Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis

Transcription

1 Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Susan Anne Feeney, Victoria J Armstrong, Lyndsey Crawford, Suzanne J Mitchell, Conall Mccaughey, Peter V Coyle To cite this version: Susan Anne Feeney, Victoria J Armstrong, Lyndsey Crawford, Suzanne J Mitchell, Conall Mccaughey, et al.. Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis. Journal of Medical Virology, Wiley-Blackwell, 0, (), pp.0. <0.00/jmv.>. <hal-00> HAL Id: hal-00 Submitted on Jan 0 HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

2 Journal of Medical Virology Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Journal: Journal of Medical Virology Manuscript ID: JMV--00.R Wiley - Manuscript type: Research Article Date Submitted by the Author: -May-0 Complete List of Authors: Feeney, Susan; Royal Victoria Hospital, Regional Virus Laboratory Armstrong, Victoria; Royal Victoria Hospital, Regional Virus Laboratory Crawford, Lyndsey; Royal Victoria Hospital, Regional Virus Laboratory Mitchell, Suzanne; Royal Victoria Hospital, Regional Virus Laboratory McCaughey, Conall; Royal Victoria Hospital, Regional Virus Laboratory Coyle, Peter; Royal Victoria Hospital, Regional Virus Laboratory Keywords: Viral Gastroenteritis, Real-Time PCR

3 Page of Journal of Medical Virology Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis susan.feeney@belfasttrust.hscni.net Tables Multiplex Rotavirus F primer R Primer Probe Norovirus GI F Primer R Primer Probe * Probe ** Norovirus GII F Primer R Primer Probe Multiplex Adenovirus F Primer R Primer Probe Astrovirus F Primer R Primer Probe Internal Control MS λ phage F Primer R Primer Probe GGCTTTAAAAGAGAGAATTTCCG TATCAGAAAGATTAGAATTGTGGTATATTC VIC-CGG TTA GCT CCT TTT A-NFQMGB CGY TGG ATG CGN TTY CAT GA CTT AGA CGC CAT CAT CAT TYA C Sequence - Target Reference FAM-AGA TYG CGR TCY CCT GTC CA-TAMRA TAMRA-AGA TYG CGR TCY CCT GTC CA-BHQ CAR GAR BCN ATG TTY AGR TGG ATG AG TCG ACG CCA TCT TCA TTC ACA FAM-TGG GAG GGC GAT CGC AAT CT-TAMRA CCG ACC CAC GAT GTA ACC A GCG GTC GAC GGG CAC GAA VIC-ACA GGT CRC AGC GAC TGA CGC-TAMRA CCG AGT AGG ATC GAG GGT GCT TCT GAT TAA ATC AAT TTT AA FAM-CTT TTC TGT CTC TGT TTA GAT-NFQMGB TGG CAC TAC CCC TCT CCG TAT TCA CG GTA CGG GCG ACC CCA CGA TGA C CY-CAC ATC GAT AGA TCA AGG TGC CTA CAA GC-BHQ VP This paper ORF Junction / () ORF Junction / () Hexon Gene This paper NCR This paper NCR () Table I. Primer and probe sets for Multiplex and Multiplex. * and ** alternative primer and probe label to allow simultaneous discrimination between Norovirus GI and GII note alternative probe only used in assay validation, not in year clinical validation. Emission spectrum of typical TaqMan Probes: FAM -nm, VIC -nm, TAMRA - 0nm, Cy -0nm. (Key: NFQMGB Non-fluorescent quencher Minor Groove Binder, BHQ- Black Hole Quencher; ORF- Open reading frame; NCR- Non-coding region)

4 Journal of Medical Virology Page of Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis susan.feeney@belfasttrust.hscni.net Probe-Based Multiplex Sensitivity % Specificity % Nested Gel-Based Assay Sensitivity % Specificity Norovirus.... Rotavirus Adenovirus..0.. Astrovirus Table II Assay validation results from a panel of specimens previously positive for a range across the four target types via a nested gel-based assay Mixed Infections Rotavirus Norovirus Rotavirus Adenovirus Rotavirus Astrovirus Norovirus Adenovirus Norovirus Astrovirus Adenovirus Astrovirus Rotavirus Norovirus Adenovirus Mar 00-Feb 00 Mar 00-Feb 00 % Mar 00-Feb Table III. Dual and triple infections detected over the three year period

5 Page of Journal of Medical Virology Figure A. Average results obtained for the,0 paediatric specimens processed both multiplex assays over a three year period, March 00-February 00. 0xmm ( x DPI)

6 Journal of Medical Virology Page of Figure B. Average results obtained for the, adult specimens processed via Multiplex assays over a three year period, March 00-February 00. 0xmm ( x DPI)

7 Page of Journal of Medical Virology Figure. Seasonal distribution of rotavirus positive specimens in paediatrics over a three year period March 00-February 00. x0mm ( x DPI)

8 Journal of Medical Virology Page of Figure. Seasonal distribution of norovirus GI/GII positive specimens in both paediatric (black) and adult (grey) specimens over a three year period March 00-February 00. (P-paediatric, A-adult) x0mm ( x DPI)

9 Page of Journal of Medical Virology Figure. Seasonal distribution of group F adenovirus (black) and Astrovirus (grey) positive specimens in the paediatric population over a three year period March 00-February 00. x0mm ( x DPI)

10 Journal of Medical Virology Page of Title: Development and Clinical Validation of Multiplex TaqMan Assays for Rapid Diagnosis of Viral Gastroenteritis Running Title: Validation of TaqMan Multiplex PCR for Viral Gastroenteritis ( characters) Authors: S.A. Feeney*, V.J. Armstrong, S.J. Mitchell, L. Crawford, C. McCaughey, P.V. Coyle. Regional Virus Laboratory, Kelvin Building, Royal Victoria Hospital, Grosvenor Road, Belfast, Northern Ireland. BT BA. *Corresponding author Above address Tel: +--0 Fax: susan.feeney@belfasttrust.hscni.net Abstract: words

11 Page of Journal of Medical Virology Abstract There is a need to provide rapid, sensitive, and often high throughput detection of pathogens in diagnostic virology. Viral gastroenteritis is a serious health issue often leading to hospitalisation in the young, the immunocompromised and the elderly. The common causes of viral gastroenteritis include rotavirus, norovirus (genogroups I and II), astrovirus and group F adenoviruses (serotypes 0 and ). This paper describes the work-up of two internally controlled multiplex, probe-based PCR assays and reports on the clinical validation over a three year period, March 00 to February 00. Multiplex assays were developed using a combination of TaqMan and minor groove binder (MGB ) hydrolysis probes. The assays were validated using a panel of specimens, previously positive via a nested gel-based assay. The assays had improved sensitivity for adenovirus, rotavirus and norovirus (.% vrs.%; 00% vrs.% and.% vrs.% respectively) and also more specific for targets adenovirus, rotavirus and norovirus (% vrs.%; 00% vrs.% and.% vrs.% respectively). For the specimens tested, both assays had equal sensitivity and specificity for astrovirus (00%). Overall the probe-based assays detected more positive specimens than the nested gel-based assay. Post introduction to the routine diagnostic service, a total of, specimens were processed with Multiplex and (,0 paediatric,, adult) over the three year study period. This clinically validated, probe-based multiplex testing algorithm allows highly sensitive and timely diagnosis of the four most prominent causes of viral gastroenteritis.

12 Journal of Medical Virology Page 0 of Introduction Acute gastroenteritis in the western world is associated with a substantial health and economic burden. The economic consequences are mainly attributable to primary care, hospitalisation, and cost to the individual [Anderson, 00; Cunliffe et al., 00; Lorgelly et al., 00; Rodigues et al., 00]. Rapid disease diagnosis can help maximise infection control efficiency and management of the disease, whether sporadic or outbreak. Acute gastroenteritis is caused by a number of viruses, including rotavirus, norovirus, astrovirus and group F adenoviruses [Anderson, 00; Logan et al., 00; Tran et al., 00; van Maarseveen et al., 00]. Transmission is via the faecal-oral route and clinical manifestations range from sub-clinical infection to varying degrees of fever, diarrhoea and vomiting [Anderson, 00; Elliott 00]. Noroviruses and rotaviruses affect both adult and child populations, and are a primary concern for infection control [Anderson, 00; Cunliffe et al., 00; Feeney et al., 00; Gallimore et al., 00]. These viruses have an extremely low infectious dose and are very resilient in the environment. Noroviruses are members of the Caliciviridae family of ssrna viruses, and have been identified as the most frequent cause of acute viral gastroenteritis [Anderson, 00; Glass et al., 00]. Noroviruses are genetically diverse viruses belonging to five recognised genogroups (GI GIV). At least antigenic types have been identified within these genogroups. GI and GII are most commonly associated with human gastroenteritis although GIV has been associated with sporadic infection [Glass et al., 00; La Rosa et al., 00]. Rotaviruses are members of the Reoviridae family. Uniquely, they are dsrna viruses, and have a segmented genome which can lend itself to frequent reassortment [Estes and Kapikian, 00; Gray et al., 00; Greenberg and Estes, 00]. Seven groups have been identified thus far and are categorised as serogroups A-G. Of these, serogroups A-C are known to infect humans with the majority of infections caused by serogroup A [Estes and Kapikian, 00; Gray et al., 00; Greenberg and Estes, 00]. Astrovirus and adenovirus are common causes of paediatric viral gastroenteritis [Anderson, 00; Tran et al., 00; Wilhelmi et al., 00]. Astroviruses belong to the family Astroviridae, genus mamastrovirus. As with norovirus, they are non-enveloped ssrna virues of which eight human subtypes have been identified [Guo et el., 00; Malasao et al., 00; Walter and Mitchell, 000]. Subtype is most commonly associated with human disease. Human adenoviruses

13 Page of Journal of Medical Virology are dsdna viruses comprising to date a total of serotypes which are grouped into seven species A-G. Although many of the serotypes can be shed in faeces, only serotypes 0 and belonging to species F, have been shown as causative agents of paediatric gastroenteritis [Banyai et al., 00; Logan et al., 00; Tran et al., 00]. All four of the above targets have been detected in a nested, multiplex PCR system; a qualitative end-point, gel-based assay, as described by O Neill et al. in 00, [O Neill et al., 00]. This assay was further enhanced in 00 to include primers specific for astrovirus. The gel-based assay involves a labour-intensive algorithm with a hr turn-around-time in the diagnostic setting, from sample receipt to result. To decrease turn-around-time, reduce labour intensity, improve sensitivity, and to have the option of quantitative detection, this gastroenteritis PCR was worked up and validated as a real-time probe-based assay.

14 Journal of Medical Virology Page of Methods Clinical Samples Faecal samples were received at the Regional Virus Laboratory, Belfast, from both hospitalised and general practice patients with gastroenteritis. Specimens were prepared aseptically as 0% suspensions in sterile phosphate-buffered saline (PBS) and centrifuged at 000 g for min, and a total of 0 µl of the clear supernatant was used for nucleic acid extraction. Nucleic Acid Extraction Nucleic acids from specimens were extracted using either the manual QIAamp DNA blood mini-kit or on the QIASymphony automated DNA extraction platform, in accordance with the manufacturer s instructions (Qiagen Ltd., Crawley, West Sussex, UK). Purified nucleic acid was eluted in 0µl of supplied AE buffer. Internal Control An internal control, MS bacteriophage (purified RNA from Roche cat no:, Mannheim, Germany) which represents encapsidated RNA, was spiked into clinical samples prior to extraction and co-amplified in the PCR to monitor nucleic acid isolation procedure and inhibition of amplification. A total of 0µl of a 0 - dilution of the MS RNA, equating to approximately.0 x0 copies/ml, was added to each sample prior to extraction. MS amplification results in a C T fixed ±. C T in the PCR for a properly isolated and uninhibited sample. The internal control primer and probe set are detailed in Table I [Rolfe et al., 00]. Multiplex Assay Design Two multiplex assays were designed to accommodate diagnostic testing of both adult and paediatric populations. Multiplex targets rotavirus and norovirus. Multiplex is specifically for use with paediatric (< years old) specimens only as it targets astrovirus and adenovirus. Both Multiplex and Multiplex assays include the MS primer and probe set and therefore both assays are used with filter combination FAM- VIC-CY.

15 Page of Journal of Medical Virology Primer and Probe Design for Multiplex Assays All PCR assays were designed specifically as reporter-quencher hydrolysis probe assays (TaqMan Assays). Primers and probes for astrovirus, adenovirus and rotavirus were designed de novo to target highly conserved regions (see Table I). Primer and probes were designed using Primer Express software version.0 and DNASTAR MegAlign sequence alignment software. The rotavirus group A primers and probe were designed within the region of the VP gene and is a VIClabelled minor groove binder (MGB) probe based assay. The astrovirus PCR targets the region of the astrovirus genome and is also a FAM-labelled MGB assay. The adenovirus primers and probe were designed via the modification of the nested inner primer set and targets the end of the hexon gene [O Neill et al., 00]. The adenovirus PCR is a VIC-labelled TaqMan assay. Norovirus genogroup specific primers and probe sets were adapted from published sequences [Kageyama et al., 00]. The norovirus genogroup specific GI and GII primer and probe sets amplify the ORF/ORF junction of the norovirus genome and are both FAM-labelled TaqMan hydrolysis probes. The MS internal control primer and probe sequences have been published previously [Rolfe et al., 00]. The MS probe incorporates a CY fluorophore at the end as detailed in Table I. Multiplex RT-PCR Assays Optimised real-time RT-PCR assays were carried out using the Superscript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA). Both multiplex assays were performed in 0 µl reaction volumes comprising 0. µl Superscript III Reverse Transcriptase Taq mix, µl x Reaction Mix (containing 0. mm each dntp),. mm MgSO, 0.µg/µl BSA (Invitrogen, Carlsbad, CA),.0 µm each primer and probe and NFW to a volume of µl. Extracted nucleic acid was denatured by heating to C for min followed by immediate cooling on ice. Two microlitres of denatured nucleic acid was added as template giving a final reaction volume of 0 µl. Real-time RT-PCR was performed in well plates using the Roche 0 LightCycler II (Roche, Mannheim, Germany). Cycling conditions were as follows: 0 C for min, C for min and cycles of C for 0 sec and 0 C for 0 sec.

16 Journal of Medical Virology Page of Quality Control (QC): Specificity and Sensitivity of monoplex and multiplex PCR Assays To assess specificity of the assay and discount the possibility of cross-reactivity or non-specific signal detection, a panel of clinical specimens which had been tested in the nested gel-based assay were re-tested against all targets with both monoplex and multiplex real-time assays. External quality assurance specimens including a HPA Enteric Unit EQ Norovirus GI and GII Panel and a National Institute of Biological Standards and Controls (NIBSC) Rotavirus Panel were tested in both monoplex and multiplex probe based assays.

17 Page of Journal of Medical Virology Results RT-PCR Assay Validation Results: Single-target (monoplex) RT-PCR probe-based assays were optimised for primer, probe and magnesium concentration and combined as two multiplex RT-PCR probebased assays. The sensitivity of the two multiplex assays was compared to the monoplex target reactions via serial dilution of extracted RNA/DNA of the target virus(es). For norovirus GI and GII, rotavirus, astrovirus and group F adenovirus comparable sensitivities were obtained in monoplex and multiplex assays, although C T values were marginally higher in the multiplex assays (data not shown). The performance of the multiplex assay was not influenced by co-amplification of another target. A total of specimens which were positive by the nested gel-based assay [O Neill et al., 00] were tested with these two optimised multiplex RT-PCR assays. The probe-based assays were more sensitive for adenovirus, rotavirus and norovirus (.% vrs.%; 00% vrs.% and.% vrs.% respectively) and also more specific for targets adenovirus, rotavirus and norovirus (% vrs.%; 00% vrs.% and.% vrs.% respectively) (see Table II). For the specimens tested, both assays had equal sensitivity and specificity for astrovirus (00%). The specificity of the two multiplex assays was further confirmed by the absence of nonspecific signal generation. Of the norovirus positive specimens only (%) belonged to genogroup GI. Overall the probe-based assays detected more positive specimens than the nested gel-based assay ( adenovirus, rotavirus, and norovirus). Both assays picked up an equal number of dual infections. External Quality Control Panel Results: Quality control results showed both monoplex and multiplex assays identified the true positives and true negatives in both the HPA EQ and NIBSC control panels with 00% sensitivity and specificity.

18 Journal of Medical Virology Page of Clinical Validation: March 00 February 00 Routine Diagnostic Testing Results: In March 00 the Multiplex and Multiplex assays were introduced to routine service. A retrospective look-back at the data generated has shown that over a three year period to March 00 a total of, specimens were processed with Multiplex (,0 paediatric specimens,, adult specimens). The paediatric specimens alone were tested with Multiplex. Mean annual results of the three year period (see Figures A, B) showed norovirus GI and GII (not differentiated in routine testing) positivity of % and % in the paediatric and adult specimens tested respectively. % of the adults tested and % of the paediatric patients tested were rotavirus positive. Adenovirus was positive in % of specimens tested, % of specimens tested were astrovirus positive. Negative results accounted for % (paediatrics) and % (adults) of all specimens tested. The monthly/seasonal breakdown was remarkably consistent for the four virus types over the three years (see Figures -). Rotavirus showed a consistent winter seasonal peak in the paediatric (Figure ) and adult specimens tested. Numbers began to rise in December to peak over January-February, and tailed off towards late Spring, April - May. The year however showed a marked increase in both paediatric and adult populations with numbers positive reaching (.% positivity) in the paediatrics and (.%) in the adult populations (positivity.%,.% in and respectively in paediatrics; positivity.% in both and in the adult population). In both paediatric and adult populations norovirus also showed a characteristic winter peak with numbers beginning to rise in October, peaking in January, remaining high through February and beginning to decline through March. With norovirus (Figure ), February 00 showed a significant increase in positivity in the adult population with positive (.% of the positives). However the overall norovirus positivity for the adult population remained stable over the three year period (.%,. and.% for 00-00, and respectively). Only the paediatric population was tested for Group F adenovirus and Astrovirus (Figure ). Adenovirus showed a consistent presence over the month period studied, with no seasonality obvious. The average monthly positive rate for

19 Page of Journal of Medical Virology adenovirus was approximately 0/month. Astrovirus showed an autumnal/winter seasonality, with numbers beginning to rise slightly early in September, peaking in November, and tailing off towards March. A number of mixed infections were detected, mainly a combination of rotavirus with either adenovirus, norovirus, or astrovirus, and on two occasions rotavirus with both adenovirus and norovirus (see Table III). The major occurrence of dual infections was in with rotavirus and adenovirus. This was an exceptionally high year for rotavirus positivity in the paediatric population. The inhibition rate was seen to be.% for Multiplex and.0% for Multiplex. In the majority of cases inhibition was overcome via a single freeze-thaw cycle and reextraction. 0

20 Journal of Medical Virology Page of Discussion The gel-based nested multiplex assay [O Neill et al., 00] has been replaced by the two TaqMan single-round real-time multiplex assays as a regional service. Turnaround time has been reduced to same-day, or ultimately under hours from specimen receipt to result issue. Approximately,00 faecal samples have been processed annually in these assays from (, in total). Multiplex was designed specifically to target norovirus and rotavirus, viruses of particular clinical significance in gastroenteritis outbeaks where rapid result turn-around time has a direct effect on patient management and infection control [Cunliffe et al, 00; Gallimore et al., 00]. These viruses are also extremely important in sporadic cases of gastroenteritis, often leading to hospitalisation in the very young. Multiplex specifically targets group F adenovirus and astrovirus, and is only used for the paediatric population. These viral infections mostly occur in childhood and confer immunity against reinfection which accounts for the absence of these viruses in the adult population [Anderson, 00; Elliott, 00; Tran et al, 00]. Another gastroenteritis virus, Sapovirus, belonging to the Caliciviridae family is known to cause infections in the very young with a prevalence similar to astrovirus and will be added to the testing schedule in the near future [Svraka et al., van Maarseveen et al., 00]. This is the first report of a probe based diagnostic assay targeting the rotavirus VP gene. Due to the extreme genetic variability of rotavirus, choice of target regions is limited, and in selecting VP as the target gene, 00 nucleotides at the end represented the optimal choice to allow maximal detection of different isolates. Norovirus GI and GII are not distinguished routinely in our current diagnostic setting, although for the purposes of assay validation an alternative TAMRA-BHQ probe was used with equal sensitivity and specificity as the FAM-TAMRA probes to differentiate between the genogroups (see Table I). Rotavirus is uniquely a dsrna virus and requires heat denaturation ( C/ min) prior to cdna synthesis. All nucleic acid extracts processed via Multiplex are subjected to heat denaturation, and while facilitating the detection of rotavirus, this does not alter the ability to detect the ssrna norvirus targets. Both assays for the detection of all four targets are run simultaneously on the LC0 II using a universal RT-TaqMan PCR thermocycling programme. Although the group F adenoviruses are DNA targets, this protocol does

21 Page of Journal of Medical Virology not affect sensitivity. The probe-based assays are continually monitored via in-house quality control systems and perform to an exceptionally high standard in on-going external quality control programmes (HPA EQ, NIBSC). Routine processing of the, specimens has generated valuable clinical and epidemiological data. The monthly distribution of the viruses was consistent over the three years, and demonstrated the seasonal incidence well, particularly with respect to norovirus and rotavirus. The norovirus outbreaks tend to establish earlier in the year than rotavirus, with January and February high months for both viruses. Winter seasonality is well established and is not reflective of enhanced testing as an outbreak protocol ensures no more than six positive specimens in any outbreak are processed. The rise in the number of positive norovirus results (n=) seen in February 00 in the adult population (see Figure ) did not continue as the March 00 figures (not part of the study time period) showed a drop back to n=. The rotavirus positives detected in the adult specimens are most likely due to re-emergence of susceptibility in the elderly population [Feeney et al., 00]. This testing algorithm is qualitative although interpretation of real time C T values lends itself to semi-quantitation with a low C T value indicating a higher viral load, but the clinical significance of C T interpretation needs to be better established. Prolonged viral shedding, particularly with norovirus, post-acute infection was seen with a rising C T value in follow-up samples. C T values in follow-up samples can also indicate dual infection due to an overlap in infection with one virus followed by a second virus infection, rather than multiple infections at the one time. Viral gastroenteritis in the developing world is associated with an immense disease burden and a high mortality rate. In developed countries viral gastroenteritis has low mortality rates but morbidity and economic consequences are significant. These onestep probe-based RT-PCR assays have improved turn-around-time significantly, are ultra sensitive and are potentially quantitative. In the high through-put diagnostic setting this rapid, quality-assured testing enables efficient and economic service delivery.

22 Journal of Medical Virology Page 0 of References Anderson EJ, 00. Prevention and treatment of viral diarrhea in pediatrics. Expert Rev Anti Infect Ther : 0-. Banyai K, Martella V, Meleg E, Kisfali P, Peterfi Z, Benko M, Melegh B, Szu G. 00. Searching for HAdV-, the putative gastroenteritis-associated human adenovirus serotype in Southern Hungary. New Microbiologia : -. Cunliffe N.A., Booth JA, Elliot C, Lowe SJ, Sopwith W, Kitchin N, Nakagomi O, Nakagomi T, Hart CA, Regan M. 00. Healthcare-associated viral gastroenteritis among children in a large pediatric hospital, United Kingdom. Emerg Infect Dis : -. Elliott EJ. 00. Acute gastroenteritis in children. BMJ : -0. Estes MK, Kapikian A. 00. Rotaviruses. Fields Virology th Edition: -., Mitchell SJ, Mitchell F, Wyatt DE, Fairley D, McCaughey C, Coyle PV, O Neill HJ. 00. Association with the G rotavirus with gastroenteritis in adults. J Med Virol : -. Gallimore CI, Taylor C, Gennery AR, Cant AJ, Galloway A, Xerry J, Adigwe J, Gray JJ. 00. Contamination of the hospital environment with gastroenteric viruses: comparison of two paediatric wards over a winter season. J Clin Microbiol : -. Glass RI, Parashar UD, Estes MK. 00. Norovirus gastroenteritis. N Engl J Med : -. Gray J, Vesikari T, Van Damme P, Giaquinto C, Mrukowicz J, Guarino A, Dagan R, Szajewska H, Usonis V. 00. Rotavirus. J Pediatr Gastroenterol Nutr : Sppl :S-. Greenberg HB, Estes MK. 00. Rotaviruses: from pathogenesis to vaccination. Gastroenterology : -. Guo L, Xu X, Song J, Wang W, Wang J, Hung T. 00. Molecular characterization of astrovirus infection in children with diarrhea in Beijing, J Med Virol : -. Rolfe KJ, Parmar S, Mururi D, Wreghitt TG, Jalal H, Zhang H, Curran MD. 00. An internally controlled, one-step, real-time RT-PCR assay for norovirus detection and genogrouping. J Clin Virol ; -. Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Takeda N, Katayama K. 00. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription PCR. J Clin Microbiol : -.

23 Page of Journal of Medical Virology La Rosa G, Pourshaban M, Laconelli M, Muscillo M. 00. Detection of genogroup IV noroviruses in environmental and clinical samples and partial sequencing through rapid amplification of cdna ends. Arch Virol : 0-0. Logan C, O Leary JJ, O Sullivan N. 00. Real-time reverse transcription-pcr for detection of rotavirus and adenovirus as causative agents of acute viral gastroenteritis in children. J Clin Microbiol : -. Logan C, O Leary JJ, O Sullivan N. 00. Real-time reverse transcription PCR detection of norovirus, sapovirus and astrovirus as causative agents of acute viral gastroenteritis. J Virol Methods : -. Lorgelly PK, Joshi D, Iturriza Gomara M, Flood C, Hughes CA, Dalrymple J, Gray J, Mugford M. 00. Infantile gastroenteritis in the community: a cost of illness study. Epidemiol Infect : -. Malasao R, Maneekarn N, Khamrin P, Pantip C, Tonusin S, Ushijima H, Peerakome S. 00. Genetic diversity of norovirus, sapovirus, and astrovirus isolated from children hospitalized with acute gastroenteritis in Chiang Mai, Thailand. J Med Virol 0: -. O Neill HJ, McCaughey C, Coyle PV, Wyatt DE, Mitchell F. 00. Clinical utility of nested multiplex RT-PCR for group F adenovirus, rotavirus and norwalk-like viruses in acute viral gastroenteritis in children. J Clin Virol : - Rodigues LC, Lordan G, Roberts J, Normand C, Higgins CD, Chady S, Tam CC. 00. The economic impact of gastroenteritis in the island of Ireland. Safe Food, The Food Safety promotion Board. Svraka S, Vennema H, van de Veer B, Hedlund KO, Thorhagen M, Siebenga J, Duizer E, Koopmans M. 00. Epidemiology and genotype of emerging sapovirusassociated infections across Europe. J Clin Microbiol : -. Tran A, Talmud D, Lejeune B, Jovenin N, Renois F, Payan C, Leveque N, Andreoletti L. 00. Prevalence of rotavirus, adenovirus, norovirus and astrovirus infections and coinfections among hospitalised children in northern France. J Clin Micro : -. van Maarseveen NM, Wessels E, de Brouer CS, Vossen AC, Claas EC 00. Diagnosis of viral gastroenteritis by simultaneous detection of Adenovirus group F, Astrovirus, Rotavirus group A, Norovirus genogroups I and II, and Sapovius in two internally controlled real-time PCR assays. J Clin Virol : 0-0. Walter JE, Mitchell DK, 000. Role of astroviruses in childhood diarrhea. Curr Opin in Pediatr : -. Wilhelmi I, Roman E, Sanchez-Fauquier A. 00. Viruses causing gastroenteritis. Clin Microbiol Infect : -.

24 Journal of Medical Virology Page of