Toolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi

Transcription

1 Toolkit for evluting genes required for prolifertion nd survivl using tetryline-regulted RNAi Johnnes Zuer,5, Ktherine MJunkin,,5, Christof Fellmnn,4, Luks E Dow, Meredith J Tylor, Gregory J Hnnon 3 & Sott W Lowe 3 Nture Ameri, In. All rights reserved. Short hirpin RNAs (shrnas) re verstile tools for nlyzing loss-of-funtion phenotypes in vitro nd in vivo. However, their use for studying genes involved in prolifertion nd survivl, whih re potentil therpeuti trgets in ner nd other diseses, is onfounded y the strong seletive dvntge of ells in whih shrna expression is ineffiient. We therefore developed toolkit tht omines Tet-regulted mir3- shrna tehnology, roust trnstivtor expression nd two fluoresent reporters to trk nd isolte ells with potent trget knokdown. We demonstrted tht this system improves the study of essentil genes nd ws suffiiently roust to erdite ggressive ner in mie y suppressing single gene. Further, we pplied this system for in vivo negtiveseletion sreening with pooled shrnas nd propose stremlined, inexpensive workflow tht will filitte the use of RNA interferene (RNAi) for the identifition nd evlution of essentil therpeuti trgets. RNAi tehnologies enle speifi suppression of the expression of ny gene through onserved ellulr mhinery. shrnas n e expressed from DNA-sed vetors integrted into the genome 3,4, thus enling the study of stle loss-of-funtion phenotypes in vitro or in mouse models 5,6. Geneti sreens using foused or genome-wide shrna lirries n identify puttive therpeuti trgets for exmple, y identifying genes tht re seletively required for the prolifertion or survivl of ner ells 7. A prtiulrly useful pproh to evlute suh genes is Tet-On RNAi, whih uses two-omponent onditionl expression system tht requires reverse tetryline trnstivtor (rtta) nd tetryline-responsive element (TRE) promoter driving shrna expression 6,,. In this system, shrna expression is indued y doxyyline, enling synhronous nd reversile gene knokdown in estlished ell popultions. Thus, in niml models, trget inhiition n e triggered trnsiently fter disese mnifesttion, therey mimiking intervention with trgeted therpeuti. Despite the power of RNAi tehnology, tehnil hllenges remin. Unlike onventionl or onditionl gene deletion, RNAi-sed lossof-funtion studies rely on strong shrna expression throughout the experiment. In virl vetor systems, n unfvorle provirl integrtion site n prevent shrna expression through promoter interferene, epigeneti silening or other inhiitory effets 3 6. Additionlly, genomi instility n result in rndom deletion of provirl trnsgenes. Although suh events might e rre, their olletive impt is most signifint when n shrna trgets gene essentil for ell survivl or prolifertion. Here, even few ells tht fil to express the shrna will outompete those in whih RNAi is effetive nd therey msk the phenotype of gene knokdown. To ddress these limittions, we designed n induile shrna expression system tht enles preise trking of retrovirl trnsdution nd shrna indution through two fluoresent reporters. TRE-dsRed-miR3/shRNA-PGK-Venus-IRES-NeoR (TRMPV) produes two trnsripts (Fig. ): when tive, the TRE drives expression of dsred fluoresent protein nd mirorna (mir)- emedded shrna 6, wheres the phosphoglyerte kinse (PGK) promoter drives onstitutive expression of oth the yellow-green fluoresent protein Venus nd, using n internl riosoml entry site (IRES), the neomyin resistne gene (NeoR). Aville vrints of TRMPV feture lterntive drug seletion mrkers, lterntive fluoresent proteins nd/or n improved TRE with redued sl tivity (TRE tight ) 7 (Supplementry Fig. ). To evlute the utility of this vetor for studying genes required for prolifertion, we hose to trget Replition Protein A, suunit 3 (), n essentil ftor for DNA replition whose knokdown uses ell yle rrest in dividing ells 8. As neutrl ontrol, we used n shrna trgeting ill luiferse (sh, Supplementry Fig.,). In immortlized Ros6-rtTA-M (ref. 9) mouse emryoni firolsts (MEFs), TRMPV vetors ontining shrnas effetively knoked down in the presene of doxyyline (Fig. nd Supplementry Fig.,d). As expeted, trnsdued ells onstitutively expressed only Venus, wheres doxyyline tretment used strong, reversile indution of TRE-driven dsred in most ells (Fig. nd Supplementry Fig. e). Therefore, shrna-expressing ells n e identified s doule positive (Venus + dsred + ) popultion. To determine whether TRMPV ould trk the depletion of ells expressing ntiprolifertive shrnas within popultion, we performed ompetitive prolifertion ssy y mixing untrnsdued nd TRMPV-trnsdued ells nd quntifying the perentge of eh popultion over time. As expeted, Venus + dsred + ells were mintined in ontrol sh (Fig. ) ut depleted in sh ultures on doxyyline, Cold Spring Hror Lortory, Cold Spring Hror, New York, USA. Wtson Shool of Biologil Sienes, Cold Spring Hror, New York, USA. 3 Howrd Hughes Medil Institute, Cold Spring Hror, New York, USA. 4 Institute of Moleulr Life Sienes, University of Zurih, Zurih, Switzerlnd. 5 These uthors ontriuted eqully to this work. Correspondene should e ddressed to S.W.L. (lowe@shl.edu). Reeived July; epted 3 Novemer; pulished online 5 Deemer ; doi:.38/nt.7 nture iotehnology VOLUME 9 NUMBER JANUARY 79

2 Nture Ameri, In. All rights reserved. Figure Dul-olor TRMPV vetors enle Tetregulted shrna expression for suppression of genes involved in ell prolifertion nd survivl. () Vetor shemti of TRMPV, whih ws onstruted in the pqcxix self-intivting (SIN) retrovirl kone. Ψ+, extended retrovirl pkging signl. () Western lot of immortlized Ros6-rtTA-M MEFs trnsdued with TRMPV hroring different shrnas (numered y strt position) or ill luiferse () shrna. After seletion, ells were ultured in the presene or sene of doxyyline for 4 d efore olletion. β-tin served s loding ontrol. Unropped lots re shown in Supplementry Figure d. () Representtive flow ytometry plots of Ros6-rtTA-M MEFs trnsdued with TRMPV.sh.73 nd TRMPV. sh.455 in ompetitive prolifertion ssys. Cells seleted for TRMPV were mixed with untrnsdued ells nd pssged in doxyyline for 6 d. (d) Quntifition of fluoresent ells in representtive ompetitive prolifertion ssys. Eh series of rs is time ourse from left to right: dy, 4, 8,, 6,. In ll series, dy r represents perentge Venus-positive ells efore doxyyline tretment. In the presene of doxyyline, trnsdued ells were gted either on Venus or on oth Venus nd dsred. (e) Vetor shemti of TRMPVIR showing onstitutive nd induile trnsripts produed y the vetor. s untrnsdued Venus dsred ells umulted. A popultion of Venus + dsred ells lso expnded in sh ultures, refleting the umultion of lones tht fil to indue TRE expression owing to preexisting positionl effets or n tive silening proess. Regrdless of the use, these lones lk shrna indution, llowing them to evde ell yle rrest in the presene of doxyyline. This phenomenon, whih we hve oserved in wide vriety of rtta-expressing ell types, highlights the vlue of linking fluoresent reporter tightly to shrna expression. Aordingly, when we quntified sh-trnsdued ells over time using only the onstitutive Venus reporter, we oserved moderte depletion (Fig. d). In ontrst, when quntifying Venus + dsred + ells, we oserved muh more sustntil depletion, whih ws gretest for the most potent shrnas (sh.455 nd sh.56) (Fig.,d nd Supplementry Fig. ). Thus, TRMPV provides sensitive tool to ssess inhiitory effets of shrna expression on ell prolifertion. Next, we imed to use TRMPV to ssess ntiprolifertive phenotypes in ner ells, dynmi setting where the potentil outgrowth of lones tht espe shrna indution presents mjor onern. In the two-omponent Tet-On system, espe n our either y n effet on the TRE lous itself or y insuffiient rtta expression. To minimize rtta-relted filure, we oneived two strtegies to ensure strong, sustined rtta expression in every ell. First, for mouse models driven y onogeni trnsgenes, we hypothesized tht linking the rtta to the onogene in iistroni trnsript would selet for strong rtta expression sed on the prolifertive dvntge onferred y the onogene. Furthermore, onogene ddition (reviewed in ref. ) would ensure mintined rtta expression throughout the experiment. We evluted this strtegy in mouse model of ute myeloid leukemi (AML) indued y oexpression of humn mixed-linege leukemi d Fluoresent ells (%) e TRMPV shrna TRMPVIR Constitutive SIN Ψ+ TRE dsred mir3 PGK Venus IRES NeoR + dox Venus IRES rtta3 rtta3 shrna SIN Ψ+ TRE dsred PGK Venus IRES rtta3 shrna mir3 Dox Positive + feedk dsred IRES rtta3 mir3 β-tin Indued log Venus f Dy Dy Dy 6 Dy Dy Dy log dsred Off dox (Venus + ) On dox (Venus + ) On dox (Venus + dsred + ) log dsred log Venus IRES-dependent rtta3 expression from the induile trnsript retes positive feedk loop of TRE indution. (f) Representtive flow ytometry plots of Eµ-my;Trp53 / lymphom ells trnsdued with TRMPVIR.sh.73 nd TRMPVIR.sh.455 in ompetitive prolifertion ssys over d. Cells were inompletely trnsdued with TRMPVIR efore dy (rther thn seleted nd dmixed with untrnsdued ells). (g) Quntifition of fluoresent ells in representtive ompetitive prolifertion ssys. Eh series of rs is time ourse from left to right: dy,, 4, 6, 8, ; see d for detils. fusion gene (MLL-AF9; AF9 lso known s MLLT3) nd mouse Nrs GD. To generte n onogene-linked Tet-On-ompetent model, we designed retrovirus expressing MLL-AF9 in iistroni trnsript downstrem of n optimized rtta (rtta3), wheres Nrs GD ws oexpressed with firefly luiferse (Lui) to enle disese monitoring y ioluminesene imging. Hemtopoieti stem nd progenitor ells were otrnsdued with rtta3-ires-mll-af9 nd Lui-IRES-Nrs GD nd trnsplnted into reipient mie, whih developed ggressive AML (Supplementry Fig. 3). Leukemi ells were olleted from moriund mie, trnsdued with TRMPV vetors nd nlyzed in ompetitive prolifertion ssys. As in MEFs, sh indution led to effiient depletion of Venus + dsred + ells nd n outgrowth of untrnsdued nd Venus + dsred ells (Supplementry Fig. 4). Therefore, onogene-linked rtta vetors n generte genetilly defined mouse models suitle for hrterizing genes required for prolifertion or survivl. We lso developed strtegy to enfore rtta expression in systems where onogene linkge is not n option for exmple, in nonner settings or estlished humn ner ell lines. We designed dulolor onstrut tht delivers oth TRE-driven shrna nd rtta in single retrovirl vetor (TRE-dsRed-miR3/shRNA-PGK-Venus-IRESrtTA3, or TRMPVIR; Fig. e). In this onstrut, the PGK promoter drives onstitutive expression of Venus nd sl levels of rtta. In the presene of doxyyline, the tivted TRE promoter indues strong expression of trnsript ontining the dsred-shrna ssette nd, further downstrem, rtta3, whose trnsltion is initited through the IRES. Thus, in the indued stte, this onfigurtion is predited to generte positive feedk loop tht produes more rtta from the TRE trnsript, ensuring roust tivity of the Tet-On system. To test this vetor, we trnsdued n estlished mouse Eµ-my;Trp53 / lymphom ell line with TRMPVIR-sh or sh. Doxyyline g Fluoresent ells (%) VOLUME 9 NUMBER JANUARY nture iotehnology

3 Nture Ameri, In. All rights reserved. Figure TRMPV enles RNAi-sed evlution of genes involved in tumor mintenne in vivo. () Shemti of the genertion nd pplition of Tet-On-ompetent mouse model of leukemi. Hemtopoieti stem nd progenitor ells (HSPC, Cd45. + ) re trnsdued with retroviruses tht oexpress onogenes, rtta3 nd firefly luiferse nd susequently trnsplnted into reipient mie. Resulting Tet-On leukemis re olleted, trnsdued with TRMPV, seleted nd retrnsplnted into seondry Cd45. + reipients. After leukemi onset, shrnas re indued y doxyyline nd effets nlyzed using different redouts. () Representtive ioluminesene imging of reipient mie trnsplnted with TRMPV-trnsdued AML ells. Mie were treted with doxyyline t disese onset (dy ). () Kpln-Meier survivl urve of reipient mie of AML ells trnsdued with indited TRMPV shrnas. Mie were treted with doxyyline t disese onset s ssyed y imging (7 d fter trnsplnttion). (d) Representtive flow ytometry plots of donor-derived (Cd45. + ) ells in one mrrow of moriund doxyyline-treted mie in. (e) Quntifition of Venus + dsred + ells in Cd45. + one mrrow ells olleted from doxyyline-treted reipient mie (n = 4) t terminl disese stge. Men nd s.e.m. re plotted. tretment led to strong indution of dsred expression, nd Venus + dsred + sh-expressing ells were outompeted y untrnsdued nd Venus + dsred ells, wheres sh-expressing ells were mintined over time (Fig. f). Agin, quntifition of Venus + dsred + Iog dsred ells provided more sensitive ssessment of deleterious shrna effets thn Venus lone (Fig. g). In summry, oth the TRMPVIR vetor nd onogene linkge of rtta re effetive strtegies to provide roust rtta expression nd therey filitte the evlution of Tet-regulted shrnas. To determine whether TRMPV ould e used to hrterize genes required for tumor mintenne in vivo, we trnsdued Tet-On-ompetent MLL-AF9;Nrs GD AML ells with sh or shrnas of three different potenies. Drug-seleted ells were trnsplnted into B6.SJL (Cd45. + ) reipient mie (Fig. ), whih llowed trnsplnt tring using Cd45.- speifi ntiodies. Mie were monitored for leukemi y ioluminesene imging (Fig. ) nd treted with doxyyline upon leukemi onset. Mie suumed to disese in ~7 d when sh or the wek sh.53 ws expressed, wheres the intermedite sh.76 or strong sh.455 delyed disese progression nd onferred signifint survivl dvntge (Fig.,). Nevertheless, even mie tht initilly responded eventully relpsed nd suumed to disese. At terminl disese stge, we nlyzed Cd45. + leukemi infiltrtes in one mrrow y flow ytometry. All TRMPV-sh leukemis were strongly positive for oth dsred nd Venus (Fig. d,e). Notly, ll relpses of doxyyline-treted leukemis hroring sh.76 or sh.455 showed strong depletion of dsred-positive ells nd n outgrowth of Venus + dsred or doule-negtive lones tht hd evded shrna expression, presumly owing to silening or loss of the TRE ssette or the entire provirus, respetively (Fig. d,e). Expression of the wek sh.53, whih used depletion in vitro (Fig. d), hd no signifint effet on the frequeny of Venus + dsred + ells in vivo, suggesting tht this setting requires more potent shrnas to detet the effets of suppression. Overll, these results illustrte how the ility to quntify shrnaexpressing ells t n dvned disese stge provides rpid nd sensitive strtegy to detet inhiitory RNAi-medited phenotypes in vivo. HSPC Cd45. Dy Dy 9 Dy 4 d Iog Venus rtta3 Luiferse 3.53 MLL-AF9 Nrs GD Syngenei reipient.73 TRE dsred Leukemi onset.455 shrna mir3 PGK TRMPV trnsdution & seletion.455 Survivl (%) 3 3 Venus IRES NeoR Cd45. Syngenei reipient Strt dox We hypothesized tht TRMPV would help to identify nd isolte lones tht homogeneously indue TRE expression. Clonl TRMPVtrnsdued MLL-AF9;Nrs GD popultions eh showed homogeneous levels of onstitutive Venus expression (Supplementry Fig. 5). After doxyyline tretment, the levels of dsred fluoresene indued vried sustntilly etween lones, with some showing no indution (Supplementry Fig. 5). Hene, TRMPV filittes the seletion of pure lonl popultions ple of strong shrna indution. We trnsplnted seleted lonl TRMPV-sh.455 leukemis into reipient mie, whih were either left untreted, treted with doxyyline upon disese onset or treted t n dvned disese stge (Fig. 3). After erly or lte doxyyline tretment, sh indution used rpid disese regression, even in mie showing wsting from dvned leukemi. Histology showed lerne of leukemi lsts from one mrrow, spleen nd liver within 4 d (Fig. 3 nd Supplementry Fig. 5). All doxyyline-treted TRMPV-sh mie hieved omplete disese remission, wheres untreted TRMPVsh mie nd reipients of lonl TRMPV-sh ontrol leukemis (treted or untreted) died rpidly (Fig. 3). When relpse ourred in doxyyline-treted TRMPV-sh mie, imging reveled tht the disese typilly expnded from fol one mrrow infiltrte, suggesting the growth of resistnt ell lone. Indeed, ll relpse leukemis were dsred-negtive (dt not shown). Notly, 75% of doxyylinetreted TRMPV-sh mie remined helthy with no detetle luiferse signl during weeks of follow-up even when doxyyline ws withdrwn fter 4 d of tretment (Fig. 3). Thus, we hve estlished roust system to identify genes tht re essentil for the mintenne nd progression of ners in mie. We resoned tht the fetures of TRMPV might lso filitte multiplexed RNAi sreening to identify genes required for disese e Dys fter trnsplnttion shrna + ells (%) Leukemi onset On Dox Off nture iotehnology VOLUME 9 NUMBER JANUARY 8

4 Nture Ameri, In. All rights reserved. Figure 3 TRMPV-indued suppression of ures lonl MLL-AF9;Nrs GD AML. () Bioluminesene imging of reipient mie of lonl MLL-AF9;Nrs GD AML hroring TRMPV.sh.455. After leukemi onset s ssyed y imging (dy ) mie were either left untreted (no dox), treted with doxyyline (erly dox) or treted t more dvned disese stge (lte dox). () Bone mrrow nd liver histology of untreted nd doxyylinetreted mie 4 d fter leukemi onset. Sle rs: µm for one mrrow, µm for liver. () Kpln-Meier survivl urve of reipient mie of lonl TRMPV.sh.455 or TRMPV. sh.73 leukemis. After disese onset s ssyed y ioluminesent imging (dy 7 fter trnsplnttion), mie were either left untreted (off dox) or treted with doxyyline for 4 d (on dox). No dox mintenne. In these pprohes, integrted proviruses serve s sequene tgs to identify shrnas tht re speifilly depleted (negtively seleted) from pooled lirry. We spiked the three most potent shrnas nd neutrl sh into lirry of 8 TRMPV shrnas (Supplementry Tle ). This pool ws trnsdued into Tet-On-ompetent MLL-AF9;Nrs GD AML ells under onditions tht predominntly result in single retrovirl integrtion per ell (Supplementry Fig. 6), nd trnsdued ells were susequently drug seleted. To red out shrna representtion, shrna ssettes were mplified from genomi DNA using hyrid primers tgged with Illumin dpters nd quntified y deep sequening. shrna representtion in lirries generted diretly fter drug seletion (T ) strongly orrelted with the originl plsmid pool, suggesting tht retrovirl trnsdution nd drug seletion did not ffet the lirry omposition (Fig. 4). To test the utility of TRMPV for negtive seletion sreens in vivo, 4 6 Venus + T ells were trnsplnted into reipient mie, whih were either left untreted or treted with doxyyline strting 4 d fter Figure 4 Pooled negtive seletion RNAi sreening in vivo detets sh depletion in MLL-AF9;Nrs GD AML. () Stter plot illustrting the orreltion of normlized reds per shrna etween the plsmid lirry nd trnsdued seleted leukemi ells efore trnsplnttion (T ); r, nonprmetri (Spermn) orreltion oeffiient. () Stter plot of normlized reds per shrna in T ells ompred to n untreted leukemi reipient mouse. () Stter plot of normlized reds per shrna in T ells ompred to verge reds in three untreted reipient mie. (d) Reltive undne of nd ill luiferse shrnas in leukemis isolted from untreted (off dox) nd doxyyline-treted (on dox) reipient mie, eh ompred to the initil representtion efore trnsplnttion (T ). Leukemis from doxyyline-treted mie were nlyzed oth without nd with purifition of shrna-expressing ells (Venus + dsred + ) efore DNA isoltion. (e) Reltive undne of ll 84 shrnas in Venus + dsred + -sorted leukemi ells from doxyyline-treted mie ompred to T ells. The men of normlized reds in Dy Dy 6 Dy 3 Dy Reds (plsmid lirry) d Erly dox Doxyyline tretment r = Reds (T ) Lte dox Survivl (%) Bone mrrow Liver Off dox Doxyyline tretment.73 off dox.73 on dox.455 off dox.455 on dox On dox (4d) Dys fter trnsplnttion trnsplnttion. AML ells were olleted from moriund leukemi mie 4 d fter injetion. In eh individul untreted mouse, >95% of the shrnas in the pool were deteted y deep sequening, nd the distriution of normlized sequene reds per shrna orrelted with the preinjetion (T ) popultion (Fig. 4 nd Supplementry Fig. 7). We resoned tht devitions from the input representtion my rise from leky shrna effets nd/or stohsti hnges in ell representtion during disese engrftment nd progression. Consistent with the ltter possiility, the orreltion etween T nd untreted leukemi smples ws sustntilly improved y verging red numers from three replite mie (Fig. 4, r =.74). Thus, the representtion of omplex shrna lirry n e mintined in vivo, nd nonspeifi hnges in shrna representtion during disese progression n e deonvoluted y omprison of replite mie. 6 Reds (one mouse) Off dox On dox On dox sorted e Reds/reds (T ) r = Reds (T ) 6 Men reds (three mie) r = shrnas Reds/reds (T ) Reds (T ) doxyyline-treted mie (n = 3) ws divided y normlized reds in T ells; shrnas re plotted ording to the resulting rtios in sending order. All three shrnas trgeting were mong the 5 most depleted shrnas, wheres neutrl sh.73 ws not ltered. 6 8 VOLUME 9 NUMBER JANUARY nture iotehnology

5 Nture Ameri, In. All rights reserved. In doxyyline-treted mie, ells hroring ntiprolifertive shrnas might evde shrna expression nd persist in the popultion, nd shrna ssettes mplified from these ells ould ontminte sequening lirries nd dmpen hnges in representtion. Indeed, we oserved sustntil frtion of Venus + dsred ells in doxyylinetreted mie (Supplementry Fig. 8). To determine whether eliminting suh noninduers would inrese the sensitivity of our redout, we isolted Venus + dsred + ells efore ssessing shrna representtion. All shrnas showed moderte depletion ompred to T vlues in lirries mplified from unsorted leukemi ells (rtios <., Fig. 4d), ut the detetle depletion ws inresed y four- to tenfold in lirries from sorted Venus + dsred + ells (rtios <.). All three shrnas were mong the top 5 depleted when ompring treted mie to either untreted mie or to T ells (Fig. 4e nd Supplementry Fig. 7,). These results provide evidene tht pooled in vivo RNAi sreens for genes involved in tumor mintenne re fesile. In ontrst to reent report using stly expressed shrnas, our induile system enles ute trget inhiition fter disese onset nd therey effetively models therpeuti intervention. Here we desrie toolkit tht filittes the use of RNAi for studying genes involved in ell prolifertion nd survivl n experimentl setting tht is omplited y lonl seletion ginst effiient RNAi. By oupling shrnas diretly to fluoresent reporter nd using roust trnstivtor systems, we produed the TRMPV system, whih enles the identifition, trking nd isoltion of only those ells tht produtively express n shrna. We show tht this feture filittes the study of tumor mintenne genes nd inreses the sensitivity of negtive seletion RNAi sreens. Indeed, y omining TRMPV-sed ell sorting with deep sequening s redout, we noted >5-fold depletion for ll three shrnas sustntil inrese in sensitivity over rtios oserved for negtively seleted shrnas using mirorry-sed pltforms (two- to tenfold) 9,3,4. A seond soure of flse negtives in RNAi sreens rises from the prevlene of nonfuntionl shrnas in lirries now ville 5. A reently developed method to identify potent shrnas in mssively prllel ssy (C.F., J.Z., G.J.H. & S.W.L. et l., unpulished dt) enles the prodution of prevlidted shrna lirries tht, when expressed from TRMPV, will represent widely pplile resoure. Our methods provide rpid pipeline for thorough vlidtion nd hrteriztion of genes enoding puttive drug trgets. Cndidte shrnas identified y high-throughput sreening n e quikly tested individully for deleterious effets in TRMPV ulk ssys. The most promising trgets n e further evluted using our lonl ssy for their role in tumor mintenne. Finlly, induile mir3-sed shrnas linked to fluoresent reporters hve een implemented in germline trnsgeni mie (P. Premsrirut, L.E.D., C. Miething, K.M., S.W.L. et l., unpulished dt), enling the study of trget inhiition in oth disesed nd norml tissues. Overll, these tehnologies delinete rtionl, inexpensive workflow to rigorously identify nd hrterize new therpeuti trgets. Methods Methods nd ny ssoited referenes re ville in the online version of the pper t Note: Supplementry informtion is ville on the Nture Biotehnology wesite. Aknowledgments We thnk R. Dikins nd C. Miething for disussions in setting up this system, s well s A. Lujmio, A. Rppport, M. Sorowski nd C. Vko for testing TRMPV in other models. We lso thnk Y. Dou (Univ. of Mihign) for providing humn MLL-AF9. We grtefully knowledge B. M nd S. Muller for exellent tehnil ssistne. We lso thnk E. Hodges, K. Chng, M. Rooks nd the MComie lortory for help with Solex sequening s well s A. Gordon for ioinformtis support. P. Moody nd T. Spener were of gret ssistne in flow ytometry. Finlly, we thnk S. Kogn for histology. This work ws supported y the Howrd Hughes Medil Institute, the Strr Foundtion nd the Don Monti Memoril Reserh Foundtion. J.Z. is the Andrew Seligson Memoril Fellow t Cold Spring Hror Lortory, nd K.M. is the Roert nd Teres Lindsy Fellow of the Wtson Shool of Biologil Sienes. L.E.D. is supported y n Overses Biomedil Reserh Fellowship of the Ntionl Helth nd Medil Reserh Counil of Austrli. AUTHOR CONTRIBUTIONS J.Z. nd K.M. designed nd performed experiments. C.F. nd L.E.D. ontriuted new regents nd performed experiments. M.J.T. mnged mouse monitoring nd husndry. G.J.H. nd S.W.L. supervised this projet. J.Z., K.M. nd S.W.L. wrote the pper. COMPETING FINANCIAL INTERESTS The uthors delre no ompeting finnil interests. Pulished online t Reprints nd permissions informtion is ville online t reprintsndpermissions/.. Mrtin, S.E. & Cplen, N.J. Applitions of RNA interferene in mmmlin systems. Annu. Rev. Genomis Hum. Genet. 8, 8 8 (7).. Hnnon, G.J. RNA interferene. Nture 48, 44 5 (). 3. Brummelkmp, T.R., Bernrds, R. & Agmi, R. A system for stle expression of short interfering RNAs in mmmlin ells. Siene 96, (). 4. Pddison, P.J., Cudy, A.A., Bernstein, E., Hnnon, G.J. & Conklin, D.S. Short hirpin RNAs (shrnas) indue sequene-speifi silening in mmmlin ells. Genes Dev. 6, (). 5. Hemnn, M.T. et l. An epi-lleli series of p53 hypomorphs reted y stle RNAi produes distint tumor phenotypes in vivo. Nt. Genet. 33, (3). 6. Dikins, R.A. et l. Proing tumor phenotypes using stle nd regulted syntheti mirorna preursors. Nt. Genet. 37, (5). 7. Brie, D.A. et l. Systemti RNA interferene revels tht onogeni KRAS-driven ners require TBK. Nture 46, 8 (9). 8. Luo, J. et l. A genome-wide RNAi sreen identifies multiple syntheti lethl intertions with the Rs onogene. Cell 37, (9). 9. Ngo, V.N. et l. A loss-of-funtion RNA interferene sreen for moleulr trgets in ner. Nture 44, 6 (6).. Sholl, C. et l. Syntheti lethl intertion etween onogeni KRAS dependeny nd STK33 suppression in humn ner ells. Cell 37, (9).. Stegmeier, F., Hu, G., Rikles, R.J., Hnnon, G.J. & Elledge, S.J. A lentivirl mirorna-sed system for single-opy polymerse II-regulted RNA interferene in mmmlin ells. Pro. Ntl. Ad. Si. USA, 3 37 (5).. Gossen, M. et l. Trnsriptionl tivtion y tetrylines in mmmlin ells. Siene 68, (995). 3. Lund, A.H., Duh, M. & Pedersen, F.S. Trnsriptionl silening of retrovirl vetors. J. Biomed. Si. 3, (996). 4. Ellis, J., Hott, A. & Rstegr, M. Retrovirus silening y n epigeneti TRIM. Cell 3, 3 4 (7). 5. Mrkstein, M., Pitsouli, C., Villlt, C., Celniker, S.E. & Perrimon, N. Exploiting position effets nd the gypsy retrovirus insultor to engineer preisely expressed trnsgenes. Nt. Genet. 4, (8). 6. Pikrt, M.J., Reills-Trg, F. & Felsenfeld, G. Loss of trnsriptionl tivity of trnsgene is ompnied y DNA methyltion nd histone deetyltion nd is prevented y insultors. Genes Dev., (998). 7. Agh-Mohmmdi, S. et l. Seond-genertion tetryline-regultle promoter: repositioned tet opertor elements optimize trnstivtor synergy while shorter miniml promoter offers tight sl lekiness. J. Gene Med. 6, (4). 8. Wold, M.S. Replition protein A: heterotrimeri, single-strnded DNA-inding protein required for eukryoti DNA metolism. Annu. Rev. Biohem. 66, 6 9 (997). 9. Hohedlinger, K., Ymd, Y., Berd, C. & Jenish, R. Etopi expression of Ot-4 loks progenitor-ell differentition nd uses dysplsi in epithelil tissues. Cell, (5).. Weinstein, I.B. Cner. Addition to onogenes the Ahilles hel of ner. Siene 97, ().. Ds, A.T. et l. Virl evolution s tool to improve the tetryline-regulted gene expression system. J. Biol. Chem. 79, (4).. Mehm, C.E., Ho, E.E., Durovsky, E., Gertler, F.B. & Hemnn, M.T. In vivo RNAi sreening identifies regultors of tin dynmis s key determinnts of lymphom progression. Nt. Genet. 4, (9). 3. Silv, J.M. et l. Profiling essentil genes in humn mmmry ells y multiplex RNAi sreening. Siene 39, 67 6 (8). 4. Shlh, M.R. et l. Cner prolifertion gene disovery through funtionl genomis. Siene 39, 6 64 (8). 5. Bssik, M.C. et l. Rpid retion nd quntittive monitoring of high overge shrna lirries. Nt. Methods 6, (9). nture iotehnology VOLUME 9 NUMBER JANUARY 83

6 Nture Ameri, In. All rights reserved. ONLINE METHODS Retrovirl vetors nd shrnas. TRMPV (TRE-dsRed-miR3/shRNA-PGK- Venus-IRES-NeoR) nd its vrints (Supplementry Fig. ) were onstruted sed on psin-tre-pig 6 in the pqcxix self-intivting retrovirl kone (Clonteh). Using stndrd loning tehniques, we inserted dsred (from pdsred, Clonteh) nd the mir3 ontext downstrem of the TRE promoter nd repled PGK-PuroR-IRES-GFP stepwise with PGK-Venus-IRES-NeoR ssette using frgments from MSCVneo (Clonteh) nd pslik 6. In vrints, we hnged TRE to TRE-tight (from ptre-tight, Clonteh), dsred to Turo-RFP (from TRIPZ, Open Biosystems) nd NeoR to HygroR (from pmscvhyg, Clonteh, fter destroying the EoRI site in HygroR using Quik- Chnge mutgenesis, Strtgene). To onstrut TRMPVIR, we repled NeoR y rtta3 (ref. ) (mplified from pslik 6 ). MSCV-rtTA3-IRES-MLL-AF9 ws onstruted y sequentilly loning humn MLL-AF9 DNA (provided y Yli Dou, University of Mihign) nd n rtta3-ires ssette into n empty MSCV kone (Clonteh). Pling rtta upstrem of the IRES generlly produed more roust rtta expression tht ws less ffeted y the nture of the oexpressed onogene thn in the reverse orienttion. Lui- IRES-Nrs GD hs een desried previously 7. Detiled loning strtegies nd primer sequenes re ville on request. All vetors re ville upon request; vetor sequenes n e otined through GenBnk (ession numers in Supplementry Fig. ). mir3-shrnas were designed y dpting BIOPREDsi 8 smll interfering RNA preditions, exept for.455 (lone VMM_478, Open Biosystems) nd for.56, whih ws identified using sensor ssy for highthroughput shrna evlution (C.F., J.Z., G.J.H., S.W.L. et l., unpulished dt). shrnas were designted y the numer of the first nuleotide of the -nt trget site in the mrna trnsript t the time of design; for shrna sequenes, see Supplementry Tle. shrnas were loned into the mir3 ontext s 6-nt XhoI EoRI frgments, whih were generted y mplifying 97-mer oligonuleotides (Sigm-Aldrih) using 5 mir3-xhoi (TACAATACTCGA GAAGGTATATTGCTGTTGACAGTGAGCG) nd 3 mir3-eori (ACTT AGAAGAATTCCGAGGCAGTAGGCA) primers nd the Pltinum Pfx kit (Invitrogen) with the following onditions: 5 µl retion ontining.5 ng oligonuleotide templte, Pfx uffer, mm MgSO 4,.3 mm of eh dntp,.8 µm of eh primer, nd.5 U Pfx polymerse; yling: 94 C for min; 33 yles of 94 C for 5 s, 54 C for 3 s nd 68 C for 5 s; 68 C for 5 min. A ustomized shrna lirry trgeting seleted mouse genes ws designed sed on BIOPREDsi preditions nd generted y loning omplex pool of oligonuleotides synthesized on 55k ustomized rrys (Agilent Tehnologies) followed y lrge-sle pillry sequening of individul lones. A pool of 84 shrnas ws ssemled y omining plsmid DNA of 8 sequene-verified lones nd dding ill luiferse nd three potent ontrol shrnas t equimolr onentrtions. Cell ulture, retrovirl trnsdution nd ompetitive prolifertion ssys. Ros6-rtTA-M MEFs were isolted from Ros6-rtTA-M trnsgeni mie 9 nd immortlized y infetion with lentivirus expressing CMVdriven SV4 lrge T ntigen. To ensure homogeneous presene of the trnsgeni PuroR-ontining rtta-m llele, MEFs were seleted with puromyin (.5 µg ml, Sigm-Aldrih) efore experimentl use. MLL-AF9;Nrs GD leukemi ells were ultured in RPMI 64 (Gio-Invitrogen) supplemented with % FBS, U ml peniillin nd µg ml streptomyin t 37 C with 7.5% CO. Eµ-my;Trp53 / lymphom ells were ultured in 45% DMEM, 45% IMDM (Gio-Invitrogen), % FBS, 4 mm l-glutmine, 5 µm β-merptoethnol, U ml peniillin nd µg ml streptomyin t 37 C with 7.5% CO. Retrovirl onstruts were trnsfeted into HEK93T Phoenix pkging ells s previously desried 9 ; hloroquine (5 µm, Sigm-Aldrih) ws dded to enhne plsmid stility. Trnsdutions of leukemi nd lymphom ells were performed in six-well pltes. The medium ws removed exept for ~.5 ml ontining.5 6 suspension ells, nd.5 ml fresh virus-ontining superntnt supplemented with Polyrene (4 µg ml, Sigm-Aldrih) ws dded; pltes were then entrifuged for 5 min t 55g. Effiieny of retrovirl trnsdution ws ssessed 48 h fter infetion y flow ytometry (EsyCyte, Guv Tehnologies). Drug seletion of TRMPV-trnsdued MEFs nd AML ells ws onduted using mg ml G48 (Genetiin, Gio-Invitrogen). To indue shrna expression, doxyyline (Sigm-Aldrih) ws dded t finl onentrtions of µg ml for leukemi nd lymphom ells nd µg ml for MEFs. To nlyze shrna effets on prolifertion nd survivl in ulk popultions, TRMPV-trnsdued ells were dmixed with untrnsdued ells nd ultured in the sene or presene of doxyyline. Venus nd dsred fluoresene were quntified on n EsyCyte (Guv Tehnologies) or LSR-II (BD Biosienes) flow ytometer. Single-ell-derived popultions of TRMPV-trnsdued AML ells were isolted y mens of limiting dilution y plting six dilutions ontining ~6, 8, 4,, nd.5 ells. After expnsion under G48 seletion, popultions were nlyzed y flow ytometry. Clonl popultions showing highly homogeneous Venus levels were lso tested for shrna (dsred) indution y doxyyline tretment nd flow ytometry fter 4 48 h. Assessment of shrna effiy. knokdown ws ssessed in immortl Ros6-rtTA-M MEFs tht were trnsdued with pproximtely single opy of TRMPV (<% overll trnsdution). After seletion in G48 ( mg ml, resulting in >95% Venus + popultion), ells were mintined in medium ontining puromyin (.5 µg ml, Sigm-Aldrih), to ensure homogenous presene of the trnsgeni PuroR-ontining rtta-m llele, nd G48 ( mg ml ) nd were treted with or without doxyyline ( µg ml ) for 4 d efore lysis. For immunolotting, smples were lysed in Lemmli uffer, seprted y SDS-PAGE nd trnsferred to PVDF memrnes (Immoilon-P, Millipore), whih were inuted with ntiodies to (M-8, : in TBS with.5% Tween- nd.% Triton X-; Snt Cruz Biotehnology) nd β-tin (AC-5, :5,; Sigm-Aldrih). Densitometry ws performed using ImgeJ (US Ntionl Institutes of Helth, ville t To ssess ill luiferse knokdown, NIH3T3 mouse firolst ells were trnsdued with retrovirus tht expresses the luiferse (MSCV-ill-PGK- HygroR), seleted with hygromyin B ( µg ml, Rohe) nd reinfeted with MSCV/LTRmiR3-PIG (LMP) 6 ontining ontrol or luiferse-trgeted shrnas. After puromyin seletion ( µg ml ), luiferse tivity ws quntified in whole ell protein extrts using ill luiferse ssy (Promeg). Luiferse tivity (solute light units) ws normlized to totl protein levels. To determine knokdown effiy t single opy, sh.73 ws loned into the pcol-tgm trgeting vetor (P. Premsrirut, L.E.D., C. Miething, K.M., S.W.L et l., unpulished dt) nd eletroported into KH ES ells. After seletion, individul lones were expnded, infeted with MSCV-ill nd treted with or without doxyyline for 4 d. Luiferse tivity ws determined s ove nd normlized to the off-doxyyline ondition. Animl studies. The Cold Spring Hror Animl Cre nd Use Committee pproved ll mouse experiments inluded in this work. To generte Tet-On MLL-AF9;Nrs GD leukemi, hemtopoieti stem nd progenitor ells were isolted from C57BL/6 fetl livers (emryoni dys 3.5 5) nd retrovirlly trnsdued s previously desried 7,3. For leukemi trnsplnttion, 6 ells were injeted in the til vein of sulethlly irrdited reipient mie (5.5 Gy, 4 h efore trnsplnttion). Whole-ody ioluminesent imging ws performed using n IVIS system (Cliper LifeSienes) s desried 7. For shrna indution, mie were treted with doxyyline in oth drinking wter ( mg ml with % surose; Sigm-Aldrih) nd food (65 mg kg, Hrln Lortories). Leukemi mie were put to deth t terminl disese stge (whole ody signl in ioluminesent imging, severe leukoytosis in peripherl lood smers, moriund pperne) y CO. Leukemi ells were olleted from one mrrow (y flushing tiis nd femurs with DMEM) nd spleen (y gently mshing enlrged spleens in DMEM etween two glss slides) nd filtered through -µm ell striners (BD Flon). Resulting single ell suspensions were ultured, frozen (in 9% FBS, % DMSO) or diretly used in flow ytometry. For the ltter, erythroytes were lysed using 5 mm NH 4 Cl, mm KHCO 3,. mm EDTA, nd ells were resuspended in PBS ontining 5% FBS nd.% NN 3. For immunophenotyping, we used FITC-, PE-Cy5- or Pifi Blue onjugted ntiodies speifi for CD45. (Ly5.), M-, Gr-, CD9, B, CD3, TER9, -Kit nd S- (ll BioLegend); dt were olleted on Guv EsyCyte (Guv Tehnologies) or LSR-II (BD Biosienes) flow ytometers. Pooled negtive-seletion RNAi sreening in vivo. Tet-On MLL-AF9;Nrs GD AML ells were trnsdued with pool of 84 TRMPV onstruts using nture iotehnology doi:.38/nt.7

7 Nture Ameri, In. All rights reserved. onditions tht predominntly led to single retrovirl integrtion per ell (4.5% trnsdution in.5 7 ells totl; see Supplementry Fig. 6). To preserve the lirry representtion, minimum of 6 ells (>, ells per shrna) were infeted nd mintined throughout the experiment. After G48 seletion, 4 6 ells were trnsplnted into reipient mie, whih were left untreted or treted with doxyyline 4 d fter trnsplnttion, the time point t whih leukemi ells n typilly e deteted in one mrrow flow ytometry in this model. At moriund disese stge (~4 d fter trnsplnttion), AML ells were olleted from one mrrow nd spleen nd mixed in : rtio. For smples from doxyyline-treted mie, ~.5 7 Venus + dsred + ells were isolted using FACSAriII flow ytometer (BD Biosienes). Genomi DNA ws isolted y two rounds of phenol extrtion using PhseLok tues (5prime) followed y isopropnol preipittion. Deep sequening templte lirries were generted y PCR mplifition of shrna guide strnds using primers tht tg the produt with stndrd Solex/Illumin dpters (p7+loop, CAAGCAGAAGACGGCATACGATAGTGAAGCCACAGATGTA; p5+mir3, AATGATACGGCGACCACCGACTAAAGTAGCCCCTTGAATTC). For eh smple, DNA from t lest 5 6 ells ws used s templte in multiple prllel 5-µl PCR retions, eh ontining µg templte, AmpliTq Gold uffer,. mm of eh dntp,.3 µm of eh primer nd.5 U AmpliTq Gold (Applied Biosystems), whih were run using the following yling prmeters: 95 C for min; 35 yles of 95 C for s, 5 C for 3 s nd 7 C for 5 s; 7 C for 7 min. PCR produts (7 nt) were omined for eh smple, preipitted nd purified on % grose gel (QIAquik gel extrtion kit, Qigen). Lirries were nlyzed on n Illumin Genome Anlyzer t finl onentrtion of 8 pm; 8 nt were sequened using primer tht reds in reverse into the guide strnd (mir3eoriseq, TAGCCCCTTGAATTCCGAG GCAGTAGGCA). To provide suffiient seline for deteting shrna depletion in experimentl smples, we imed to quire >, reds per shrna in the T smple. In prtie, this depth of overge required ~ million reds per smple to ompenste for disprities in shrna representtion inherent in the pooled plsmid preprtion or introdued y PCR ises. With these onditions, we quired T selines of >, reds for 796 (96.6% of ll) shrnas. Sequene proessing ws performed using ustomized Glxy pltform 3. For eh shrna nd ondition, the numer of mthing reds ws normlized to the totl red numer per lne nd imported into dtse for further nlysis (Aess 3, Mirosoft). 6. Shin, K.J. et l. A single lentivirl vetor pltform for mirorna-sed onditionl RNA interferene nd oordinted trnsgene expression. Pro. Ntl. Ad. Si. USA 3, (6). 7. Zuer, J. et l. Mouse models of humn AML urtely predit hemotherpy response. Genes Dev. 3, (9). 8. Huesken, D. et l. Design of genome-wide sirna lirry using n rtifiil neurl network. Nt. Biotehnol. 3, 995 (5). 9. MCurrh, M.E. & Lowe, S.W. Methods for studying pro- nd ntipoptoti genes in nonimmortl ells. Methods Cell Biol. 66, 97 7 (). 3. Shmitt, C.A. et l. Disseting p53 tumor suppressor funtions in vivo. Cner Cell, (). 3. Tylor, J., Shenk, I., Blnkenerg, D. & Nekrutenko, A. Using Glxy to perform lrge-sle intertive dt nlyses. Curr. Proto. Bioinformtis,.5 (7). doi:.38/nt.7 nture iotehnology