Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis
|
|
- Cameron Davis
- 5 years ago
- Views:
Transcription
1 Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Susan Anne Feeney, Victoria J Armstrong, Lyndsey Crawford, Suzanne J Mitchell, Conall Mccaughey, Peter V Coyle To cite this version: Susan Anne Feeney, Victoria J Armstrong, Lyndsey Crawford, Suzanne J Mitchell, Conall Mccaughey, et al.. Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis. Journal of Medical Virology, Wiley-Blackwell, 0, (), pp.0. <0.00/jmv.>. <hal-00> HAL Id: hal-00 Submitted on Jan 0 HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
2 Journal of Medical Virology Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Journal: Journal of Medical Virology Manuscript ID: JMV--00.R Wiley - Manuscript type: Research Article Date Submitted by the Author: -May-0 Complete List of Authors: Feeney, Susan; Royal Victoria Hospital, Regional Virus Laboratory Armstrong, Victoria; Royal Victoria Hospital, Regional Virus Laboratory Crawford, Lyndsey; Royal Victoria Hospital, Regional Virus Laboratory Mitchell, Suzanne; Royal Victoria Hospital, Regional Virus Laboratory McCaughey, Conall; Royal Victoria Hospital, Regional Virus Laboratory Coyle, Peter; Royal Victoria Hospital, Regional Virus Laboratory Keywords: Viral Gastroenteritis, Real-Time PCR
3 Page of Journal of Medical Virology Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis susan.feeney@belfasttrust.hscni.net Tables Multiplex Rotavirus F primer R Primer Probe Norovirus GI F Primer R Primer Probe * Probe ** Norovirus GII F Primer R Primer Probe Multiplex Adenovirus F Primer R Primer Probe Astrovirus F Primer R Primer Probe Internal Control MS λ phage F Primer R Primer Probe GGCTTTAAAAGAGAGAATTTCCG TATCAGAAAGATTAGAATTGTGGTATATTC VIC-CGG TTA GCT CCT TTT A-NFQMGB CGY TGG ATG CGN TTY CAT GA CTT AGA CGC CAT CAT CAT TYA C Sequence - Target Reference FAM-AGA TYG CGR TCY CCT GTC CA-TAMRA TAMRA-AGA TYG CGR TCY CCT GTC CA-BHQ CAR GAR BCN ATG TTY AGR TGG ATG AG TCG ACG CCA TCT TCA TTC ACA FAM-TGG GAG GGC GAT CGC AAT CT-TAMRA CCG ACC CAC GAT GTA ACC A GCG GTC GAC GGG CAC GAA VIC-ACA GGT CRC AGC GAC TGA CGC-TAMRA CCG AGT AGG ATC GAG GGT GCT TCT GAT TAA ATC AAT TTT AA FAM-CTT TTC TGT CTC TGT TTA GAT-NFQMGB TGG CAC TAC CCC TCT CCG TAT TCA CG GTA CGG GCG ACC CCA CGA TGA C CY-CAC ATC GAT AGA TCA AGG TGC CTA CAA GC-BHQ VP This paper ORF Junction / () ORF Junction / () Hexon Gene This paper NCR This paper NCR () Table I. Primer and probe sets for Multiplex and Multiplex. * and ** alternative primer and probe label to allow simultaneous discrimination between Norovirus GI and GII note alternative probe only used in assay validation, not in year clinical validation. Emission spectrum of typical TaqMan Probes: FAM -nm, VIC -nm, TAMRA - 0nm, Cy -0nm. (Key: NFQMGB Non-fluorescent quencher Minor Groove Binder, BHQ- Black Hole Quencher; ORF- Open reading frame; NCR- Non-coding region)
4 Journal of Medical Virology Page of Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis susan.feeney@belfasttrust.hscni.net Probe-Based Multiplex Sensitivity % Specificity % Nested Gel-Based Assay Sensitivity % Specificity Norovirus.... Rotavirus Adenovirus..0.. Astrovirus Table II Assay validation results from a panel of specimens previously positive for a range across the four target types via a nested gel-based assay Mixed Infections Rotavirus Norovirus Rotavirus Adenovirus Rotavirus Astrovirus Norovirus Adenovirus Norovirus Astrovirus Adenovirus Astrovirus Rotavirus Norovirus Adenovirus Mar 00-Feb 00 Mar 00-Feb 00 % Mar 00-Feb Table III. Dual and triple infections detected over the three year period
5 Page of Journal of Medical Virology Figure A. Average results obtained for the,0 paediatric specimens processed both multiplex assays over a three year period, March 00-February 00. 0xmm ( x DPI)
6 Journal of Medical Virology Page of Figure B. Average results obtained for the, adult specimens processed via Multiplex assays over a three year period, March 00-February 00. 0xmm ( x DPI)
7 Page of Journal of Medical Virology Figure. Seasonal distribution of rotavirus positive specimens in paediatrics over a three year period March 00-February 00. x0mm ( x DPI)
8 Journal of Medical Virology Page of Figure. Seasonal distribution of norovirus GI/GII positive specimens in both paediatric (black) and adult (grey) specimens over a three year period March 00-February 00. (P-paediatric, A-adult) x0mm ( x DPI)
9 Page of Journal of Medical Virology Figure. Seasonal distribution of group F adenovirus (black) and Astrovirus (grey) positive specimens in the paediatric population over a three year period March 00-February 00. x0mm ( x DPI)
10 Journal of Medical Virology Page of Title: Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Running Title: Validation of TaqMan Multiplex PCR for Viral Gastroenteritis ( characters) Authors: S.A. Feeney*, V.J. Armstrong, S.J. Mitchell, L. Crawford, C. McCaughey, P.V. Coyle. Regional Virus Laboratory, Kelvin Building, Royal Victoria Hospital, Grosvenor Road, Belfast, Northern Ireland. BT BA. *Corresponding author Above address Tel: +--0 Fax: susan.feeney@belfasttrust.hscni.net Abstract: words
11 Page of Journal of Medical Virology Abstract There is a need to provide rapid, sensitive, and often high throughput detection of pathogens in diagnostic virology. Viral gastroenteritis is a serious health issue often leading to hospitalisation in the young, the immunocompromised and the elderly. The common causes of viral gastroenteritis include rotavirus, norovirus (genogroups I and II), astrovirus and group F adenoviruses (serotypes 0 and ). This paper describes the work-up of two internally controlled multiplex, probe-based PCR assays and reports on the clinical validation over a three year period, March 00 to February 00. Multiplex assays were developed using a combination of TaqMan and minor groove binder (MGB ) hydrolysis probes. The assays were validated using a panel of specimens, previously positive via a nested gel-based assay. The assays had improved sensitivity for adenovirus, rotavirus and norovirus (.% vrs.%; 00% vrs.% and.% vrs.% respectively) and also more specific for targets adenovirus, rotavirus and norovirus (% vrs.%; 00% vrs.% and.% vrs.% respectively). For the specimens tested, both assays had equal sensitivity and specificity for astrovirus (00%). Overall the probe-based assays detected more positive specimens than the nested gel-based assay. Post introduction to the routine diagnostic service, a total of, specimens were processed with Multiplex and (,0 paediatric,, adult) over the three year study period. This clinically validated, probe-based multiplex testing algorithm allows highly sensitive and timely diagnosis of the four most prominent causes of viral gastroenteritis.
12 Journal of Medical Virology Page 0 of Introduction Acute gastroenteritis in the western world is associated with a substantial health and economic burden. The economic consequences are mainly attributable to primary care, hospitalisation, and cost to the individual [Anderson, 00; Cunliffe et al., 00; Lorgelly et al., 00; Rodigues et al., 00]. Rapid disease diagnosis can help maximise infection control efficiency and management of the disease, whether sporadic or outbreak. Acute gastroenteritis is caused by a number of viruses, including rotavirus, norovirus, astrovirus and group F adenoviruses [Anderson, 00; Logan et al., 00; Tran et al., 00; van Maarseveen et al., 00]. Transmission is via the faecal-oral route and clinical manifestations range from sub-clinical infection to varying degrees of fever, diarrhoea and vomiting [Anderson, 00; Elliott 00]. Noroviruses and rotaviruses affect both adult and child populations, and are a primary concern for infection control [Anderson, 00; Cunliffe et al., 00; Feeney et al., 00; Gallimore et al., 00]. These viruses have an extremely low infectious dose and are very resilient in the environment. Noroviruses are members of the Caliciviridae family of ssrna viruses, and have been identified as the most frequent cause of acute viral gastroenteritis [Anderson, 00; Glass et al., 00]. Noroviruses are genetically diverse viruses belonging to five recognised genogroups (GI GIV). At least antigenic types have been identified within these genogroups. GI and GII are most commonly associated with human gastroenteritis although GIV has been associated with sporadic infection [Glass et al., 00; La Rosa et al., 00]. Rotaviruses are members of the Reoviridae family. Uniquely, they are dsrna viruses, and have a segmented genome which can lend itself to frequent reassortment [Estes and Kapikian, 00; Gray et al., 00; Greenberg and Estes, 00]. Seven groups have been identified thus far and are categorised as serogroups A-G. Of these, serogroups A-C are known to infect humans with the majority of infections caused by serogroup A [Estes and Kapikian, 00; Gray et al., 00; Greenberg and Estes, 00]. Astrovirus and adenovirus are common causes of paediatric viral gastroenteritis [Anderson, 00; Tran et al., 00; Wilhelmi et al., 00]. Astroviruses belong to the family Astroviridae, genus mamastrovirus. As with norovirus, they are non-enveloped ssrna virues of which eight human subtypes have been identified [Guo et el., 00; Malasao et al., 00; Walter and Mitchell, 000]. Subtype is most commonly associated with human disease. Human adenoviruses
13 Page of Journal of Medical Virology are dsdna viruses comprising to date a total of serotypes which are grouped into seven species A-G. Although many of the serotypes can be shed in faeces, only serotypes 0 and belonging to species F, have been shown as causative agents of paediatric gastroenteritis [Banyai et al., 00; Logan et al., 00; Tran et al., 00]. All four of the above targets have been detected in a nested, multiplex PCR system; a qualitative end-point, gel-based assay, as described by O Neill et al. in 00, [O Neill et al., 00]. This assay was further enhanced in 00 to include primers specific for astrovirus. The gel-based assay involves a labour-intensive algorithm with a hr turn-around-time in the diagnostic setting, from sample receipt to result. To decrease turn-around-time, reduce labour intensity, improve sensitivity, and to have the option of quantitative detection, this gastroenteritis PCR was worked up and validated as a real-time probe-based assay.
14 Journal of Medical Virology Page of Methods Clinical Samples Faecal samples were received at the Regional Virus Laboratory, Belfast, from both hospitalised and general practice patients with gastroenteritis. Specimens were prepared aseptically as 0% suspensions in sterile phosphate-buffered saline (PBS) and centrifuged at 000 g for min, and a total of 0 µl of the clear supernatant was used for nucleic acid extraction. Nucleic Acid Extraction Nucleic acids from specimens were extracted using either the manual QIAamp DNA blood mini-kit or on the QIASymphony automated DNA extraction platform, in accordance with the manufacturer s instructions (Qiagen Ltd., Crawley, West Sussex, UK). Purified nucleic acid was eluted in 0µl of supplied AE buffer. Internal Control An internal control, MS bacteriophage (purified RNA from Roche cat no:, Mannheim, Germany) which represents encapsidated RNA, was spiked into clinical samples prior to extraction and co-amplified in the PCR to monitor nucleic acid isolation procedure and inhibition of amplification. A total of 0µl of a 0 - dilution of the MS RNA, equating to approximately.0 x0 copies/ml, was added to each sample prior to extraction. MS amplification results in a C T fixed ±. C T in the PCR for a properly isolated and uninhibited sample. The internal control primer and probe set are detailed in Table I [Rolfe et al., 00]. Multiplex Assay Design Two multiplex assays were designed to accommodate diagnostic testing of both adult and paediatric populations. Multiplex targets rotavirus and norovirus. Multiplex is specifically for use with paediatric (< years old) specimens only as it targets astrovirus and adenovirus. Both Multiplex and Multiplex assays include the MS primer and probe set and therefore both assays are used with filter combination FAM- VIC-CY.
15 Page of Journal of Medical Virology Primer and Probe Design for Multiplex Assays All PCR assays were designed specifically as reporter-quencher hydrolysis probe assays (TaqMan Assays). Primers and probes for astrovirus, adenovirus and rotavirus were designed de novo to target highly conserved regions (see Table I). Primer and probes were designed using Primer Express software version.0 and DNASTAR MegAlign sequence alignment software. The rotavirus group A primers and probe were designed within the region of the VP gene and is a VIClabelled minor groove binder (MGB) probe based assay. The astrovirus PCR targets the region of the astrovirus genome and is also a FAM-labelled MGB assay. The adenovirus primers and probe were designed via the modification of the nested inner primer set and targets the end of the hexon gene [O Neill et al., 00]. The adenovirus PCR is a VIC-labelled TaqMan assay. Norovirus genogroup specific primers and probe sets were adapted from published sequences [Kageyama et al., 00]. The norovirus genogroup specific GI and GII primer and probe sets amplify the ORF/ORF junction of the norovirus genome and are both FAM-labelled TaqMan hydrolysis probes. The MS internal control primer and probe sequences have been published previously [Rolfe et al., 00]. The MS probe incorporates a CY fluorophore at the end as detailed in Table I. Multiplex RT-PCR Assays Optimised real-time RT-PCR assays were carried out using the Superscript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA). Both multiplex assays were performed in 0 µl reaction volumes comprising 0. µl Superscript III Reverse Transcriptase Taq mix, µl x Reaction Mix (containing 0. mm each dntp),. mm MgSO, 0.µg/µl BSA (Invitrogen, Carlsbad, CA),.0 µm each primer and probe and NFW to a volume of µl. Extracted nucleic acid was denatured by heating to C for min followed by immediate cooling on ice. Two microlitres of denatured nucleic acid was added as template giving a final reaction volume of 0 µl. Real-time RT-PCR was performed in well plates using the Roche 0 LightCycler II (Roche, Mannheim, Germany). Cycling conditions were as follows: 0 C for min, C for min and cycles of C for 0 sec and 0 C for 0 sec.
16 Journal of Medical Virology Page of Quality Control (QC): Specificity and Sensitivity of monoplex and multiplex PCR Assays To assess specificity of the assay and discount the possibility of cross-reactivity or non-specific signal detection, a panel of clinical specimens which had been tested in the nested gel-based assay were re-tested against all targets with both monoplex and multiplex real-time assays. External quality assurance specimens including a HPA Enteric Unit EQ Norovirus GI and GII Panel and a National Institute of Biological Standards and Controls (NIBSC) Rotavirus Panel were tested in both monoplex and multiplex probe based assays.
17 Page of Journal of Medical Virology Results RT-PCR Assay Validation Results: Single-target (monoplex) RT-PCR probe-based assays were optimised for primer, probe and magnesium concentration and combined as two multiplex RT-PCR probebased assays. The sensitivity of the two multiplex assays was compared to the monoplex target reactions via serial dilution of extracted RNA/DNA of the target virus(es). For norovirus GI and GII, rotavirus, astrovirus and group F adenovirus comparable sensitivities were obtained in monoplex and multiplex assays, although C T values were marginally higher in the multiplex assays (data not shown). The performance of the multiplex assay was not influenced by co-amplification of another target. A total of specimens which were positive by the nested gel-based assay [O Neill et al., 00] were tested with these two optimised multiplex RT-PCR assays. The probe-based assays were more sensitive for adenovirus, rotavirus and norovirus (.% vrs.%; 00% vrs.% and.% vrs.% respectively) and also more specific for targets adenovirus, rotavirus and norovirus (% vrs.%; 00% vrs.% and.% vrs.% respectively) (see Table II). For the specimens tested, both assays had equal sensitivity and specificity for astrovirus (00%). The specificity of the two multiplex assays was further confirmed by the absence of nonspecific signal generation. Of the norovirus positive specimens only (%) belonged to genogroup GI. Overall the probe-based assays detected more positive specimens than the nested gel-based assay ( adenovirus, rotavirus, and norovirus). Both assays picked up an equal number of dual infections. External Quality Control Panel Results: Quality control results showed both monoplex and multiplex assays identified the true positives and true negatives in both the HPA EQ and NIBSC control panels with 00% sensitivity and specificity.
18 Journal of Medical Virology Page of Clinical Validation: March 00 February 00 Routine Diagnostic Testing Results: In March 00 the Multiplex and Multiplex assays were introduced to routine service. A retrospective look-back at the data generated has shown that over a three year period to March 00 a total of, specimens were processed with Multiplex (,0 paediatric specimens,, adult specimens). The paediatric specimens alone were tested with Multiplex. Mean annual results of the three year period (see Figures A, B) showed norovirus GI and GII (not differentiated in routine testing) positivity of % and % in the paediatric and adult specimens tested respectively. % of the adults tested and % of the paediatric patients tested were rotavirus positive. Adenovirus was positive in % of specimens tested, % of specimens tested were astrovirus positive. Negative results accounted for % (paediatrics) and % (adults) of all specimens tested. The monthly/seasonal breakdown was remarkably consistent for the four virus types over the three years (see Figures -). Rotavirus showed a consistent winter seasonal peak in the paediatric (Figure ) and adult specimens tested. Numbers began to rise in December to peak over January-February, and tailed off towards late Spring, April - May. The year however showed a marked increase in both paediatric and adult populations with numbers positive reaching (.% positivity) in the paediatrics and (.%) in the adult populations (positivity.%,.% in and respectively in paediatrics; positivity.% in both and in the adult population). In both paediatric and adult populations norovirus also showed a characteristic winter peak with numbers beginning to rise in October, peaking in January, remaining high through February and beginning to decline through March. With norovirus (Figure ), February 00 showed a significant increase in positivity in the adult population with positive (.% of the positives). However the overall norovirus positivity for the adult population remained stable over the three year period (.%,. and.% for 00-00, and respectively). Only the paediatric population was tested for Group F adenovirus and Astrovirus (Figure ). Adenovirus showed a consistent presence over the month period studied, with no seasonality obvious. The average monthly positive rate for
19 Page of Journal of Medical Virology adenovirus was approximately 0/month. Astrovirus showed an autumnal/winter seasonality, with numbers beginning to rise slightly early in September, peaking in November, and tailing off towards March. A number of mixed infections were detected, mainly a combination of rotavirus with either adenovirus, norovirus, or astrovirus, and on two occasions rotavirus with both adenovirus and norovirus (see Table III). The major occurrence of dual infections was in with rotavirus and adenovirus. This was an exceptionally high year for rotavirus positivity in the paediatric population. The inhibition rate was seen to be.% for Multiplex and.0% for Multiplex. In the majority of cases inhibition was overcome via a single freeze-thaw cycle and reextraction. 0
20 Journal of Medical Virology Page of Discussion The gel-based nested multiplex assay [O Neill et al., 00] has been replaced by the two TaqMan single-round real-time multiplex assays as a regional service. Turnaround time has been reduced to same-day, or ultimately under hours from specimen receipt to result issue. Approximately,00 faecal samples have been processed annually in these assays from (, in total). Multiplex was designed specifically to target norovirus and rotavirus, viruses of particular clinical significance in gastroenteritis outbeaks where rapid result turn-around time has a direct effect on patient management and infection control [Cunliffe et al, 00; Gallimore et al., 00]. These viruses are also extremely important in sporadic cases of gastroenteritis, often leading to hospitalisation in the very young. Multiplex specifically targets group F adenovirus and astrovirus, and is only used for the paediatric population. These viral infections mostly occur in childhood and confer immunity against reinfection which accounts for the absence of these viruses in the adult population [Anderson, 00; Elliott, 00; Tran et al, 00]. Another gastroenteritis virus, Sapovirus, belonging to the Caliciviridae family is known to cause infections in the very young with a prevalence similar to astrovirus and will be added to the testing schedule in the near future [Svraka et al., van Maarseveen et al., 00]. This is the first report of a probe based diagnostic assay targeting the rotavirus VP gene. Due to the extreme genetic variability of rotavirus, choice of target regions is limited, and in selecting VP as the target gene, 00 nucleotides at the end represented the optimal choice to allow maximal detection of different isolates. Norovirus GI and GII are not distinguished routinely in our current diagnostic setting, although for the purposes of assay validation an alternative TAMRA-BHQ probe was used with equal sensitivity and specificity as the FAM-TAMRA probes to differentiate between the genogroups (see Table I). Rotavirus is uniquely a dsrna virus and requires heat denaturation ( C/ min) prior to cdna synthesis. All nucleic acid extracts processed via Multiplex are subjected to heat denaturation, and while facilitating the detection of rotavirus, this does not alter the ability to detect the ssrna norvirus targets. Both assays for the detection of all four targets are run simultaneously on the LC0 II using a universal RT-TaqMan PCR thermocycling programme. Although the group F adenoviruses are DNA targets, this protocol does
21 Page of Journal of Medical Virology not affect sensitivity. The probe-based assays are continually monitored via in-house quality control systems and perform to an exceptionally high standard in on-going external quality control programmes (HPA EQ, NIBSC). Routine processing of the, specimens has generated valuable clinical and epidemiological data. The monthly distribution of the viruses was consistent over the three years, and demonstrated the seasonal incidence well, particularly with respect to norovirus and rotavirus. The norovirus outbreaks tend to establish earlier in the year than rotavirus, with January and February high months for both viruses. Winter seasonality is well established and is not reflective of enhanced testing as an outbreak protocol ensures no more than six positive specimens in any outbreak are processed. The rise in the number of positive norovirus results (n=) seen in February 00 in the adult population (see Figure ) did not continue as the March 00 figures (not part of the study time period) showed a drop back to n=. The rotavirus positives detected in the adult specimens are most likely due to re-emergence of susceptibility in the elderly population [Feeney et al., 00]. This testing algorithm is qualitative although interpretation of real time C T values lends itself to semi-quantitation with a low C T value indicating a higher viral load, but the clinical significance of C T interpretation needs to be better established. Prolonged viral shedding, particularly with norovirus, post-acute infection was seen with a rising C T value in follow-up samples. C T values in follow-up samples can also indicate dual infection due to an overlap in infection with one virus followed by a second virus infection, rather than multiple infections at the one time. Viral gastroenteritis in the developing world is associated with an immense disease burden and a high mortality rate. In developed countries viral gastroenteritis has low mortality rates but morbidity and economic consequences are significant. These onestep probe-based RT-PCR assays have improved turn-around-time significantly, are ultra sensitive and are potentially quantitative. In the high through-put diagnostic setting this rapid, quality-assured testing enables efficient and economic service delivery.
22 Journal of Medical Virology Page 0 of References Anderson EJ, 00. Prevention and treatment of viral diarrhea in pediatrics. Expert Rev Anti Infect Ther : 0-. Banyai K, Martella V, Meleg E, Kisfali P, Peterfi Z, Benko M, Melegh B, Szu G. 00. Searching for HAdV-, the putative gastroenteritis-associated human adenovirus serotype in Southern Hungary. New Microbiologia : -. Cunliffe N.A., Booth JA, Elliot C, Lowe SJ, Sopwith W, Kitchin N, Nakagomi O, Nakagomi T, Hart CA, Regan M. 00. Healthcare-associated viral gastroenteritis among children in a large pediatric hospital, United Kingdom. Emerg Infect Dis : -. Elliott EJ. 00. Acute gastroenteritis in children. BMJ : -0. Estes MK, Kapikian A. 00. Rotaviruses. Fields Virology th Edition: -., Mitchell SJ, Mitchell F, Wyatt DE, Fairley D, McCaughey C, Coyle PV, O Neill HJ. 00. Association with the G rotavirus with gastroenteritis in adults. J Med Virol : -. Gallimore CI, Taylor C, Gennery AR, Cant AJ, Galloway A, Xerry J, Adigwe J, Gray JJ. 00. Contamination of the hospital environment with gastroenteric viruses: comparison of two paediatric wards over a winter season. J Clin Microbiol : -. Glass RI, Parashar UD, Estes MK. 00. Norovirus gastroenteritis. N Engl J Med : -. Gray J, Vesikari T, Van Damme P, Giaquinto C, Mrukowicz J, Guarino A, Dagan R, Szajewska H, Usonis V. 00. Rotavirus. J Pediatr Gastroenterol Nutr : Sppl :S-. Greenberg HB, Estes MK. 00. Rotaviruses: from pathogenesis to vaccination. Gastroenterology : -. Guo L, Xu X, Song J, Wang W, Wang J, Hung T. 00. Molecular characterization of astrovirus infection in children with diarrhea in Beijing, J Med Virol : -. Rolfe KJ, Parmar S, Mururi D, Wreghitt TG, Jalal H, Zhang H, Curran MD. 00. An internally controlled, one-step, real-time RT-PCR assay for norovirus detection and genogrouping. J Clin Virol ; -. Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Takeda N, Katayama K. 00. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription PCR. J Clin Microbiol : -.
23 Page of Journal of Medical Virology La Rosa G, Pourshaban M, Laconelli M, Muscillo M. 00. Detection of genogroup IV noroviruses in environmental and clinical samples and partial sequencing through rapid amplification of cdna ends. Arch Virol : 0-0. Logan C, O Leary JJ, O Sullivan N. 00. Real-time reverse transcription-pcr for detection of rotavirus and adenovirus as causative agents of acute viral gastroenteritis in children. J Clin Microbiol : -. Logan C, O Leary JJ, O Sullivan N. 00. Real-time reverse transcription PCR detection of norovirus, sapovirus and astrovirus as causative agents of acute viral gastroenteritis. J Virol Methods : -. Lorgelly PK, Joshi D, Iturriza Gomara M, Flood C, Hughes CA, Dalrymple J, Gray J, Mugford M. 00. Infantile gastroenteritis in the community: a cost of illness study. Epidemiol Infect : -. Malasao R, Maneekarn N, Khamrin P, Pantip C, Tonusin S, Ushijima H, Peerakome S. 00. Genetic diversity of norovirus, sapovirus, and astrovirus isolated from children hospitalized with acute gastroenteritis in Chiang Mai, Thailand. J Med Virol 0: -. O Neill HJ, McCaughey C, Coyle PV, Wyatt DE, Mitchell F. 00. Clinical utility of nested multiplex RT-PCR for group F adenovirus, rotavirus and norwalk-like viruses in acute viral gastroenteritis in children. J Clin Virol : - Rodigues LC, Lordan G, Roberts J, Normand C, Higgins CD, Chady S, Tam CC. 00. The economic impact of gastroenteritis in the island of Ireland. Safe Food, The Food Safety promotion Board. Svraka S, Vennema H, van de Veer B, Hedlund KO, Thorhagen M, Siebenga J, Duizer E, Koopmans M. 00. Epidemiology and genotype of emerging sapovirusassociated infections across Europe. J Clin Microbiol : -. Tran A, Talmud D, Lejeune B, Jovenin N, Renois F, Payan C, Leveque N, Andreoletti L. 00. Prevalence of rotavirus, adenovirus, norovirus and astrovirus infections and coinfections among hospitalised children in northern France. J Clin Micro : -. van Maarseveen NM, Wessels E, de Brouer CS, Vossen AC, Claas EC 00. Diagnosis of viral gastroenteritis by simultaneous detection of Adenovirus group F, Astrovirus, Rotavirus group A, Norovirus genogroups I and II, and Sapovius in two internally controlled real-time PCR assays. J Clin Virol : 0-0. Walter JE, Mitchell DK, 000. Role of astroviruses in childhood diarrhea. Curr Opin in Pediatr : -. Wilhelmi I, Roman E, Sanchez-Fauquier A. 00. Viruses causing gastroenteritis. Clin Microbiol Infect : -.
24 Journal of Medical Virology Page of
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationViral Causes Of Gastroenteritis In The Era Of Widespread Rotavirus Vaccination
Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2016 Viral Causes Of Gastroenteritis In The Era Of Widespread
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationNucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
More informationViral Agents of Paediatric Gastroenteritis
Viral Agents of Paediatric Gastroenteritis Dr Carl Kirkwood -------------------- Enteric Virus Research Group Murdoch Childrens Research Institute Royal Children s Hospital Victoria. WHO Collaborating
More informationReceived 24 March 2011/Returned for modification 6 May 2011/Accepted 6 July 2011
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2011, p. 3154 3162 Vol. 49, No. 9 0095-1137/11/$12.00 doi:10.1128/jcm.00599-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Evaluation
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationThe association of and -related gastroduodenal diseases
The association of and -related gastroduodenal diseases N. R. Hussein To cite this version: N. R. Hussein. The association of and -related gastroduodenal diseases. European Journal of Clinical Microbiology
More information*To whom correspondence should be addressed. This PDF file includes:
www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue
More informationAn update on the laboratory detection and epidemiology of astrovirus, adenovirus, sapovirus, and enterovirus in gastrointestinal disease
An update on the laboratory detection and epidemiology of astrovirus, adenovirus, sapovirus, and enterovirus in gastrointestinal disease Christopher McIver, Principal Hospital Scientist, Microbiology Department
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationEnrichment culture of CSF is of limited value in the diagnosis of neonatal meningitis
Enrichment culture of CSF is of limited value in the diagnosis of neonatal S. H. Chaudhry, D. Wagstaff, Anupam Gupta, I. C. Bowler, D. P. Webster To cite this version: S. H. Chaudhry, D. Wagstaff, Anupam
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationMutaPLEX GastroSys 1. real time RT-PCR kit
MutaPLEX GastroSys 1 real time RT-PCR kit For the qualitative in vitro detection of RNA of rotavirus, norovirus (GI and GII), and DNA of adenovirus in clinical specimens, environmental and food samples
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationVIRAL GASTRO-ENTERITIS
VIRAL GASTRO-ENTERITIS Dr Esam Ibraheem Azhar (BSc, MSc, Ph.D Molecular Medical Virology) Asst. Prof. Medical Laboratory Technology Department ١ Gastroenteritis Introduction (1) Paediatric diarrhoea remains
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationgastroplexvirus real time RT-PCR Kit
Instruction for Use gastroplexvirus real time RT-PCR Kit For the qualitative in-vitro detection of RNA from Rotavirus, Norovirus (GI and GII), and DNA from Adenovirus in clinical specimens, environmental
More informationDepartment of Virology, Niigata Prefectural Institute of Public Health and Environmental Sciences, Niigata ; 3
Jpn. J. Infect. Dis., 63, 405-411, 2010 Original Article Molecular Epidemiological Study of Rotavirus and Norovirus Infections among Children with Acute Gastroenteritis in Nha Trang, Vietnam, December
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationBilateral anterior uveitis secondary to erlotinib
Bilateral anterior uveitis secondary to erlotinib Lik Thai Lim, Robert Alexander Blum, Chee Peng Cheng, Abdul Hanifudin To cite this version: Lik Thai Lim, Robert Alexander Blum, Chee Peng Cheng, Abdul
More informationDaily alternating deferasirox and deferiprone therapy for hard-to-chelate β-thalassemia major patients
Daily alternating deferasirox and deferiprone therapy for hard-to-chelate β-thalassemia major patients Manuela Balocco, Paola Carrara, Valeria Pinto, Gian Luca Forni To cite this version: Manuela Balocco,
More informationCIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
More informationA model for calculation of growth and feed intake in broiler chickens on the basis of feed composition and genetic features of broilers
A model for calculation of growth and feed intake in broiler chickens on the basis of feed composition and genetic features of broilers Bernard Carré To cite this version: Bernard Carré. A model for calculation
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationInfluenza A viruses Detection with real time RT-PCR reagents
Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza
More informationA Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain
Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza
More informationAcute viral gastroenteritis in children hospitalized in Iksan, Korea during December 2010 June 2011
Original article Korean J Pediatr 2013;56(9):383-388 eissn 1738-1061 pissn 2092-7258 Korean J Pediatr Acute viral gastroenteritis in children hospitalized in Iksan, Korea during December 2010 June 2011
More informationVIRAL GASTROENTERITIS
VIRAL GASTROENTERITIS (GI & N Block, Microbiology : 2016) By: Dr.Malak M. El-Hazmi OBJECTIVES Ø VIRAL GASTROENTERITIS (VGE) n Etiology of VGE n Epidemiology n Clinical Features n Lab diagnosis n Treatment
More informationReplacing Traditional Diagnostics of Fecal Viral Pathogens by a Comprehensive Panel of Real-Time PCRs
JOURNAL OF CLINICAL MICROBIOLOGY, May 2011, p. 1926 1931 Vol. 49, No. 5 0095-1137/11/$12.00 doi:10.1128/jcm.01925-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Replacing Traditional
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationChronic shedders as reservoir for nosocomial. transmission of norovirus
JCM Accepts, published online ahead of print on 1 September 2010 J. Clin. Microbiol. doi:10.1128/jcm.01308-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationRelationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
More informationTraining in Infectious Diseases Modeling. A reflection on vaccination as a disease control measure
Training in Infectious Diseases Modeling A reflection on vaccination as a disease control measure -Example of Rotavirus disease- Participant s Guide Adapted by Nathalie Elomeiri; Camelia Savulescu; Fernando
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationLYMPHOGRANULOMA VENEREUM PRESENTING AS PERIANAL ULCERATION: AN EMERGING CLINICAL PRESENTATION?
LYMPHOGRANULOMA VENEREUM PRESENTING AS PERIANAL ULCERATION: AN EMERGING CLINICAL PRESENTATION? Tajinder K Singhrao, Elizabeth Higham, Patrick French To cite this version: Tajinder K Singhrao, Elizabeth
More informationCross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
More informationFrom universal postoperative pain recommendations to procedure-specific pain management
From universal postoperative pain recommendations to procedure-specific pain management Hélène Beloeil, Francis Bonnet To cite this version: Hélène Beloeil, Francis Bonnet. From universal postoperative
More informationThe Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationDevelopment of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients Sangjung Park The Graduate School Yonsei University Department of Biomedical Laboratory
More informationHuman Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationHOW COST-EFFECTIVE IS NO SMOKING DAY?
HOW COST-EFFECTIVE IS NO SMOKING DAY? Daniel Kotz, John A. Stapleton, Lesley Owen, Robert West To cite this version: Daniel Kotz, John A. Stapleton, Lesley Owen, Robert West. HOW COST-EFFECTIVE IS NO SMOKING
More informationHuman Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationPrevalence and Management of Non-albicans Vaginal Candidiasis
Prevalence and Management of Non-albicans Vaginal Candidiasis Nalin Hetticarachchi, Ruth Ashbee, Janet D Wilson To cite this version: Nalin Hetticarachchi, Ruth Ashbee, Janet D Wilson. Prevalence and Management
More informationEpidemiological surveillance of human enteric viruses by monitoring of different environmental matrices
Epidemiological surveillance of human enteric viruses by monitoring of different environmental matrices A. Carducci, M. Verani, R. Battistini, F. Pizzi, E. Rovini, E. Andreoli and B. Casini Department
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationUniversity of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationIsolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States
JOURNAL OF VIROLOGY, May 2006, p. 5092 5096 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.5092 5096.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Isolation
More informationHuman Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.
PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationA study on the possibility of zoonotic infection in rotaviral diarrhoea among calves and buffalo calves in and around Kolkata, India
European Review for Medical and Pharmacological Sciences 2009; 13: 7-11 A study on the possibility of zoonotic infection in rotaviral diarrhoea among calves and buffalo calves in and around Kolkata, India
More informationNoronet report, April 2014
Noronet report, April 2014 Janko van Beek, Annelies Kroneman, Harry Vennema, Marion Koopmans A. van Leeuwenhoeklaan 9 3721 MA Bilthoven Postbus 1 3720 BA Bilthoven www.rivm.nl T 030 274 91 11 F 030 274
More informationGenetic diversity of noroviruses in Taiwan between November 2004 and March 2005
Arch Virol (2006) 151: 1319 1327 DOI 10.1007/s00705-005-0717-4 Genetic diversity of noroviruses in Taiwan between November 2004 and March 2005 F.-T. Wu 1, T. Oka 2, K. Katayama 2, H.-S. Wu 1, D.-S. Donald
More informationEvaluation of Three Influenza A/B Real-time RT-PCR Assays and a New 2009 H1N1 Assay for Detection of Influenza viruses
JCM Accepts, published online ahead of print on 15 September 2010 J. Clin. Microbiol. doi:10.1128/jcm.02464-09 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationNoronet report, April 2013
Noronet report, April 2013 Janko van Beek, Annelies Kroneman, Harry Vennema, Marion Koopmans National Institute for Public Health and the Environment, Bilthoven, The Netherlands The major aim of Noronet
More informationIMMUNOLOGY, HEALTH, AND DISEASE
IMMUNOLOGY, HEALTH, AND DISEASE Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens S. Rashid,* K. Naeem, 1 Z. Ahmed,
More informationPATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
More informationHCV Persistence and Immune Evasion in the Absence of Memory T Cell Help.
SOM Text HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. Arash Grakoui 1, Naglaa H. Shoukry 2, David J. Woollard 2, Jin-Hwan Han 1, Holly L. Hanson 1, John Ghrayeb 3, Krishna K.
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationDietary acrylamide exposure among Finnish adults and children: The potential effect of reduction measures
Dietary acrylamide exposure among Finnish adults and children: The potential effect of reduction measures Tero Hirvonen, Marika Jestoi, Heli Tapanainen, Liisa Valsta, Suvi M Virtanen, Harri Sinkko, Carina
More informationGastroenteritis and viral infections
Gastroenteritis and viral infections A Large number of viruses are found in the human gut; these include some that are associated with gastroenteritis Rotaviruses Adenoviruses 40/41 Caliciviruses Norwalk-like
More informationViruse associated gastrointestinal infection
Viruse associated gastrointestinal infection Dr. Hala Al Daghistani Rotaviruses Rotaviruses are a major cause of diarrheal illness in human (infants), and young animals, including calves and piglets. Infections
More informationThe QIAsymphony RGQ as a platform for laboratory developed tests
The QIAsymphony RGQ as a platform for laboratory developed tests James B. Mahony Ph.D., F.A.A.M., F.C.C.M. Director, Regional Virology Laboratory St. Joseph s Healthcare, Hamilton Assistant Dean Medical
More informationModerate alcohol consumption and risk of developing dementia in the elderly: the contribution of prospective studies.
Moderate alcohol consumption and risk of developing dementia in the elderly: the contribution of prospective studies. Luc Letenneur To cite this version: Luc Letenneur. Moderate alcohol consumption and
More information