75* ± ± 2.09* ± 1.27* ± 1.61* ± 3.22* ± 2.20* ± 1.77* ± 2.90* ± 2.52* 9.55 ± 2.48* 2.18 ± 0.32* Log [H 2 O 2 ], µm H 2 O 2 (µm) Negative Control (media + 1% EtOH) MR219 (50µg/mL) MR219 (100µg/mL) ± ± ± 8.30* ± 3.75* ± ± 2.96* ± 1.27* ± 0.97* ± 2.88* ± 2.20* ± 3.62* 6.56 ± 4.99* ± 2.52* 4.15 ± 0.32* ± 4.56* 113

131 Figure 3-12: Effects of H 2 O 2 inductions on cell viabilities of H9c2(2-1) cardiomyocytes pre-treated with different concentrations of Bajong LN RBE (25µg/mL and 50µg/mL) and MR219 RBE (50µg/mL and 100µg/mL) 114

132 Table 3-14: Average IC 50 of H 2 O 2 for H9c2(2-1) cells. The IC 50 value was determined from respective cell viability curves (Figure 5-11) via GraphPad Prism (GraphPad Software, Inc. USA). Data represent mean ± standard deviation of 3 (n=3). * denotes significantly different from negative control treated with media + 1% EtOH at P Graphical representations of data were depicted in Figure 5-11 (Appendix section) Average IC 50 of H 2 O 2 (µm) H 2 O 2 (µm) Log [H 2 O 2 ], µm Negative Control (media + 1% EtOH) ± ± 0.01 RBE H 2 O 2 (µm) Log [H 2 O 2 ], µm Bajong LN (25 µg/ml) ± 1.10* 2.81 ± 0.04* Bajong LN (50 µg/ml) ± 1.17* 1.97 ± 0.07* MR219 (50 µg/ml) ± 1.14* 2.55 ± 0.06* MR219 (100 µg/ml) ± 1.13* 2.24 ± 0.05* The efficiencies of potential cytoprotective effects of Bajong LN (25µg/mL) and MR219 (50µg/mL) also differed from one another. Preincubation of H9c2(2-1) cells with Bajong LN (25µg/mL) extract increased the IC 50 of H 2 O 2 by approximately two fold. Contrarily, the efficiency of MR219 (50µg/mL) extract was not on par with that of Bajong LN (25µg/mL) extract, only a slight increment in IC 50 of H 2 O 2 was detected in cells pre-treated with MR219 (50µg/mL) extract (approximately 1.4%). The differences in efficiency of cytoprotective effects of both extracts could be attributed to the difference in their respective total antioxidant contents. The high concentrations of Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts tested in the present study did not result in cytoprotection of cells towards H 2 O 2 -induced cell cytotoxicity. Left shifts in cell viability curves were observed in H9c2(2-1) cells pre-incubated with higher concentrations of Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts respectively. These were followed by a decrease in IC 50 values of H 2 O 2 along with the high 115

133 concentrations RBE used. The IC 50 values of H 2 O 2 for H9c2(2-1) cells pretreated with Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts were 92.90µM and µM respectively as opposed to that of low concentration of Bajong LN (25µg/mL) and MR219 (50µg/mL) extracts (645.65µM and µM respectively). High concentrations of Bajong LN and MR219 extracts selected for this study were near the range of IC 50 for both extracts (IC 50 of Bajong LN: 52.18µg/mL to 73.09µg/mL; IC 50 of MR219: 95.44µg/mL to µg/mL). It was deduced that H9c2(2-1) cells could have experienced cytotoxic stress from high concentrations of crude rice brans and H 2 O 2 respectively. As overdoses of natural antioxidants have been reported to exhibit prooxidant-like characteristics that potentially threaten cell survival and viability (Azam et al. 2004; Decker 1997; Watjen et al. 2005), additional cytotoxic stress derived from H 2 O 2 could have further decrease the viability of H9c2(2-1) after treatment with extract and and H 2 O 2 respectively. Pre-treatment of cells with Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) extracts did not result in protection of cells against H 2 O 2 -induced cell cytotoxicity at 1000µM of H 2 O 2 (Table 3-13). Viability of H9c2(2-1) cells significantly decreased to less than 10%. This could be due to over accumulation of H 2 O 2 in cells which threaten the cell viability. Besides, induction of cells with high concentration may have induced cell necrosis and apoptosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995). Various chronic diseases such as cardiovascular diseases, cancer and diabetics are closely associated with oxidative stress. Factors such as molecular targets, mechanism and severity of oxidative stress define the consequence of oxidative stress injury on cells. This may further initiates signal transduction cascade reactions that lead to the onset and progression of chronic diseases (Aruoma 1998; Magalhaes et al. 2009). The present preliminary results have revealed the potential of RBE as a source of natural antioxidants to alleviate oxidative stress mediated cytotoxicity. Coupled with further carefully planned investigations, RBE could be considered for further 116

134 application as nutraceuticals for protection against chronic diseases mediated by oxidative stress, such as cardiovascular diseases. 117

135 Effects of Different Treatments on Activities and Gene Expression of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells Cells develop a series of endogenous cellular antioxidant enzymes as the first line defensive mechanism for regulation and maintenance of cellular redox homeostasis (Krishnamurthy & Wadhwani 2012). Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) are among the first line endogenous antioxidant protective mechanisms of cells. These protective mechanisms work synergistically with exogenous antioxidants to maintain the balance between oxidants and antioxidants within the physiological systems (Pham-Huy, He & Pham-Huy 2008). Oxidative stress has been implicated as one of the multifactorial etiologies of cardiovascular disease (CVD) (Ceriello 2008; Chatterjee et al. 2007; Droge 2002). Hence, strategies of using antioxidant to attenuate CVD via inhibition of inadvertent cellular oxidative damage or signalling pathway may have important implications to both prevention and treatment of CVD (Lönn, Dennis & Stocker 2012) Previous studies (Chapter 2) on the antioxidant activities of RBE of Sarawak local rice varieties have shown their potential antioxidant activities as free radical scavengers in several in vitro chemical-based antioxidant assays. Therefore, this part of the study was conducted at preliminary stage to assess the potential cytoprotective and antioxidant protective effects of these RBE by using an in vitro cardiomyocyte cell culture model. The focus of this part of study was centred on the potential induction effects of RBE on the regulations of endogenous cellular antioxidant enzymes (SOD, CAT and GPx). The cells were pre-treated with different concentrations of RBE and hydrogen peroxide (H 2 O 2 ) respectively. The effects of different treatments were assessed by studying the respective activities and gene expression of targeted endogenous cellular antioxidant enzymes in induced H9c2(2-1) cardiomyocytes. 118

136 (A) Superoxide Dismutase (SOD) SOD involves in the neutralization of superoxide anions (O - 2 ) into hydrogen peroxide (H 2 O 2 ) and oxygen (O 2 ). It mainly exist in three different forms: Cu/Zn-SOD, Mn-SOD and EC-SOD respectively (Meier et al. 1998). Each of them is distributed in different parts of the cells, Mn-SOD present mostly in mitochrondria while Cu/Zn-SOD occupies areas within the nucleus, cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani 2012). As for EC-SOD, it is the secreted form of Cu/Zn-SOD distributed in the extracellular space. Enzymatic activities of SOD were examined by using the commercially available detection assay kit (Cayman Chemicals). The assay kit measures the total enzymatic activities of Cu/Zn-SOD, Mn-SOD and Fe-SOD (Cayman Chemical 2014). The isoenzyme of SOD, SOD2 was the targeted gene for gene expression study in this part of the project. SOD2 is responsible for encoding Mn-SOD. They are mostly distributed in cellular mitochondria and protect the organelles from oxidative damage (Kang & Kang 2013; Kokoszka et al. 2001). This part of the study aimed to investigate the respective induction effects of RBE and H 2 O 2 on the enzymatic activities and gene expression of SOD in H9c2(2-1) cardiomyocytes. (i) Effects of RBE on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) Cells The effects of pre-treating H9c2(2-1) cells with different concentrations of RBE on their respective enzymatic activities and gene expression levels of SOD were depicted in Figure Based on the results, pre-treatment of H9c2(2-1) cells with RBE after 24 hours significantly increased the total activities of SOD [Figure 3-13(A)]. The highest SOD activity was detected in H9c2(2-1) cells pretreated with 50µg/mL of Bajong LN extract. The total SOD activity was increased by 2 folds as compared to negative control while cellular induction with 25µg/mL of Bajong LN, 50µg/mL and 100µg/mL of MR219 extracts elevated the total SOD activity by approximately 1.4 times in relation to negative control. 119

137 Figure 3-13: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

138 The induction effects of different concentrations of RBE on the expression of SOD2 were depicted in Figure 3-13(B). After 24 hours of incubation with RBE, expression of SOD2 was significantly down regulated by RBE of Bajong LN (50µg/mL) and MR219 (50µg/mL and 100µg/mL) respectively. No significant difference in expression of SOD2 was observed between negative control and 25µg/mL of Bajong LN treated sample. Contrarily to the lower concentration Bajong LN extract, 50µg/mL of Bajong LN induced a weak down-regulation in expression of SOD2 by approximately 10% in relation to negative control. Distinctive down-regulations of SOD2 were observed with 50µg/mL and 100µg/mL of MR219 extracts. Both extracts have down-regulated the expression of SOD2 by approximately 45%. (ii) Effects of H 2 O 2 on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) Cells In this part of the study, H 2 O 2 was used to induce oxidative injuries to H9c2(2-1) cardiomocytes. H9c2 cells were treated with three different concentrations of H 2 O 2 and incubated for 24 hours. The effects of H 2 O 2 inductions on total enzymatic activity of SOD and expression levels of SOD2 in H9c2(2-1) cells were depicted in Figure Based on the results, cellular induction with different concentrations of H 2 O 2 showed dose-dependent effects on the enzymatic activities and expression of SOD. Briefly, incubation of H9c2(2-1) cells with 125µM, 250µM and 500µM H 2 O 2 have elevated the total SOD activities of H9c2(2-1) cells [Figure 3-14(A)]. Total SOD activities were significantly elevated with increasing dose of H 2 O 2 from 125µM to 250µM. Cellular inductions with 125µM and 250µM of H 2 O 2 were found to increase total SOD activity by ~19% and ~43% in relation to negative control respectively. Contrarily, cellular induction with 500µM of H 2 O 2 resulted in approximately 33% decrement in total SOD activity as compared to that with 250µM of H 2 O

139 Figure 3-14: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in H9c2(2-1) cells after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

140 The effects of H 2 O 2 induction on the expression levels of SOD2 were depicted in Figure 3-14(B). A significant up-regulation of SOD2 expression was observed with 250µM of H 2 O 2 ; the expression level of SOD2 was up-regulated by 2 folds (relative to negative control) with 250µM of H 2 O 2. Contrarily, the expression level of SOD2 was significantly down-regulated by 32% (relative to negative control) with 500µM of H 2 O 2. There was no significant difference in expression level of SOD2 between negative control and 125µM of H 2 O 2. (iii) Effects of H 2 O 2 on total SOD enzymatic activity and gene expression of SOD2 in H9c2(2-1) cells pre-treated with RBE In this part of the study, H9c2(2-1) cells were pre-treated with different concentration of RBE before they were subjected to oxidative injuries with H 2 O 2. Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) extracts were among the different concentrations of RBE selected for the study. After 24 hours of incubation with RBE, the cells were induced with 125µM H 2 O 2. The concentration of H 2 O 2 was selected based on the lowest the concentration that would substantially decrease cell viability to approximately 50% (Figure 3-12 and Table 3-13). The effects of the treatment on total SOD enzymatic activities and gene expression of SOD2 in H9c2(2-1) cells were depicted in Figure Post H 2 O 2 induction (with 125µM of H 2 O 2 ) effects of H9c2(2-1) cardiomyocytes pre-treated with different concentrations of RBE generally have resulted in a slight decrease in total SOD activities in relation to negative control [Figure 3-15(A)]. Only significant increase (approximately 36% in relation to negative control) in total SOD activities was detected in cells pre-treated with 25µg/mL of Bajong LN extract. Total SOD activities significantly decreased by ~23.3% and ~13.6% in cells pre-treated with 50µg/mL of Bajong LN and 50µg/mL of MR219 extracts respectively. In addition, there was no significant difference in total SOD activity between negative control and 100µg/mL of MR219 treated cells. 123

141 Figure 3-15: (A) Total SOD enzymatic activities and (B) gene expression levels of SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) 124

142 Down-regulations in expression levels of SOD2 were generally observed across H9c2(2-1) cells pre-treated with different concentrations of RBE except for H9c2(2-1) cells pre-treated with 100µg/mL of MR219 extract [Figure 3-15(B)]. There was no significant difference in SOD2 expression between negative control and H9c2(2-1) cardiomyocytes pre-treated with 100µg/mL of MR219 extract. Pre-treatment of H9c2(2-1) cells with RBE of Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL) extract induced down-regulation in expression of SOD2 by ~38%, ~22%, and ~48% in relation to negative control respectively [Figure 3-15(B)]. In addition, dose-dependent interactions of RBE with the expression level of SOD2 were also observed. Cellular induction with low concentrations (25µg/mL of Bajong LN and 50µg/mL of MR219) of both RBE has significantly down-regulated the expression of SOD2 by ~38% to ~48% respectively. However, a weaker down-regulation in expression of SOD2 was reported with higher concentration of RBE (50µg/mL of Bajong LN and 100µg/mL of MR219 extracts) as compared to the lower concentration RBE (25µg/mL of Bajong LN and 50µg/mL of MR219 extracts). Based on the current findings, induction of H9c2(2-1) cardiomyocytes with different concentrations of RBE and H 2 O 2 has revealed their respective and distinctive effects in regulating the total SOD enzymatic activities and gene expression of SOD2. Inductions of H9c2(2-1) cells with different concentrations of RBE have significantly increased the total SOD enzymatic activity. Several in vivo and in vitro studies targeting on the antioxidative effects of RBE have also reported similar increment in enzyme activity of SOD after induction with RBE (Ling et al. 2001; Surarit et al. 2015; Wang et al. 2014). This reveals the potential of RBE in enhancing the enzymatic activity of SOD. The positive induction effects of RBE on the total SOD activity of H9c2(2-1) cells could be attributed to its polyphenol contents. Several reports have described the potential of polyphenols exhibiting prooxidant effects. Oxidation polyphenols is able to generate significant amount of potentially cytotoxic prooxidants such as O - 2, H 2 O 2, semiquinones and quinones (Awad et al. 2001; Lambert & Elias 2010). It was proposed that these prooxidants may have mildly triggered oxidative stress and subsequently induced the cellular 125

143 antioxidant defences which ultimately lead to cellular cytoprotection (Fahey & Kensler 2007; Halliwell 2009) The present data revealed that the expression of SOD2 gene was significantly down-regulated after induction of RBE. The effects were relatively more distinctive with higher concentrations of RBE. The exact mechanisms involved in the down-regulation of SOD2 gene remains unknown and require further investigation. Inductions of H9c2(2-1) cardiomyocytes with different concentrations of H 2 O 2 have shown dose-dependent interactions with both total SOD enzymatic activity and the gene expression of SOD2. The present data revealed that cellular induction with 250µM of H 2 O 2 significantly elevated the total SOD activity and expression level of SOD2. It was proposed that such observation - could be attributed to the the accumulation of O 2 which subsequently initiate the protective mechanism of SOD in detoxification of O - 2. Such mechanism is crucial for maintaining cellular redox homeostasis (Pham-Huy, He & Pham-Huy 2008). However, the underlying mechanism that leads to the accumulation of - - O 2 remains unknown. It was deduced that the source of O 2 could potentially be deriving from normal cellular metabolic activities. During normal cell proliferation cycles, mitochondrial oxidative phosphorylation, the ATP energy production pathway of mitochondrial produces ROS such as superoxide (O - 2 ) and hydroxyl (OH - ) radicals and H 2 O 2 (Hoffman & Brookes 2009; Lee et al. 2011). Positive correlation between mitochondrial ROS and Mn-SOD has been reported in proliferating cells (Chung et al. 2009; Lee et al. 2011). In order to maintain the intercellular mitochondrial redox homeostasis, Mn-SOD localized in mitochondrial matrix are up-regulated to aid in the detoxification of O - 2 to O 2 and H 2 O 2 (Zelko, Mariani & Folz 2002). Similar observation was reported in the present study. The expression of SOD2 was significantly up-regulated by 2.4 folds in relation to negative control. Such observation may suggest the activation of Mn-SOD to counteract potential oxidative injury mediated by exogenous H 2 O 2. In contrast to the induction effect with 250µM of H 2 O 2, cellular induction with 500µM of H 2 O 2 weakly up-regulated the total SOD activity in H9c2(2-1) 126

144 cells by approximately 8.6% while the expression of SOD2 was significantly down-regulated. As the expression of SOD2 directly correlate to the levels of Mn-SOD (Drane et al. 2001), the present observation on down-regulation of SOD2 expression with 500µM of H 2 O 2 could suggest the decrease in Mn-SOD level. In the condition of absence or little existence of Mn-SOD, both cytosolic Cu/Zn-SOD and EC-SOD could have involved in the detoxification of superoxide ions in the cells (Papa et al. 2014). Previous study on viability of H9c2(2-1) cells with different concentrations of H 2 O 2 (Figure 3-11) have revealed a significant drop in cell viability to approximately 48% after 24 hours of treatment with 500µM H 2 O 2. It was presumed that 500µM H 2 O 2 could have induced substantial oxidative injuries to H9c2(2-1) cardiomyocytes and consequently led to mitochondrial dysfunction. Both Mn-SOD and Cu/Zn-SOD are involving in the - detoxification of O 2 that leads to intracellular accumulation of H 2 O 2 and O 2 (Meier et al. 1998). It was discovered that SOD (Mn-SOD and Cu/Zn-SOD) and high concentration of H 2 O 2 synergistically induced the degradation of nitric oxide (NO) and concomitantly increased the formation of ONOO - (McBride, Borutaite & Brown 1999). Intracellular accumulation of these ONOO - has been associated with pathologies of various oxidative stress-related chronic diseases. These radicals are capable of inducing mitochondrial cytotoxicity by inhibition of mitochondrial electron transport chain (McBride, Borutaite & Brown 1999; Radi et al. 1994). This consequently leads to ATP depletion which threatens cell survival and normal functions of mitochondria (Lieberthal, Menza & Levine 1998). Based on the present result, the H 2 O 2 -induction of RBE pre-treated H9c2(2-1) cells generally did not result in any significant improvement over the total SOD enzymatic activity and expression levels of SOD2. Interestingly, only H9c2(2-1) cells that was pre-treated with 25µg/mL of Bajong LN RBE resulted in significant improvement of total SOD activity by 33% (relative to negative control) after being induced with 125µM of H 2 O 2 for 24 hours (Figure 3-15). Contrarily, tthe total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of Bajong LN RBE only (Figure 3-13) reported a significant increment of total SOD 127

145 activity by 44% in relation to negative control. This translates into a difference of 11% in the total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of Bajong LN RBE, before and after H 2 O 2 -induction. The mechanisms involved in relation to the present observations await further investigation. It was speculated that the decrease in total SOD activity of RBE (25µg/mL of Bajong LN) pre-treated H9c2(2-1) after being induced with 125µM of H 2 O 2 could be linked to the oxidation of SOD enzyme mediated by H 2 O 2 (Jewett et al. 1999). Polyphenols are capable of exerting characteristics of prooxidants. Through oxidation process, the oxidized polyphenols can generate prooxidants such as O - 2, H 2 O 2, semiquinones and quinones (Awad et al. 2001; Lambert & Elias 2010). Accumulation of these endogenous H 2 O 2 along with those introduced exogenously could have initiated the inactivation of SOD enzyme. Jewett et al. (1999) has highlighted the potential of H 2 O 2 in mediating oxidation of Cu/Zn-SOD. The loss of copper ion, fragmentation of active-site peptides and the production of 2-oxo-histidine were among the characteristics of oxidized Cu/Zn-SOD which consequently leads to the enzyme inactivation (Jewett et al. 1999). 128

146 (B) Catalase (CAT) CAT enzyme involves in the catalytic conversion of H 2 O 2 to H 2 O and O 2 in a two-steps reaction (Kang & Kang 2013). It actively involves in detoxification of H 2 O 2 produced from the enzymatic reaction of SOD and cellular metabolic activities (Pham-Huy, He & Pham-Huy 2008). The enzyme maintains intracellular ROS homeostasis by neutralizing the toxic effects of H 2 O 2 produced from cellular metabolic activities. The enzyme primarily localized in peroxisomes of the cells and actively neutralize H 2 O 2 that diffuses into the peroxisomes (Slater 1984). It is also a highly conserved protein and is encoded by a single gene (Kang & Kang 2013; Nishikawa et al. 2002). (i) Effects of RBE on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells The effects of inducing H9c2(2-1) cells with different concentrations of RBE on their respective enzymatic activity and gene expression of CAT were depicted in Figure Based on the results, cellular induction with Bajong LN (50µg/mL) and MR219 (50µg/mL and 100µg/mL) RBE have elevated cellular CAT activity respectively while no significant improvement in CAT activity was observed with 25µg/mL of Bajong LN [Figure 3-16(A)]. Among the two different concentrations of extracts selected in this study, higher concentrations of extracts were found to induce higher cellular CAT activities as compared to the lower extract concentrations. Briefly, cellular CAT activity had increased by ~39% and ~103% in relation to negative control with 50µg/mL of Bajong LN extract and 100µg/mL of MR219 extract respectively. As for the 50µg/mL of MR219 extract, it weakly elevated the cellular CAT activity by ~16%. In additional, significantly higher CAT activities were also observed in MR219 extracts when compared to Bajong LN extracts. 129

147 Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT after treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

148 Figure 3-16(B) showed the effects of cellular induction with different concentrations of RBE on the expression levels of cellular CAT. Based on the result, the expression levels of CAT were significantly up-regulated with all the concentrations of extracts tested. The increments were in the range of ~18% to ~40%. In addition, it was discovered that Bajong LN extracts expressed higher levels of CAT (relative to negative control) as compared to MR219 extracts. There was no significant difference in expression of CAT between the two different concentrations of each extract selected for this part of the study. (ii) Effects of Hydrogen peroxide (H 2 O 2 ) on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells Effects of H 2 O 2 inductions on the enzymatic activity and expression levels of CAT in H9c2(2-1) cells were depicted in Figure H9c2(2-1) cells were incubated with three different concentrations of H 2 O 2 for 24 hours. The present results revealed that cellular induction with 250µM of H 2 O 2 significantly increased the CAT activity by ~20%. Contrarily to the induction effect with 250µM of H 2 O 2, no significant difference in CAT activity was reported with 125µM and 500µM of H 2 O 2 respectively [Figure 3-17(A)]. Induction of H9c2(2-1) cardiomyocytes with different concentrations of H 2 O 2 significantly elevated the expression levels of CAT [Figure 3-17(B)]. The up-regulation of CAT expression was in the range of ~80% to ~380% in comparison to negative control. Among the three different concentrations of H 2 O 2 studied (125µM, 250µM and 500µM), the highest up-regulation in expression level of CAT was with 250µM H 2 O 2 (4.8 folds over negative control) then followed 125µM H 2 O 2 (3.2 folds over negative control), and with 500µM H 2 O 2 (1.8 folds over negative control). 131

149 Figure 3-17: (A) Total enzymatic activities and (B) gene expression levels of CAT after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

150 (iii) Effects of H 2 O 2 on total enzymatic activity and gene expression of CAT in H9c2(2-1) cells pre-treated with RBE H9c2(2-1) cells were pre-treated with different concentration of RBE: Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) for 24 hours before they were induced with oxidative injuries with 125µM of H 2 O 2. Figure 3-18 showed the effects of the treatment on enzymatic activities and gene expression of CAT. Briefly, CAT activities of cells pre-treated with RBE were significantly increased after being induced with 125µM of H 2 O 2 [Figure 3-18(A)]. The changes in increment of CAT activities were in the range of 3 to 8 folds as compared to negative control. Sample group pre-treated with 100µg/mL of MR219 extract reported the highest fold change (~8 folds) in CAT activity when compared to control group, then followed by 50µg/mL of MR219 extract (~5 folds); 25µg/mL of Bajong LN extract (~4.5 folds) and 50µg/mL of Bajong LN extract (~3.3 folds). Figure 3-18(B) depicted the gene expression of CAT after pre-treatment with different concentrations of RBE and followed by induction with 125µM of H 2 O 2. Based on the results, both 25µg/mL Bajong LN extract and MR219 (50µg/mL) extract significantly up-regulated the expression levels of CAT by 13% and 33% respectively in relation to negative control. A slight down-regulation in expression of CAT (~7%) was observed with cells pre-treated with 25µg/mL of Bajong LN extract. No significant difference in expression of CAT was reported between negative control and 100µg/mL of MR219 treated cells. Based on the current research findings, induction of H9c2(2-1) cardiomyocytes with different concentrations of RBE and H 2 O 2 has revealed their respective and distinctive effects in regulating the total enzymatic activities and gene expression levels of CAT. Briefly, CAT activities of H9c2(2-1) cells pre-treated with different concentrations of RBE were significantly improved in relation to negative control. Similar observations have also been reported in several in vitro and in vivo study models in which CAT activities of the study models were significantly improved by the induction of RBE (Lee et al. 2014; Surarit et al. 2015; Wang et al. 2014). All these evidences would suggest 133

151 potential of RBE as mediators for increasing cellular CAT activity and thereby improve the total antioxidant status of induced cells. Positive induction effects of RBE in elevating the activity of CAT were further evidently supported by up-regulation in gene expression of CAT. It is presumed that the positive induction effects of RBE on both enzymatic activity and gene expression CAT were generally attributed to the contents of polyphenols in those extracts. Polyphenols are capable of exerting characteristics of prooxidants. Through oxidation process, the oxidized polyphenols can generate prooxidants such as O - 2, H 2 O 2, semiquinones and quinones (Awad et al. 2001; Lambert & Elias 2010). Accumulation of these prooxidants would trigger oxidative stress that ultimately leads to activation of cellular antioxidant protective- and cytoprotective-mechanisms (Fahey & Kensler 2007; Halliwell 2009). Hydrogen peroxide (H 2 O 2 ) is known as one of the inducers of oxidative stress. It can easily be converted to reactive hydroxyl radicals and are able to migrate freely between cells and tissues (Jiang et al. 2014). CAT actively involved in the detoxification of H 2 O 2 produced from the enzymatic reaction of SOD and cellular metabolic activities (Pham-Huy, He & Pham-Huy 2008). It catalyses the conversion of H 2 O 2 to H 2 O and O 2 in a two-steps reaction (Kang & Kang 2013). CAT naturally has high Michaelis constants (Km) for H 2 O 2, hence it is capable of neutralizing high concentration of H 2 O 2 (Kohen & Nyska 2002). In the presence of different concentrations of exogenous H 2 O 2, activities and gene expression of CAT in H9c2(2-1) cardiomyocytes induced with different concentrations of H 2 O 2 were significantly up-regulated in a dosedependent manner. An increase in activity and expression levels of CAT was reported with 125µM and 250µM of H 2 O 2 respectively and followed by a decrease in activity and gene expression CAT when cells were induced with 500µM H 2 O

152 Figure 3-18: (A) Total enzymatic activities and (B) gene expression levels of CAT in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) 135

153 Previous study on viability of H9c2(2-1) cells with different concentrations of H 2 O 2 (Figure 3-11) have revealed a significant drop in cell viability to approximately 48% after 24 hours of treatment with 500µM H 2 O 2. It was presumed that 500µM H 2 O 2 could have induced substantial oxidative injuries to H9c2(2-1) cardiomyocytes and consequently resulting in progressive cell death. During such event, normal functions of cellular biological systems could have been disrupted (Trachootham et al. 2008). The present data revealed that pre-treating H9c2(2-1) cells with RBE before H 2 O 2 induction (with 125µM H 2 O 2 ) resulted in significant improvement on the enzymatic activity of CAT. Based on such observation, it was proposed that RBE could have protected H9c2(2-1) cells from oxidative injuries mediated by H 2 O 2 via up-regulation of CAT activity. 136

154 (C) Glutathione Peroxidase (GPx) GPx is a selenocysteine (Sec)-containing enzyme. The enzyme involves in the catalytic conversion of H 2 O 2 to H 2 O and organic hydroperoxides to their respective alcohols (Rodrigo et al. 2013). The enzyme is sensitive to low levels of oxidative injuries and capable of neutralizing low levels of H 2 O 2 (Kohen & Nyska 2002), GPx decomposes H 2 O 2 and organic hydroperoxides by utilizing its co-substrate, glutathione (GSH) and NADPH-NADH redox system (Pham- Huy, He & Pham-Huy 2008). Selenocysteine-containing GPx has 5 different isoforms: GPx1, GPx2, GPx3, GPx4 and GPx6. Each isoform has different structural form and is localized in different part of the physiological system (Kang & Kang 2013). Both GPx1 and GPx4 genes encode cytosolic GPx that are mainly distributed in cytoplasm. GPx1 gene has also involved in encoding mitochondrial GPx while GPx4 also encodes phospholipid hydroperoxide GPx that mainly localized in associated membrane (Esworthy, Ho & Chu 1997; Imai & Nakagawa 2003; Kang & Kang 2013). (i) Effects of RBE on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells The effects of pre-treating H9c2(2-1) cells with different concentrations of RBE : Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) on their respective total GPx enzymatic activities and expression of GPX1 were depicted in Figure Cellular induction with different concentrations of RBE significantly elevated the total GPx activities in H9c2(2-1) cells by 1.3 to 1.5 folds in comparison to that of negative control [Figure 3-19(A)]. However, GPx activity was weekly elevated with 100µg/mL of MR219 extract. In addition, among the two different RBE, no significant difference was observed between the two in their respective induction effects on GPx activities. 137

155 Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1 after treated with RBE. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

156 Figure 3-19 (B) depicted the effects of cellular induction with different concentrations of RBE on the expression of targeted GPx gene, GPx1. GPx1 gene was selected for this part of the study as the gene is responsible for encoding cytosolic and mitochrondrial GPx (Esworthy, Ho & Chu 1997). Based on the results, cellular induction with different concentrations of RBE showed a dose-dependent effect in the regulation of GPx1 gene. A significant upregulation in GPx1 gene (by 1.4 folds) was observed with 25µg/mL of Bajong LN extract. Contrarily, significant down-regulations in the expression of GPx1 gene were reported with 50µg/mL of Bajong LN, 50µg/mL and 100µg/mL of MR219 extracts respectively. The expression of GPx1 was down-regulated by 0.4 to 0.6 folds. (ii) Effects of Hydrogen peroxide (H 2 O 2 ) on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells Effects of H 2 O 2 inductions on the enzymatic activity and expression levels of GPx in H9c2(2-1) cells were depicted in Figure H9c2(2-1) cells were incubated with three different concentrations of H 2 O 2 for 24 hours. The present results revealed that cellular induction with 125µM and 250µM of H 2 O 2 significantly increased the GPx activities by ~34% and ~20% (relative to negative control) respectively. No significant difference in GPx activity was reported with 500µM of H 2 O 2 [Figure 3-20(A)]. Induction of H9c2(2-1) cardiomyocytes with 125µM and 250µM of H 2 O 2 significantly elevated the expression levels of GPx by 1.3 and 1.2 folds respectively [Figure 3-20(B)]. Among the three different concentrations of H 2 O 2 studied (125µM and 250µM), the highest up-regulation in expression level of GPx1 was with 125µM of H 2 O 2 (1.3 folds over negative control) and then followed 250µM of H 2 O 2 (1.2 folds over negative control). As for the effect of induction with 500µM of H 2 O 2, the expression of GPx1 was significantly downregulated by 37% as compared to negative control. 139

157 Figure 3-20: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1 after induction with different concentrations of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control at P 0.05 and ** : significantly different from negative control at P

158 (iii) Effects of H 2 O 2 on total GPx enzymatic activity and gene expression of GPx1 in H9c2(2-1) cells pre-treated with RBE Different concentration of RBE: Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) were used to induce H9c2(2-1) cardiomyocytes for 24 hours before 125µM of H 2 O 2 was introduced to the cells to induce oxidative injuries. The effects of pre-treating cells with different concentrations of RBE on their respective enzymatic activities and gene expression levels of GPx were depicted in Figure H9c2(2-1) cells that have been pre-treated with 50µg/mL Bajong LN, 50µg/mL and 100µg/mL of MR219 extracts showed significant decrement in total GPx activities after induction with 125µM of H 2 O 2 [Figure 3-21(A)]. Total GPx activities were decreased by ~27% to ~53% as compared to negative control. There was no significant difference in total GPx activity between negative control and 25µg/mL of Bajong LN pre-treated cells. In addition, the total GPx activity also showed dose-dependent interaction. The present data showed that GPx activity significantly decreased with increasing concentration of RBE. Figure 3-21(B) showed the post H 2 O 2 induction effects of H9c2(2-1) cells pre-treated with different concentration of RBE on their respective expression of GPx1. Based on the results, GPx1 expression showed dosedependent interaction. The expressions of GPx1 were weakly up-regulated with both 25µg/mL of Bajong LN (7% increment)) and 50µg/mL of MR219 (10% increment) extracts. Contrarily, GPx1 expressions were down-regulated when the cells were induced with higher concentrations of RBE. However, the downregulation effects were relatively weak. The expression of GPx1 was downregulated by ~14% with 25µg/mL of Bajong LN extract. There was no significant difference in expression of GPx1 between negative control and 100µg/mL of MR219 extracts. 141

159 Figure 3-21: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H 2 O 2. Data represent mean ± standard deviation of three repetitions (n=3). * : significantly different from negative control (P 0.05); ** : significantly different from negative control (P 0.01) 142