Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes

Transcription

1 ISSN , Biochemistry (Moscow), 21, Vol. 3, No. 5, pp Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov, Ye. V. Prfyonov, 21, pulished in Biokhimiy, 21, Vol. 3, No. 5, pp Originlly pulished in Biochemistry (Moscow) On-Line Ppers in Press, s Mnuscript BM17-39, Mrch 26, 21. Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistnt Adipocytes I. S. Stfeev 1,2, *, S. S. Michurin 1,3, N. V. Podkuychenko 1,3, A. V. Vorotnikov 1,4, *, M. Yu. Menshikov 1, nd Ye. V. Prfyonov 1,2 1 Institute of Experimentl Crdiology, Ntionl Medicl Reserch Center for Crdiology, Moscow, Russi 2 Lomonosov Moscow Stte University, Fculty of Bsic Medicine, Moscow, Russi 3 Lomonosov Moscow Stte University, Fculty of Biology, Moscow, Russi 4 Lomonosov Moscow Stte University Medicl Center, Moscow, Russi e-mil: yuristfeev@gmil.com e-mil:.vorotnikov@icloud.com Received August 29, 217 Revision received Octoer 26, 217 Astrct Oesity nd ltent inflmmtion in dipose tissue significntly contriute to the development of insulin resistnce (IR) nd type 2 dietes. Here we studied whether the ntiinflmmtory interleukin-4 () cn restore insulin sensitivity in cultured 3T3-L1 dipocytes. The ctivity of key components of the insulin signling cscde ws ssessed y immunolotting using phospho-specific ntiodies to insulin receptor sustrte IRS1 (Tyr612), Akt (Thr3 nd Ser473), nd AS16 (Ser31) protein tht regultes trnsloction of the GLUT4 glucose trnsporter to the plsm memrne. IR ws induced in mture dipocytes with lumin-conjugted plmitte. IR significntly reduced phosphoryltion levels of ll the ovementioned proteins. Addition of to the culturing medium during IR induction led to dose-dependent stimultion of the insulin-promoted phosphoryltion of IRS1, Akt, nd AS16. At the optiml concentrtion of 5 ng/ml, fully restored ctivtion of the insulin cscde in IR cells, ut it did not ffect insulin signling ctivtion in the control cells. IL- 4 neither upregulted expression of key dipogenesis mrkers GLUT4 nd PPARγ nor cused lipid ccumultion in the dipocytes. These results demonstrte tht cn restore insulin sensitivity in dipocytes vi mechnisms not ssocited with induced dipogenesis or de novo formtion of lipid depots. DOI: /S Keywords: insulin resistnce, interleukin-4, inflmmtion Arevitions: Akt, protein kinse B; AS16, Akt sustrte of 16 kd; FBS, fetl ovine serum; GLUT4, type 4 glucose trnsporter; IKK, IκB kinse;, interleukin-4; IR, insulin resistnce; IRS1, type 1 insulin receptor sustrte; PA BSA, plmitic cid (PA) conjugte with ovine serum lumin (BSA); PCR, polymerse chin rection; PDK1, phosphoinositide-dependent protein kinse-1; PPARγ, peroxisome prolifertor-ctivted receptor γ; TLR, Toll-like receptor. * To whom correspondence should e ddressed. Oesity nd type 2 dietes contriute to disility nd mortlity in the contemporry society. Oesity provokes ltent inflmmtion in dipose tissue resulting in dipocyte hypertrophy nd development of hypoxi [1]. It lso ctivtes the oxidtive nd endoplsmic reticulum stresses in cells in response to overnutrition [2, 3]. These indirect effects nd direct stimultion of the Toll-like receptor 4 (TLR4) nd TLR-dependent inflmmtory signling y free ftty cids in dipocytes result in ctivtion of proinflmmtory cytokine expression tht mintin ltent inflmmtion vi utocrine signling in dipose tissue [4-6]. Inflmmtion contriutes to insulin resistnce (IR) development [7], including IR in dipose tissue []. Assocition etween IR nd inflmmtion hs een confirmed in mny clinicl nd experimentl studies. The mjor strtegy of the ntiinflmmtory therpy widely used in clinicl prctice is to suppress proinflmmtory signling using ntgonists of proinflmmtory cytokine receptors (nkinr, etnercept, etc.) or nonspecific ntiinflmmtory drugs (slicyltes). An lterntive pproch is eing developed since 21 nd is much less studied [9, 1]. It involves excittion of ntiinflmmtory signling, for exmple, y nturl ntiinflmmtory receptor gonists such s ntiinflmmtory cytokines, IL-13, etc. Here, we investigted the possiility to restore insulin signling y the ntiinflmmtory cytokine in experimentl IR model of 3T3-L1 dipocytes. 49

2 RESTORES INSULIN SENSITIVITY IN INSULIN-RESISTANT ADIPOCYTES 499 The insulin receptor is clssicl tyrosine kinse receptor involved in severl intrcellulr signling cscdes []. Its unique feture is the use of insulin receptor sustrte (IRS) protein nd its mjor IRS1 isoform s the immedite trget. Tyrosine phosphoryltion of IRS1 y insulin receptor initites different signling pthwys, including mjor insulin-dependent cscde tht ws the suject in our study. The tyrosine phosphorylted IRS1 (including Tyr612) trnsmits the signl to PI3 kinse, which genertes phosphtidylinositol 3,4,5-triphosphte (PIP3) to ctivte phosphoinositide-dependent kinse (PDK1), resulting in PDK1-dependent phosphoryltion of protein kinse B (Akt) on Thr3 tht is required for Akt ctivtion []. Complete ctivtion of Akt lso requires PI3 kinse dependent phosphoryltion on Ser473. Among other sustrtes, Akt phosphoryltes the Akt sustrte of 16 kd (AS16 protein), which regultes trnsloction of the insulin-dependent glucose trnsporter GLUT4 to the plsm memrne. This provides mechnism y which insulin ctivtes glucose uptke from the lood into dipocytes nd myocytes, which express GLUT4. IR is chrcterized y impired insulin stimultion of tyrosine phosphoryltion of IRS1 nd insulin signling. It is elieved to develop in response to IRS phosphoryltion on serine residues tht disturs tyrosine phosphoryltion of IRS. Vrious fctors, including inflmmtory pthwy s the mjor of them, trigger serine phosphoryltion of IRS [5-]. This leds to decresed insulin-induced phosphoryltion of AS16 nd trnsloction of GLUT4 to the plsm memrne, impired glucose uptke nd development of hyperglycemi nd type 2 dietes. Thus, ntiinflmmtory therpy hs potentil in prevention of type 2 dietes. is pleotropic cytokine produced mostly y ctivted T lymphocytes nd, to lesser extent, y mcrophges nd eosinophils. Acting in utocrine mnner to ctivte the STAT6 trnscription fctor, induces ntiinflmmtory phenotype in mcrophges nd T lymphocytes [11]. This ntiinflmmtory immune shift my counterct ltent inflmmtion nd IR development in dipose tissue. We hypothesized tht my hve potentil for IR therpy in dipose tissue. MATERIALS AND METHODS Study design. All experiments were performed in cultured mouse 3T3-L1 dipocytes with the firolst-like morphology. The cells were sujected to dipogenic differentition for 1 dys. The extent of differentition ws ssyed on dy 1 y stining the cells with the lipophilic dye Oil Red O. IR ws induced in the differentited dipocytes with plmitic cid in the sence or presence of different concentrtion (25, 5, nd 1 ng/ml); the cells were incuted with for 24 h. To estimte insulin sensitivity, the cells were incuted with 1 nm insulin for 2 min. Immunolotting ws used to ssess ctivtion of insulin cscde s n insulindependent increse in phosphoryltion of the mjor components of insulin cscde, such s IRS1, Akt, nd AS16. After optiml concentrtion of ws estlished, its effects on dipogenic differentition of 3T3-L1 predipocytes were studied. The cells were differentited y stndrd protocol in the presence or sence of the optiml concentrtion. Accumultion of neutrl lipids nd expression of dipogenic mrkers were then compred in these cells. Regents. 3T3-L1 cells (ATCC, USA) were cultured in DMEM with high glucose (4.5 g/liter; PnEko, Russi) supplemented with fetl ovine serum (FBS; Gico, USA), 2 mm L-glutmine, nd 6 U/ml penicillin/streptomycin (Gico). For dipogenic differentition, 3T3-L1 predipocytes were precultured with neworn clf serum (NBCS; Gico) nd differentited in the presence of insulin, isoutylmethylxnthine, dexmethsone, nd rosiglitzone (Sigm, USA). The extent of differentition ws estimted y stining the cells with the lipophilic dye Oil Red O (Merck Millipore, USA). qpcr ws performed using StepOnePlus cycler (Applied Biosystems, USA) nd SYBRGreen dye (Syntol, Russi). Totl RNA ws isolted from dipocytes with n RNesy Mini Kit (Qigen, USA). cdna ws synthesized with RevertAid H Minus First Strnd cdna Kit (Thermo Fisher Scientific, USA). Primers (Evrogen, Russi) used for mplifiction re shown in the tle. Immunolotting ws performed using primry ntiodies ginst IRS1 phospho-tyr612 (#4416; Thermo Primers for qpcr Trget gene forwrd Primer sequence (5-3 ) reverse GLUT4 PPARγ GAPDH AGAGAGAGCGTCCAATGTCC TCTCAGAGGGCCAAGGATTC CGACTTCAACAGCAACTCCCACTCTTCC ACTAAGAGCACCGAGACCAAC GCAGCAGGTTGTCTTGGATG TGGGTGGTCCAGGGTTTCTTACTCCTT

3 5 STAFEEV et l. Fisher Scientific); IRS1 (#347), Akt phospho-thr3 (#9275), Akt phospho-ser473 (#46), AS16 phospho- Ser31 (#619), nd AS16 (#267), ll from Cell Signling (USA); Akt (6414) nd horserdish peroxidse-conjugted secondry ntiody ginst rit Ig (6721) (Acm, UK). Culturing nd differentition of 3T3-L1 predipocytes. 3T3-L1 predipocytes were cultured in DMEM supplemented with 4.5 g/liter glucose, 1% FBS, 2 mm L-glutmine, nd penicillin/streptomycin (6 U/ml). Adipogenic differentition ws performed ccording to Zeisch et l. [12]. Briefly, 3T3-L1 predipocytes were cultured to ~9% confluency in DMEM s ove; the medium ws then replced with DMEM contining 1% NBCS insted of FBS (dys -2 of differentition). On dy 3, the medium ws replced with DMEM supplemented with 1% FBS,.5 mm dexmethsone,.25 µm isoutylmethylxnthine, 2 µm rosiglitzone, nd 1 µg/ml insulin. The cells were cultured for nother 2 dys (dys 5-7 of differentition) nd then trnsferred to the initil DMEM medium. On dy 1, the cells were used for experiments or fixed with 4% formldehyde for 1 h nd stined with Oil Red O. Lipid-induced IR model. Plmitic cid (PA) conjugted with ovine serum lumin (BSA) ws used s clssic inducer of IR in the high-ft diet model. Conjugtion with BSA increses the soluility of PA nd its sorption y the cells. PA BSA conjugte ws prepred s descried in [13] y dding.2 M PA solution in 96% ethnol to 2% BSA solution in the Kres Ringer uffer (12 mm NCl, 5 mm KCl, 1.1 mm MgCl 2 6H 2 O, 25 mm NHCO 3, ph 7.4) t 1 : 25 rtio. The mixture ws crefully stirred for 1 h; the ph of the rection mixture ws mintined t 7.4. Mture 3T3-L1 dipocytes were incuted for 24 h in FBS-free DMEM (1 g/liter glucose, 2 mm L-glutmine, 6 U/ml penicillin/streptomycin) contining.1% BSA. PA BSA ws then dded to finl concentrtion of 3 µm PA. The cells were cultured for 24 h in the sme medium nd then stimulted with 1 nm insulin for 2 min. The medium ws spirted; the cells were wshed three times with n ice-cold PBS nd lysed on ice in RdioImmuno Precipittion Assy (RIPA) uffer (15 mm NCl, 1% Triton X-1,.5% sodium deoxycholte,.1% SDS, 5 mm Tris-HCl, ph.) contining protese inhiitor cocktil (complete Tlets EASYpck; Roche, Switzerlnd) nd phosphtse inhiitors (1 mm sodium glycerophosphte, 2 mm sodium pyrophosphte, 1 mm sodium fluoride, nd 1 mm sodium orthovndte). The lystes were centrifuged for 1 min t 16,g, nd superntnts were crefully collected y seprting them from the pellets nd floting lipids. Immunolotting. Cell lystes were seprted y Lemmli SDS-PAGE [14] nd proteins were electrotrnsferred onto polyvinylidene fluoride (PVDF) memrnes t 1 A/h. The memrnes were locked for t lest 2 h in 5% ft-free milk in Tris-uffered sline (TBS) contining.1% Tween 2 (TBST) nd incuted in TBST contining 1% ft-free milk with primry nd secondry ntiodies in dilutions recommended y vendor. The protein nds were visulized using the Clrity ECL regent kit (BioRd, USA) nd Fusion FX gel-documenting system (Viler Lourmt, Frnce) in the ccumulting regime. Quntittion ws performed with the GelAnlyzer21 progrm. The results re presented s histogrms with the stimultion of phosphoryltion t the ctivting residue prmeter tht corresponds to the increse in protein phosphoryltion t given residue in response to insulin stimultion. For this, reltive levels of protein phosphoryltion (phosphorylted/totl protein) efore nd fter cell stimultion with insulin were determined. Ech of the otined vlues ws normlized to the lod control (usully, vinculin); the rtios were then clculted etween the vlues otined for stimulted nd control cells. RT-qPCR. Totl RNA ws isolted from differentited 3T3-L1 dipocytes using n RNesy Mini kit (Qigen). RNA concentrtion nd purity were determined using Nnodrop 2 micro spectrometer (Thermo Fisher Scientific). The isolted totl RNA nd the RevertAid H Minus First Strnd cdna kit (Thermo Fisher Scientific) were used to synthesize cdna. Ech rection mixture contined 1 µg of totl RNA, so tht the mount of synthesized cdna in the rection tues ws considered to e the sme. Neutrl lipid stining with Oil Red O. To visulize the mture dipocytes, 3T3-L1 cells were stined with the lipophilic dye Oil Red O on dy 1 of differentition. The cells were fixed for 3 min in 4% formldehyde nd then wshed 3 times with PBS, stined for 5 min with the dye, nd wshed two times with deionized wter. After spirtion of the dye, the cells were exmined under n Axiovert 2 light microscope (Crl Zeiss, Germny). Oil Red O ws extrcted from the cells with isopropnol, nd the opticl density of the extrcts ws determined t 6 nm using Eppendorf BioPhotometer (Eppendorf, Germny). Sttisticl nlysis. Sttisticl dt tretment ws performed using MS Excel 27. The results re shown s the men ± stndrd devition. The significnce of differences etween the groups ws estimted using the twotiled t-test with different smple dispersion; the differences were considered significnt t p <.5. RESULTS restores ctivting phosphoryltion of IRS1 in cells with lipid-induced IR. First, we studied how ffects the initil step of insulin signling in stndrd model of lipid-induced IR. IR ws induced y treting mture 3T3-L1 dipocytes with PA BSA conjugte. To estimte the extent of IR, insulin-stimulted phosphory-

4 p-irs-1 (Y612) IRS1 Vinculin RESTORES INSULIN SENSITIVITY IN INSULIN-RESISTANT ADIPOCYTES Insulin, 1 nm PA BSA, 2 µm ng/ml Stimultion of IRS1 phosphoryltion t Tyr612, rel. units р =.135 Control PA BSA + 25 ng/ml + 5 ng/ml + 1 ng/ml Fig. 1. stimultes insulin-dependent IRS1 phosphoryltion t Tyr612 in 3T3-L1 dipocytes with experimentl lipid-induced IR: ) immunolotting; ) sttistics of insulin-stimulted phosphoryltion of IRS1 (n = 3). IR ws induced with PA BSA for 24 h in the presence or sence of the indicted concentrtions in the culturing medium s descried in Mterils nd Methods. ltion of IRS1 on Tyr612 ws monitored y immunolotting. Figure 1 shows tht in the untreted cells, insulin incresed Tyr612 phosphoryltion ~3-fold. In PA BSAtreted cells, insulin did not ffect Tyr612 phosphoryltion (p =.2 s compred to the untreted control cells). These results indicte tht PA BSA efficiently induced IR in 3T3-L1 dipocytes. Activtion of inflmmtory response is n importnt mechnism of IR development cused y lipid overlod. We studied the possiility to restore insulin cscde ctivtion with the ntiinflmmtory cytokine under the IR conditions. While did not exert ny significnt effect t 25 ng/ml (p =.3); 5 ng/ml of restored insulin-induced phosphoryltion of Tyr612 in IRS1 (p =.14) (Fig. 1, nd ). Further increse in concentrtion up to 1 ng/ml in the culturing medium produced n opposite effect y ttenuting the insulininduced stimultion of Tyr612 phosphoryltion (Fig. 1). Although the underlying mechnism remins uncler, our results indicte tht t concentrtion of 5 ng/ml efficiently restored the ility of insulin to stimulte IRS1 phosphoryltion in resistnt 3T3-L1 dipocytes. restores Akt phosphoryltion in cells with lipidinduced IR. To investigte how ffects intermedite steps of insulin signling, we explored phosphoryltion of two Akt ctivting sites. Insulin stimulted phosphoryltion of Thr3, tht is essentil for Akt ctivtion, y ~6- fold in norml dipocytes, wheres this stimultion ws only 4-fold in resistnt dipocytes (p <.1) (Fig. 2, nd ). Similrly, tretment with insulin resulted in -9- fold increse in Akt phosphoryltion on Ser473 in control cells, while it ws only 2-fold in cells with IR (p <.1) (Fig. 2, c nd d). Tken together, these results demonstrte tht the ility of insulin to stimulte PI3 kinse nd phosphoryltion of Akt is considerly decresed in IR. ctivted, in concentrtion-dependent mnner, phosphoryltion of Akt t oth Thr3 (Fig. 2, nd ) nd Ser473 (Fig. 2, c nd d) in cells with IR. The effect of ws not uniform. At low concentrtions (25 ng/ml) the formlly clculted stimultion of Akt phosphoryltion ws lower thn in the sence of nd did not exceed 1.5-fold. incresed oth sl nd insulin-dependent Akt phosphoryltion to such n extent tht differences etween the two vlues vnished. This effect might e expected if these vlues reflect mximl levels of Akt phosphoryltion. At higher concentrtions (5 nd 1 ng/ml), did not ffect sl phosphoryltion of Akt, ut incresed the insulin-induced phosphoryltion, presumly to the mximl level, i.e. comprle to tht in stimulted control cells without IR (Fig. 2, nd c). As result, completely restored insulin-induced phosphoryltion of Thr3 in resistnt cells to the levels oserved in cells without IR (Fig. 2), nd incresed Ser473 phosphoryltion stimulted y insulin ~2-fold (Fig. 2d). Yet, 5 ng/ml did not ffect the profile of Akt phosphoryltion in the sence of IR (Fig. 2, nd c, right pnel). Thus, restores the ility of insulin to ctivte PI3 kinse pthwy nd phosphoryltion of Akt in 3T3- L1 dipocytes under conditions of lipid-induced IR with the mximl effect oserved t 5 ng/ml of. restores Akt-dependent phosphoryltion of AS16 in lipid-induced IR. Akt phosphoryltion of AS16 initites GLUT4 trnsloction to the plsm memrne nd glucose trnsport into the cells. Insulin only slightly

5 52 STAFEEV et l. p-akt (T3) Akt Vinculin Insulin, 1 nm PA BSA, 2 µm Stimultion of Akt phosphoryltion t Thr3, rel. units р = c p-akt (S473) Akt Vinculin ng/ml Insulin, 1 nm PA BSA, 2 µm ng/ml Stimultion of Akt phosphoryltion t Ser473, rel. units Control PA BSA + 25 ng/ml d р =.156 Control PA BSA + 25 ng/ml + 5 ng/ml + 5 ng/ml + 1 ng/ml + 1 ng/ml Fig. 2. restores insulin-dependent phosphoryltion of Akt t Thr3 (, ) nd Ser473 (c, d) in 3T3-L1 dipocytes with experimentl lipid-induced IR:, c) immunolotting;, d) sttistics of insulin-stimulted phosphoryltion of Akt t Thr3 (n = 3) or Ser473 (n = 3), respectively. p-as16 (S31) AS-16 Vinculin Insulin, 1 nm PA BSA, 2 µm ng/ml Stimultion of AS16 phosphoryltion t Ser31, rel. units р =.73 Control PA BSA + 25 ng/ml + 5 ng/ml + 1 ng/ml Fig. 3. stimultes insulin-dependent phosphoryltion of AS16 t Ser31 in 3T3-L1 dipocytes with experimentl lipid-induced IR: ) immunolotting; ) sttistics of insulin-stimulted phosphoryltion of AS16 (n = 3).

6 RESTORES INSULIN SENSITIVITY IN INSULIN-RESISTANT ADIPOCYTES 53 (1.2-fold) stimulted phosphoryltion of the key Ser31 residue in AS16 in 3T3-L1 dipocytes (Fig. 3), which my e due to the presence of other Akt-phosphorylted residues in AS16 tht hve different sensitivity to insulin [15, 16]. IR impired stimultion of Ser31 phosphoryltion nd decresed it ~2-fold (p =.4) (Fig. 3). In cells with experimentlly induced IR, incresed the insulin-induced, ut not sl phosphoryltion of Ser31 in AS16 (Fig. 3). In the presence of 25 or 5 ng/ml, insulin stimulted this phosphoryltion ~1.5-fold, which is higher thn in the control cells in the sence of IR (Fig. 3). This effect ws significnt for oth concentrtions (p =.3 nd p <.1, respectively). However, t 1 ng/ml, filed to produce significnt effect on AS16 phosphoryltion (p =.9). In the sence of IR, tretment of cells with 5 ng/ml did not ffect the profile of AS16 phosphoryltion t Ser31 (Fig. 3, right pnel). Thus, restores the ility of insulin to ctivte insulin- nd Akt-dependent phosphoryltion of AS16 in 3T3-L1 dipocytes under conditions of lipid-induced IR. Both 25 nd 5 ng/ml concentrtions were sufficient to produce mximl effect. does not ffect ccumultion of neutrl lipids y 3T3-L1 dipocytes. Action of severl ntidietic compounds (thizolidinediones, metformin) tht restore sensitivity of dipose cells to insulin is due to formtion of new ft depots vi ctivtion of dipogenic differentition of the precursor cells [17]. To explore the effect of on dipogenic differentition of 3T3-L1 predipocytes, the cells were sujected to stndrd differentition procedure in the presence or sence of 5 ng/ml. The extent of differentition ws determined t the dy 1 y stining the lipid droplets with the lipophilic dye Oil Red O followed y quntifiction of the dye extrcted from cells with isopropnol. The light microscopy nlysis reveled no effect of 5 ng/ml of on ccumultion of neutrl lipids y predipocytes (Fig. 4, nd ). By the dy 1 of differentition, ~% of cells contined neutrl lipids stined with Oil Red O irrespectively of the presence or sence of in the culturing medium during differentition (Fig. 4, c nd d). Quntifiction of the extrcted Oil Red O lso reveled no difference etween the cells differentited in the presence or sence of (Fig. 4e). Predipocytes tht were cultured for 1 dys without induction of differentition contined twice less lipophilic dye thn the cells fter dipogenic differentition (Fig. 4e, control). This indictes tht does not stimulte ccumultion of neurl lipids in 3T3-L1 cells (t lest, t the concentrtion of 5 ng/ml), most likely due to its inility to stimulte dipogenic differentition. only slightly decreses GLUT4 expression nd does not ffect PPARg expression. To prove inility of to induce or to ffect the rte of dipogenic differentition, we determined the mrna levels of the key dipogenic mrkers GLUT4 nd PPARγ (peroxisome prolifertor-ctivted receptor γ) during dipogenic differentition of 3T3-L1 cells in the presence or sence of 5 ng/ml. As expected, expression of oth GLUT4 nd PPARγ considerly incresed strting from the dy 6 of dipogenic differentition (Fig. 5). However, we did not oserve mrked differences in the levels of GLUT4 or PPARγ mrnas (Fig. 5, nd, respectively) in cells differentited in the presence or sence of 5 ng/ml. Only t the dy 1, there ws slight, ut significnt decrese, in the GLUT4 mrna level in cells differentited in the presence of (p =.3). This is in greement with no differences in ccumultion of neutrl lipids oserved ove, indicting tht neither induces, nor stimultes dipogenic differentition of 3T3-L1 cells. DISCUSSION Here, we demonstrted tht stimultes ctivity of insulin signling pthwy in 3T3-L1 dipocytes. When used in the optiml concentrtion of 5 ng/ml, mximlly ctivted phosphoryltion of ll the key components of the insulin pthwy (IRS1, Akt, nd AS16) nd restored cell sensitivity to insulin under IR conditions. At this concentrtion only slightly ffected insulin cscde ctivity in the control cells in the sence of IR, did not upregulte expression of GLUT4 nd PPARγ (dipogenesis mrker genes), nd produced no effect on dipogenic differentition of 3T3-L1 predipocytes. Therefore, restortion of insulin sensitivity y is most likely due to its signling ctivity nd does not proceed vi formtion of new ft depots. The positive ction of on insulin sensitivity is likely relted to the specifics of mechnisms of lipidinduced IR development in dipocytes. It is likely tht free ftty cids ct distinctively in these cells thn in muscle nd liver cells tht develop lipotoxicity nd ctivte typicl protein kinse C isoforms [1]. The mjor trget of free ftty cid in dipose tissue is the type 4 Toll-like receptors (TLR4) tht trigger clssicl inflmmtory cscde vi IκB kinse/nucler fctor κb (IKK/NF-κB) [5- ]. Activtion of IKK/NF-κB upregultes expression of proinflmmtory cytokines tht ct s utocrine fctors nd promote ltent inflmmtion in dipose tissue [5, 6]. This increses ctivity of stress-ctivted kinses (JNK, IKK) tht medite inhiitory serine phosphoryltion of IRS1, impir insulin signling nd glucose uptke y ft cells, leding to chronic metolic disorders [7]. is clssic ntiinflmmtory cytokine. Its signling mechnism is not yet completely understood, ut links to ctivtion of the ntiinflmmtory trnscription fctor STAT6, which cts s functionl ntgonist of the

7 54 STAFEEV et l. c d e.25.2 Opticl density, rel. units Control Adipogenic differentition Adipogenic differentition + Fig. 4. does not ffect dipogenic differentition of 3T3-L1 predipocytes: -d) phse contrst microscopy of undifferentited 3T3-L1 predipocytes cultured in the () sence or () presence of 5 ng/ml, nd cells fter 1 dys of dipogenic differentition in the (c) sence or (d) presence of 5 ng/ml. The cells were stined with Oil Red O; e) quntifiction of the neutrl lipid content t the dy 1 of differentition (opticl density of Oil Red O extrcts t 6 nm). The control represents verged dt from () nd ().

8 14 12 RESTORES INSULIN SENSITIVITY IN INSULIN-RESISTANT ADIPOCYTES 55 р =.22 7 GLUT4 mrna levels, rel. units PPARγ mrna levels, rel. units Dy Dy 4 Dy 6 Dy 1 Dy Dy 4 Dy 6 Dy 1 Adipogenic differentition Adipogenic differentition + Adipogenic differentition Adipogenic differentition + Fig. 5. Effect of on the expression of dipogenic mrker genes () GLUT4 nd () PPARγ in 3T3-L1 dipocytes. The corresponding mrna levels were determined y qpcr (n = 3) t different stges of dipogenic differentition in the presence or sence of 5 ng/ml. mjor inflmmtory trnscription fctor NF-κB [11]. STAT6 ctivtes expression of the ntiinflmmtory cytokines (IL-13, IL-33, TGFβ, etc.), inhiits ctivity of proinflmmtory trnscription fctors, nd restrins proinflmmtory cytokine expression, therey suppressing ltent inflmmtion in dipose tissue. This justifies implementtion of s n insulin-sensitizing gent in the model of lipid-induced IR in dipocytes. Our results experimentlly support this hypothesis. We used stndrd cell model of lipid-induced dipose IR to revel dose dependence of insulin-sensitizing ctivity of. The concentrtion of 25 ng/ml ws insufficient to restore insulin-dependent phosphoryltion of IRS1 nd Akt (Figs. 1 nd 2). Only in cse of AS16, t concentrtion of 25 ng/ml restored insulindependent phosphoryltion of Ser31 (Fig. 3). Becuse Ser31 is one of severl phosphoryltion sites for Akt in AS16 [15, 16], the possiility still exists tht phosphoryltion of Ser31 lone does not fully reflect the ctivtory effect of insulin on the totl insulin-dependent phosphoryltion of AS16. In resistnt dipocytes, 5 ng/ml of ws sufficient nd optiml to restore ctivtion of the key components of insulin cscde up to the levels oserved in control cells without IR (Figs. 1-3). The only exception ws insulin-dependent phosphoryltion of Ser473 in Akt, which significntly incresed ut did not rech control vlues (Fig. 2, c nd d). However, Tyr3 locted in ctivtion loop of the enzyme is most essentil for Akt ctivtion y phosphoryltion, wheres Ser473 locted in the hydrophoic motif is uxiliry [19]. While Thr3 is phosphorylted y PDK1 kinse in the context of clssic insulin-ctivted PI3 kinse pthwy, phosphoryltion of Ser473 in Akt is medited y the mmmlin trget of rpmycin complex 2 (mtorc2) [2]. The mechnisms of mtorc2 ctivtion re not completely cler nd involve oth insulin-sensitive nd insensitive components tht my ccount for prtil effect of on Akt phosphoryltion oserved in our work. Incresing concentrtion to 1 ng/ml did not enhnce insulin- sensitizing ctivity of. The stimultory effect of on tyrosine phosphoryltion of IRS1 ws even lower t 1 ng/ml thn t 5 ng/ml. This my e due to existence of severl mechnisms of ction in cells, some of which my not depend on insulin or PI3 kinse [11]. The signling pthwys ctivted y in dipocytes re incompletely understood nd wrrnt further studies to explin the optiml effects of intermedite (5 ng/ml) concentrtions on insulin sensitivity, t lest in the cell model. It is well known tht the mjor ntidietic drugs, such s metformin nd thizolidinediones, ct vi incresed dipogenesis nd de novo formtion of insulinsensitive ft depots [16]. Notly, neither ffected dipogenic differentition, nor stimulted expression of dipogenic mrkers in cultured dipocytes, indicting tht cts vi different mechnisms. Most likely, it ctivtes ntiinflmmtory signling, therey creting new perspectives to control insulin sensitivity in dipose tissue. In conclusion, we hve demonstrted potentil to counterct IR in dipose cells. When used in optiml concentrtions, restored insulin sensitivity ut did not ffect dipogenic differentition or insulin signling under norml conditions. Future studies re needed to confirm eneficil effect of in humn primry dipocytes, to develop n -sed gene therpeutic pproch nd vlidte it in high-ft diet niml model.

9 56 STAFEEV et l. Acknowledgments This work ws supported y the Russin Foundtion for Bsic Reserch nd the Ntionl Intellectul Development Foundtion for Supporting Scientific Activity of Students, Ph.D. Cndidtes, nd Young Scientists (project ). The uthors hve no pprent or potentil conflicts of interest relted to the puliction of this rticle. Note dded in proof While our mnuscript ws in preprtion, the pper of Lee, S. E., et l. (217) Dietes, 66 (11), , ppered showing tht IL-13, n ntiinflmmtory T- helper type 2 cytokine similr to, improves systemic glucose metolism nd insulin sensitivity in high-ftdiet mouse model y incresing expression of growth differentition fctor 15 (GDF15) vi Jk/STAT6 pthwy in dipose tissue. This is consistent with our results otined in the model cells nd further supports potentil of for therpy of insulin resistnce. REFERENCES 1. Tryhurn, P. (213) Hypoxi nd dipose tissue function nd dysfunction in oesity, Physiol. Rev., 93, Ozcn, L., nd Ts, I. (212) Role of endoplsmic reticulum stress in metolic diseses nd other disorders, Annu. Rev. Med., 63, Mtsud, M., nd Shimomur, I. (213) Incresed oxidtive stress in oesity: implictions for metolic syndrome, dietes, hypertension, dyslipidemi, therosclerosis nd cncer, Oes. Res. Clin. Prct., 7, e33-e Stripy, P., nd Loskutoff, D. J. (23) Monocyte chemottrctnt protein 1 in oesity nd insulin resistnce, Proc. Ntl. Acd. Sci. USA, 1, Reilly, S. M., nd Sltiel, A. R. (214) A complex role for dipose tissue mcrophges, Nt. Rev. Endocrinol., 1, Stfeev, I. S., Menshikov, M. Y., Tsokolev, Z. I., Shestkov, M. V., nd Prfyonov, Ye. V. (215) Moleculr mechnisms of ltent inflmmtion in metolic syndrome. Possile role of sirtuins nd peroxisome prolifertor-ctivted receptor type γ, Biochemistry (Moscow),, Hotmisligil, G. S., nd Ery, E. (2) Nutrient sensing nd inflmmtion in metolic diseses, Nt. Rev. Immunol.,, Stfeev, I. S., Vorotnikov, A. V., Rtner, E. I., Menshikov, M. Y., nd Prfyonov, Ye. V. (217) Ltent inflmmtion nd insulin resistnce in dipose tissue, Int. J. Endocrinol., 217, Ricrdo-Gonzlez, R. R., Red Egle, A., Odegrd, J. I., Jouihn, H., Morel, C. R., Heredi, J. E., Mukundl, L., Wu D., Locksley, R. M., nd Chwl, A. (21) IL- 4/STAT6 immune xis regulte peripherl nutrient metolism nd insulin sensitivity, Proc. Ntl. Acd. Sci. USA, 17, Drkhl, P., Go, M., M, Y., nd Liu, D. (215) Blocking high-ft diet-induced oesity, insulin resistnce nd ftty liver y overexpression of IL-13 gene in mice, Int. J. Oes., 39, Luzin, I. G., Keegn, A. D., Heller, N. M., Rook, G. A. W., She-Donohue, T., nd Atms, S. P. (212) Regultion of inflmmtion y interleukin-4: review of lterntives, J. Leuk. Biol., 92, Zeisch, K., Voight, V., Witsch, M., nd Brndsch, M. (212) Protocol for effective differentition of 3T3L1 cells to dipocytes, Anl. Biochem., 425, Svederg, J., Bjorntorp, P., Smith, U., nd Lonnroth, P. (199) Free-ftty cid inhiition of insulin inding, degrdtion nd ction in isolted rt heptocytes, Dietes, 39, Lemmli, U. K. (197) Clevge of structurl proteins during the ssemly of the hed of cteriophge T4, Nture, 15, Kne, S., Sno, H., Liu, S. C. H., Asr, J. M., Lne, W. S., Grner, C. C., nd Lienhrd, G. E. (22) A method to identify serine kinses sustrtes. Akt phosphoryltes novel dipocyte protein with R GTPse-ctivting protein (GAP) domin, J. Biol. Chem., 277, Sno, H., Kne, S., Sno, E., Miine, C. P., Asr, J. M., Lne, W. S., Grner, C. W., nd Lienhrd, G. E. (23) Insulin-stimulted phosphoryltion of R GTPse-ctivting protein regulted GLUT4 trnsloction, J. Biol. Chem., 27, Huner, H. (22) The mode of ction of thizolidinediones, Dietes Met. Res. Rev., 1, S1-S Smuel, V. T., nd Shulmn, G. I. (212) Integrting mechnisms for insulin resistnce: common threds nd missing links, Cell, 14, Perce, L. R., Komnder, D., nd Alessi, D. R. (21) The nuts nd olts of AGC protein kinses, Nt. Rev. Mol. Cell. Biol., 11, Srssov, D. D., Ali, S. M., nd Stini, D. M. (25) Growing roles for the mtor pthwy, Curr. Opin. Cell. Biol., 17,