A basic helix loop helix transcription factor controls cell growth

Size: px

Start display at page:

Download "A basic helix loop helix transcription factor controls cell growth"

Madeline Fields
5 years ago
Views:

1 A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability (low phosphate stress) induces the elongation of root hairs 1 and enhances the capture of phosphate for plant growth 2. Plants grown in medium containing 10 µm phosphate are considered to be subject to low phosphate stress and root hairs are longer (698 ± 6 µm) than on plants grown with an adequate supply of phosphate (1000 µm phosphate) which develop shorter root hairs (338 ± 6 µm). To demonstrate a requirement for RSL4 in the response to low phosphate, we compared root hair growth of rhd6-3 rsl1-1 double mutants and rhd6-3 rsl1-1 rsl4-1 triple mutants in low phosphate. Low phosphate induces the development of a few hairs in the rhd6-3 rsl1-1 mutant indicating that hairs could respond to the low phosphate growth stimulus. In contrast no hairs developed on the rhd6-3 rsl1-1 rsl4-1 triple mutant (Supplementary Fig. 8a). This indicates that RSL4 is required for the increase in root hair growth that occurs when roots are grown in low phosphate. Further support for the role of RSL4 comes from the observation that low phosphate stress did not induce growth in rsl2-1 rsl4-1 double mutant (Supplementary Fig. 8a). Together, these data indicate that RSL4 activity is required for the root hair growth response induced by low phosphate stress. To confirm that low phosphate stress controls growth by modulating RSL4 activity, we determined the RSL4 transcript and protein levels in roots grown under phosphate stress and

2 control conditions. The levels of RSL4 transcript were 2 to 3 times higher in plants grown in conditions where phosphate was in short supply compared to those grown in high phosphate, while the transcript level of RSL2 did not change (Supplementary Fig. 8b). Furthermore, the steady state levels of GFP-RSL4 protein increased under the low phosphate stress, while the levels of GFP-RSL2 remain unchanged (Supplementary Fig. 8c). To verify that the induction of RSL4 was due to low phosphate and not another stress, we examined RSL4 induction under low phosphate stress in plants with defective low phosphate stress root responses 3. LPR1 and LPR2 are multicopper oxidases involved in triggering the root response to low phosphate stress signal 3. The root hair response to low phosphate is partially repressed in the lpr1 lpr2 double mutant (a gift from Thierry Desnos, CEA Cadarache, France); wild type root hairs grown in low phosphate stress are 100% longer than wild type hairs grown in control conditions. In contrast, the root hairs of lpr1 lpr2 double mutants are only 40% longer in low phosphate than in high phosphate (lpr1 lpr2 HP: 350 ± 6 μm; lpr1 lpr2 LP: 489 ± 6 μm). As expected, the induction of RSL4 mrna by low phosphate stress is defective in the lpr1 lpr2 double mutant background (Supplementary Fig. 6b). These data indicate that low phosphate stress controls root hair length by modulating steady state levels of RSL4 transcript and protein and requires the phosphate signalling activity of LPR1 and LPR2. 1. Bates, T.R. & Lynch, J.P. Stimulation of root hair elongation in Arabidopsis thaliana by low phosphorus availability. Plant, Cell & Environment 19, (1996). 2. Bates, T.R. & Lynch, J.P. The efficiency of Arabidopsis thaliana (Brassicaceae) root hairs in phosphorus acquisition. Am.J.Bot. 87, (2000). 3. Svistoonoff, S. et al. Root tip contact with low-phosphate media reprograms plant root architecture. Nat Genet 39, (2007).

3 Supplementary Fig. 1

4 Supplementary Fig. 1 Expression pattern of RSL4. (a) The distribution of RSL4 protein partially overlaps with RHD6. From left to right are GFP-RSL4, mcherry-rhd6, overlay and bright field; (b) RSL4 mrna was only present in the roots (R). No detectable mrna transcript was present in the rosette leaf (RL), cauline leaf (CL) stem (St) and flower (F); (c) GUS in an RSL4 gene trap line (CSHL_GT13756 from Cold Spring Harbor Laboratory) was detected only in the root hair cells, not in any other tissues including shoots, leaves and flowers.

5 Supplementary Fig. 2 Supplementary Fig. 2 qrt-pcr analysis of RSL4 relative levels in the RSL4 RNAi lines. Values represent mean±s.d., n=3.

Supplementary Fig. 3 Supplementary Fig. 3: Constitutive of RSL4 results in constitutive growth until root hair cells undergo programmed cell death.

6 Supplementary Fig. 3 Supplementary Fig. 3: Constitutive of RSL4 results in constitutive growth until root hair cells undergo programmed cell death. (a) Root hair phenotype of Col-0 (left side) and a plant transformed with 35S:RSL4 (right side) grown in half strength Johnson media. (b) Gray scale pictures are DIC images of root hairs of Col-0 (left side) and 35S:RSL4 (right side). Colour images above each DIC image are pseudo colour of root hairs grown in half strength Johnson media with 10 nm Rhodamine 123 showing the mitochondrial membrane potential ( ψm). The ruler above indicates the fluorescent intensity of the pseudo colour images. The absence of fluorescence intensity is an indicator of cell death.

7 Supplementary Fig. 4 Supplementary Fig. 4 Morphologies of 35S::RSL4 plants. Wild type (left) and 35S::RSL4 (right) plants are morphologically identical except that the root hairs are much longer in the 35S::RSL4 plants.

8 Supplementary Fig. 5 Supplementary Fig. 5: Nuclear volume is the same in wild type and in plants transformed with 35S::RSL4. DAPI staining of Col-0 and plants transformed with 35S::RSL4 root hairs indicates that the nuclear size is the same in these two genotypes.

Supplementary Fig. 6 Supplementary Fig. 6: RSL2 regulates root hair tip growth. (a) Root hair morphology of Col-0 (the left panel) and rsl2-1 (the right panel).

9 Supplementary Fig. 6 Supplementary Fig. 6: RSL2 regulates root hair tip growth. (a) Root hair morphology of Col-0 (the left panel) and rsl2-1 (the right panel). (b) Root hair length distributions of Col-0 and rsl2-1. (c) GFP:RSL2 accumulates in initiating and growing root hair cells similarly to GFP:RSL4. (d) RSL2 is not a direct target of RHD6. qrt-pcr analysis of RNAs from rhd6-3 rsl1-1 harboring GR:RHD6 treated with DEX for 2h (open bar), 24h (black bar) and DEX/CHX for 2h (hatched bar).

10 Supplementary Fig. 7 Supplementary Fig. 7: RSL2 and RSL4 regulate root hair development. (a) Cryo-SEM images of Col-0 (left panel) and rsl2-1 rsl4-1 (right panel); (b) Genomic DNA fragments of RSL2 and RSL4 complement the rsl2 and rsl4 mutations.

11 Supplementary Fig. 8 Supplementary Fig. 8: Low phosphate stress modulates RSL4 to control hair cell growth. (a) Root hair morphologies of Col-0, rhd6-3 rsl1-1, rhd6-3 rsl1-1 rsl4-1 and rsl2-1 rsl4-1 under HP and LP treatments show that LP stress can induce root hair growth in Col-0 and rhd6-3 rsl1-1, but not in rhd6-3 rsl1-1 rsl4-1 and rsl2-1 rsl4-1. (b) qrt-pcr analysis of mrnas isolated from Col-0 and the lpr1 lpr2 double mutant under high phosphate and low phosphate treatments show that the induction of RSL4 transcripts by low phosphate stress is compromised in the lpr1 lpr2 double mutant background. Values represent mean±s.d., n=3. (c) Pseudo colour images of GFP:RSL2 (upper panel) and GFP:RSL4 (lower panel) under high phosphate and low phosphate treatments showing low phosphate stress induces the accumulation of RSL4 but not RSL2.

12 Supplementary Fig. 9 Supplementary Fig. 9 RSL4 positively regulates the of genes that promote growth in root hair cells. (a) Hierarchical clustering of the 83 genes positively regulated by RSL4. (b) qrt-pcr analysis of AtEXP7, MRH3 and MRH4 from mrnas isolated from plants with wild type levels of RSL4 (Col-0, rsl2-1), higher levels of RSL4 (35S::RSL4) or plants that lack RSL4 (rsl4-1 and rsl2-1 rsl4-1). These data show that RSL4 positively regulates AtEXP 7, MRH3 and MRH4. Values represent mean±s.d., n=3.

Supplementary Fig. 10 Supplementary Fig. 10 A working model showing that RSL4 integrates the internal and external signals to regulate root hair cell growth.

13 Supplementary Fig. 10 Supplementary Fig. 10 A working model showing that RSL4 integrates the internal and external signals to regulate root hair cell growth. The left diagram is a SEM picture of Arabidopsis primary root. The white dot line marks the area where RHD6 and RSL1 are expressed in the root hair cells, while the white line marks the area where RSL2 and RSL4 are expressed in the root hair cells. The partial overlapping of these two white lines indicates the slight overlapping of RHD6 with RSL2 and RSL4. The black arrows indicate the genetic relationships.

14 Supplementary Table 1 RSL4 positively regulated genes Probe Set ID Fold change (35S-RSL4 vs P.Value Fold change (Col-0 vs P.Value AGI Gene Symbol Related to root hair or not Col-0) rsl4-1) _at E E-08 AT1G27740 RSL _at E AT1G26420 FAD-binding domain-containing protein _at E-06 AT5G51870 AGL _at AT1G34330 putative peroxidase _at AT5G26080 proline-rich family protein _at AT4G28850 xyloglucan:xyloglucosyl transferase, putative _at AT1G34510 peroxidase, putative _at E AT1G12560 ATEXPA7 root hair _at E-05 AT1G30850 RHS4 root hair _at E AT1G34540 CYP94D _at AT5G22410 RHS18 root hair _at AT3G63380 calcium-transporting ATPase _at AT2G20520 FLA6

15 256352_at E-06 AT1G54970 RHS7/ATPRP1 root hair _at AT4G19680 IRT _at AT2G03980 GDSL-motif lipase/hydrolase family protein _at AT5G19790 RAP2.11 root hair _at AT5G67400 RHS19 root hair _at E AT4G25220 RHS15 root hair _at E-08 AT5G57530 xyloglucan:xyloglucosyl transferase, putative _at AT1G61080 proline-rich family protein _at AT3G10710 RHS12 root hair _s_at AT4G22080 /// AT4G22090 RHS14 root hair _s_at AT1G05240 /// peroxidase, putative

16 AT1G _at AT1G26250 proline-rich extensin, putative _at AT4G02270 RHS13 root hair _at E-05 AT4G25790 allergen V5/Tpx-1-related family protein _at AT3G60280 UCC _at AT5G61650 CYCP4; _at AT4G30320 allergen V5/Tpx-1-related family protein _at AT5G40860 unknown protein _at AT5G19800 hydroxyproline-rich glycoprotein family protein _at AT4G04900 RIC _at AT1G35330 zinc finger (C3HC4-type RING finger) family protein _at AT5G43580 Predicted to encode a PR peptide _at AT4G40090 AGP _at AT2G25240 serine-type endopeptidase inhibitor _at AT3G53150 UGT73D _at AT4G25820 XTR _at AT3G02240 unknown protein _at E-05 AT5G61350 protein kinase family protein _at AT1G05340 unknown protein

17 250683_x_at AT5G06640 proline-rich extensin-like family protein _at AT5G18910 protein kinase family protein _at AT1G16370 ATOCT _at E-06 AT5G57540 xyloglucan:xyloglucosyl transferase, putative _at AT2G29450 ATGSTU _at AT2G03720 MRH6 defective in root hair growth _at AT3G01175 unknown protein _at AT3G62680 PRP3 root hair _at AT4G03330 SYP123 root hair _at E AT1G62980 ATEXPA18 root hair _at AT5G24880 unknown protein _at AT1G59850 binding, biological process unknown _at AT5G23030 TET _at AT1G25240 epsin N-terminal homology (ENTH) domain-containing protein _at AT1G31750 proline-rich family protein _at AT1G34760 RHS5/GRF11 root hair

18 248441_at AT5G51270 protein kinase family protein _at AT4G34580 COW1 defective in root hair growth _at E-07 AT4G13390 proline-rich extensin-like family protein _s_at AT4G01820 PGP5 /// AT4G _at E-05 AT5G61550 protein kinase family protein _at E-05 AT2G46860 ATPPA _at AT1G14950 major latex protein-related / MLP-related _at AT5G03640 protein kinase family protein _at AT2G39690 unknown protein _at AT1G24030 protein kinase family protein _x_at AT4G08410 proline-rich extensin-like family protein _at AT3G12540 unknown protein _at AT1G21130 O-methyltransferase, putative _at AT1G30870 cationic peroxidase _at E-06 AT1G17180 ATGSTU _at AT1G63600 protein kinase-related _at AT1G22880 ATCEL _at AT1G51880 RHS6 root hair

19 255632_at AT4G00680 ADF8 root hair _at AT5G49700 DNA-binding protein-related _at E-05 AT3G07070 protein kinase family protein _at E-05 AT2G38500 unknown protein _at AT2G02990 RNS1 /// AT2G _at AT5G41730 protein kinase family protein _at E-05 AT5G07450 CYCP4; _at AT2G21880 AtRABG2

20 Supplementary Table 2 Primers used in this study rsl2-1 LB F: CTCGTCCCCAATGGAACAAAGGT rsl2-1 LB R: TAGCATCTGAATTTCATAACCAACTCGATACAC rsl2-1 homozygote F: CTCGTCCCCAATGGAACAAAGGT rsl2-1 homozygote R: CGAACGTGACTCTCCATTTCTCTCA rsl4-1 LB F: GGGAACCGGTATTTTTGTTCGG rsl4-1 LB R: TTGTAAGCCAATGGTGCGTACAT rsl4-1 homozygote F: GAAAGCTTCGGTCACAAGTGTTAAA rsl4-1 homozygote R: TTGTAAGCCAATGGTGCGTACAT 35SRSL4F(KpnI): cgg ggtacc ATGGACGTTTTTGTTGATGGT 35SRSL4R(BamHI): cgc ggatcc TCACATAAGCCGAGACAAAAG P RSL2 ::GFP:RSL2 GFPattB1F GGGG ACA AGT TTG TAC AAA AAA GCA GGC TCA ATG AGT AAA GGA GAA GAA CTT TTC

21 GFPattB2R GGGG AC CAC TTT GTA CAA GAA AGC TGG GTA TTT GTA TAG TTC ATC CAT GCC RSL2P_ATTB4F: GGGG ACA ACT TTG TAT AGA AAA GTT G tgc atg tca cct ttc ttt gc RSL2P _ATTB1R: GGGG AC TGC TTT TTT GTA CAA ACT TG a ttc tcc cat ggc ttc cat t RSL2:3 UTRATTB2F: GGGG ACA GCT TTC TTG TAC AAA GTG G gg agc aac aac ctc gga gga at RSL2:3 UTRATTB3R: GGGG AC AAC TTT GTA TAA TAA AGT TG g cca ctt tta aat gct ttg gac P RSL4 ::GFP:RSL4 RSL4P_ATTB4F: GGGG ACA ACT TTG TAT AGA AAA GTT G at acg cgt tgg gct taa atg RSL4P _ATTB1R: GGGG AC TGC TTT TTT GTA CAA ACT TG c aaa aac gtc cat cgc tct RSL4:3 UTRATTB2F: GGGG ACA GCT TTC TTG TAC AAA GTG G tg gac gtt ttt gtt gat ggt RSL4:3 UTRATTB3R: GGGG AC AAC TTT GTA TAA TAA AGT TG acgatacggtttggtttgactaat P RHD6 ::mcherry:rhd6 mcherryattb1f GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTA atg gtg agc aag ggc gag ga mcherryattb2r GGGG AC CAC TTT GTA CAA GAA AGC TGG GT A CTT GTA CAG CTC GTC CAT GCC G

22 RHD6P_ATTB4F GGGG ACA ACT TTG TAT AGA AAA GTT Gtt ctc aaa gag gga caa gac caa agc cca tga c RHD6P_ATTB1R GGGG AC TGC TTT TTT GTA CAA ACT TGc tag aca cta ata agt ttg ata agt gat ttt ttg t RHD6:3 UTRATTB2F GGGG ACA GCT TTC TTG TAC AAA GTG Gcc atg gca ctc gtt aat gac cat ccc aac gag a RHD6:3 UTRATTB3R GGGG AC AAC TTT GTA TAA TAA AGT TGc tga taa atc gag atc tta ggt atg tcg tcc GR ATTB1F GGGG ACA AGT TTG TAC AAA AAA GCA GGC T CT ATG GAT CCT GAA GCT CGA AAA ACA AA GR ATTB2R GGGG AC CAC TTT GTA CAA GAA AGC TGG GTT TTT TTG ATG AAA CAG AAG CTT TTT G RSL2 genomic DNA RSL2genomicUATTB1: GGGG ACA AGT TTG TAC AAA AAA GCA GGC T tgcatgtcacctttctttgc RSL2genomicLATTB2: GGGG AC CAC TTT GTA CAA GAA AGC TGG GT gccacttttaaatgctttggac RSL4 genomic DNA RSL4genomicUATTB1: GGGG ACA AGT TTG TAC AAA AAA GCA GGC T at acg cgt tgg gct taa atg RSL4genomicLATTB2: GGGG AC CAC TTT GTA CAA GAA AGC TGG GT acgatacggtttggtttgactaat

23 qrt-pcr primers RSL2-F RSL2-R RSL4-F RSL4-R AtEXP7-F AtEXP7-R MRH3-pair1-F MRH3-pair1-R MRH4-pair1-F MRH4-pair1-R EF1α -F EF1α -R TCCCCAATGGAACAAAGGTC TCTCGGTGAGCTGAGACCAA GTGCCAAACGGGACAAAAGT TTGTGATGGAACCCCATGTC ATCCCAGTTGCATACCGAAG TATCCAATTCGTCCGGCTAC GATGACCTAGACCACCACTAT GCCTTCAATTCCAGGACTTGAC CGAGGGTTGGCTCTGTCC GGTGGTGATTGTTGTGTTGAC GGTGGTGGCATCCATCTTGTTACA TGAGCACGCTCTTCTTGCTTTCA

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons